ID: 1142324775

View in Genome Browser
Species Human (GRCh38)
Location 16:89407517-89407539
Sequence CCTAAGAAACAAACTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142324772_1142324775 11 Left 1142324772 16:89407483-89407505 CCTCGTCAGGGCTGTTGCACGAC No data
Right 1142324775 16:89407517-89407539 CCTAAGAAACAAACTCCTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 163
1142324771_1142324775 20 Left 1142324771 16:89407474-89407496 CCACGTTCGCCTCGTCAGGGCTG 0: 1
1: 0
2: 1
3: 4
4: 70
Right 1142324775 16:89407517-89407539 CCTAAGAAACAAACTCCTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142324775 Original CRISPR CCTAAGAAACAAACTCCTTC TGG Intronic
901189635 1:7401519-7401541 TCTAAAAAAAAAAATCCTTCTGG + Intronic
901678923 1:10902054-10902076 CCTCAGAACCTGACTCCTTCGGG + Intergenic
902786113 1:18733722-18733744 CCCAGGAAACAAACTACTGCTGG + Intronic
909498508 1:76306659-76306681 CCAAAAAAAAAAACTCCTTTGGG - Intronic
910283468 1:85527366-85527388 CCTAAGAAACCAACCTTTTCAGG + Intronic
913314480 1:117538555-117538577 CCTTATTAACAAACGCCTTCAGG - Intergenic
913601652 1:120426916-120426938 CCTAACTAAGAAACTCCTGCTGG - Intergenic
913992764 1:143630106-143630128 CCTAATTAAGAAACTCCTGCTGG + Intergenic
914085393 1:144449684-144449706 CCTAACTAAGAAACTCCTGCTGG + Intronic
914191280 1:145413658-145413680 CCTAACTAAGAAACTCCTGCTGG + Intergenic
914206546 1:145535624-145535646 CCTAAGAAACTAACCTTTTCAGG - Intergenic
914362842 1:146950497-146950519 CCTAACTAAGAAACTCCTGCTGG - Intronic
914589212 1:149091662-149091684 CCTAACTAAGAAACTCCTGCTGG + Intronic
917151675 1:171952403-171952425 CCGAAAAAACAAACTCTTTGTGG - Intronic
920984224 1:210870144-210870166 TCTATGAAAAAAACTCCTTTTGG - Intronic
921193437 1:212729937-212729959 CTTAAAAAAAAAAATCCTTCCGG - Intronic
924053811 1:240104763-240104785 CCTAAGAATGAAAGTCCTGCTGG + Intronic
924887205 1:248231290-248231312 CCTAGGAAACAAAATCCATGTGG - Intergenic
1064868682 10:19912112-19912134 CCAAAGAAGCAAAATGCTTCAGG - Intronic
1065280515 10:24133014-24133036 TCTAAGAAACAAGCTCCTGCTGG - Intronic
1065980756 10:30894274-30894296 TTTAAGAATCAAACTGCTTCGGG + Intronic
1068909274 10:62360761-62360783 TCTATGAAACCAGCTCCTTCCGG - Intergenic
1068922737 10:62501901-62501923 CTTAAAAAACAAACTCCCTTAGG + Intronic
1069126936 10:64647232-64647254 GTAAAGAAAGAAACTCCTTCAGG + Intergenic
1072537342 10:96373651-96373673 CCTGAGAAACATACTGCTGCCGG + Exonic
1074849206 10:117425405-117425427 CCTCAGAAACTAATTCCTGCTGG - Intergenic
1076008192 10:126965056-126965078 CATCAGACACAAACTCCTTGAGG - Intronic
1076776989 10:132703358-132703380 CCCCAGAAACCAACTCCATCAGG - Intronic
1078083487 11:8220164-8220186 CCTAAGTTAGAAACTTCTTCTGG + Intergenic
1086614680 11:88802184-88802206 ACTAAGAAAAACACTTCTTCTGG + Intronic
1087733594 11:101806557-101806579 CATCAGAAACAAACTTCCTCAGG - Intronic
1090078536 11:123594751-123594773 CCAAAGAGACATTCTCCTTCAGG + Exonic
1090475531 11:127016688-127016710 GCTAAGAAGAAAACACCTTCAGG - Intergenic
1090850023 11:130563943-130563965 CCTAAGACCCAAGCTCCTCCCGG - Intergenic
1091954971 12:4632561-4632583 CCTAAGAAACACTCTCCACCAGG - Intronic
1096751947 12:53765398-53765420 TCTAAAAAAAAAACTCCTTAGGG - Intergenic
1098083152 12:66811355-66811377 CCTAAGACACATACACCTTCAGG - Intergenic
1098514182 12:71354587-71354609 CCTCAGAATCAAATGCCTTCAGG + Intronic
1099098481 12:78405617-78405639 CCTAAGAATCAATCTTATTCAGG - Intergenic
1101546723 12:105720345-105720367 CTTTAAAAACAAAGTCCTTCTGG - Intergenic
1103011426 12:117461289-117461311 CCTAACAAACAAACTCATTGGGG + Exonic
1103391287 12:120575399-120575421 CCTAAGGAACAAACAGCTTATGG + Intronic
1103670410 12:122610091-122610113 CCCAAGAAACGGATTCCTTCTGG + Intronic
1106332485 13:28752160-28752182 TCTAAAAAACAAACTTCTTCGGG + Intergenic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1109784824 13:67159744-67159766 ACTAAAAAACAAATTCATTCAGG + Intronic
1114889498 14:26900007-26900029 CCTAAGGAATAAATTCCTTAAGG - Intergenic
1115493237 14:33979134-33979156 GCTAGGAAACAACCTCCCTCAGG - Intronic
1116242424 14:42362219-42362241 CCTATGATAACAACTCCTTCTGG + Intergenic
1117145678 14:52835100-52835122 CCTTAGAAACAAACTAATTGTGG + Intergenic
1118646453 14:67845796-67845818 CCTACAAAAGAAACTCCATCAGG - Intronic
1120748505 14:88175307-88175329 CCCAAGAAACAAAATCATTCAGG + Intergenic
1120774522 14:88419269-88419291 ACCAAGAAACTACCTCCTTCAGG - Intronic
1121039081 14:90730282-90730304 CCTAAAAAACCAACTTCCTCAGG + Intronic
1122562667 14:102627684-102627706 CCAAAAAAACAAACTTCTTTTGG + Intronic
1123725890 15:23101198-23101220 CCTAATCGACACACTCCTTCTGG - Intergenic
1125097781 15:35874359-35874381 CCTGAACAACAAACTCCATCAGG + Intergenic
1126137289 15:45403587-45403609 CCTAAGAGGCAAACGCCTCCGGG - Intronic
1127201107 15:56652080-56652102 ACTAAGAAACAAACTACTTGCGG + Intronic
1127934841 15:63627216-63627238 TCTAAGAAACAAAATCCCTATGG + Intronic
1128182081 15:65612933-65612955 CCTAAGTAACACAGTCCTCCTGG - Intronic
1130926212 15:88387840-88387862 CCTGAGATACAAAGCCCTTCTGG + Intergenic
1142324775 16:89407517-89407539 CCTAAGAAACAAACTCCTTCTGG + Intronic
1143838931 17:9715157-9715179 CCACAGAAACAAAGTCCTTAAGG + Intronic
1144515285 17:15913181-15913203 CCTAAGAATCCAAGCCCTTCTGG - Intergenic
1149161852 17:53703339-53703361 CCTGGGAAACAAATTTCTTCTGG + Intergenic
1149576306 17:57715912-57715934 CCTAGGAAACCAGCTCCATCTGG + Intergenic
1149771863 17:59328777-59328799 ACTTCTAAACAAACTCCTTCTGG - Intergenic
1151925769 17:77195153-77195175 ACAAACAAACAAACACCTTCTGG - Intronic
1155165895 18:23232236-23232258 CCTAAGTAACATTCTCCATCTGG + Intronic
1155561050 18:27077594-27077616 ACTAAGAAATAAACTTCTTTCGG + Intronic
1156841179 18:41611353-41611375 CCAAAGAAACAAAGTGCTTCAGG - Intergenic
1157916265 18:51666838-51666860 CCACAGACACACACTCCTTCTGG + Intergenic
1159032443 18:63245174-63245196 TCTAAGAAGAAAACTCTTTCTGG - Intronic
1160003726 18:75052661-75052683 CCTAAGAAACGAGCTCTATCAGG - Intronic
1160229871 18:77039696-77039718 TCTAAGAAACAACTTTCTTCTGG - Intronic
1165378066 19:35457592-35457614 CCTAACAAACATTCCCCTTCAGG + Intergenic
1165644979 19:37427922-37427944 CATAAGAAACACACTCTTGCTGG + Intronic
1167766504 19:51486441-51486463 CCTAAGAAACAGCTTCCTCCGGG - Intronic
925749155 2:7071913-7071935 CCTAAGGAAGAAATTCCTCCTGG + Intergenic
926194325 2:10753237-10753259 ACCAAGATACAAACTCCTACAGG - Intronic
926458968 2:13103729-13103751 CCCAACAACCAAACTGCTTCCGG + Intergenic
926827635 2:16923231-16923253 TCTAAGAAATAAACTTATTCAGG - Intergenic
928436768 2:31259585-31259607 CCTAAGGAAGAAACCCCTTGTGG + Intronic
929158731 2:38811061-38811083 CCCAAGAACCAACCACCTTCAGG - Intronic
929278559 2:40052327-40052349 CCTAGGCAACAAACAACTTCTGG + Intergenic
930242844 2:48954211-48954233 CTTCAGAAACAAAGTCTTTCTGG + Intergenic
933284602 2:80372110-80372132 CCTATGAAACAAATTCATGCAGG + Intronic
943162496 2:184272006-184272028 CCAAAGTAATAAACCCCTTCTGG - Intergenic
945141678 2:206693263-206693285 CCTCAGAAACAACCTTCTTCAGG - Exonic
946096109 2:217275266-217275288 CATAATCAACAAACTCCTTGGGG - Intergenic
946831235 2:223730133-223730155 AGGAAAAAACAAACTCCTTCTGG + Intergenic
947875811 2:233467662-233467684 CCAAAGGAACAATGTCCTTCAGG - Intronic
948581890 2:238992940-238992962 CCTACGAAAAAAAATCCTTCAGG - Intergenic
1170221282 20:13944641-13944663 CCCCAGACACAAACTACTTCAGG - Intronic
1170623783 20:18015353-18015375 CCAAAGAAACAAAAAACTTCTGG + Intronic
1175045906 20:56105283-56105305 CATTAGAAACAAAATCCTTAGGG + Intergenic
1179337390 21:40470542-40470564 CCTAATAAACAAAACACTTCAGG - Intronic
1180597228 22:16986002-16986024 TCAAAGAAACCAACTCCTGCTGG + Intronic
1181952799 22:26566775-26566797 ACAAACAAACAAACTCCTTAAGG + Intronic
1182533332 22:30980149-30980171 CTTAAGAATCAAAGTCCTTGTGG - Intergenic
949600126 3:5589106-5589128 CCTAAGAATCAAAGAGCTTCAGG - Intergenic
950973832 3:17218554-17218576 CATAATAAAGAAAGTCCTTCAGG - Intronic
951704091 3:25526320-25526342 AATAAAAATCAAACTCCTTCAGG - Intronic
952687208 3:36163541-36163563 CCAAAGAAACAATCTCCTTGAGG - Intergenic
955907976 3:63827647-63827669 CCAGGGAAACACACTCCTTCGGG + Exonic
956077307 3:65519261-65519283 CATAAGATACAAAGTCCTTATGG - Intronic
956084475 3:65595751-65595773 CCTAAGAAAGAAACTACATGGGG + Intronic
962820296 3:139042747-139042769 CCTAAGAAACAAATTATTTCCGG + Exonic
963159234 3:142133505-142133527 CCAAACAAACAAACTGCTTTTGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968486322 4:864726-864748 CCTCAGTCACAAACCCCTTCAGG + Intronic
968684474 4:1948066-1948088 CCTTAGAAATACATTCCTTCAGG - Intronic
971316146 4:25569805-25569827 CCAAAGAAACATATGCCTTCAGG + Intergenic
972768606 4:42174571-42174593 CTTAAGCAAAAAACTGCTTCTGG - Intergenic
977488717 4:97683866-97683888 TCAAAGAAACAAAATCTTTCTGG + Intronic
978187787 4:105877873-105877895 TGCAAGAAACAAACTCATTCTGG - Intronic
979000484 4:115211210-115211232 AATTAGAAACAAACTCTTTCTGG + Intergenic
979212000 4:118115915-118115937 CCAAATAAACAAACAGCTTCAGG + Intronic
979325190 4:119370885-119370907 CCTAATAAACAAACTGCTAATGG + Intergenic
986053298 5:4110305-4110327 CTTTAAAAGCAAACTCCTTCCGG - Intergenic
988351543 5:30114723-30114745 CATCAGAAAGAAACTCCTCCGGG - Intergenic
990245500 5:53859755-53859777 CCTAAGAACCAAGCACCTCCAGG + Intergenic
992643859 5:78794135-78794157 CCTGAGAAGCAGACTCCTACAGG - Intronic
992734468 5:79704909-79704931 GGTAAGGAACAAACTCTTTCAGG - Intronic
993136524 5:83973449-83973471 ACTAAATAACAAACTCTTTCAGG - Intronic
994339197 5:98605787-98605809 CCTAAGAAACAAATTAATTAAGG - Intergenic
997191372 5:131939318-131939340 ACCAAGAAACAAACTGATTCAGG - Intronic
997640344 5:135444872-135444894 CCTATGAAACTCACTCCTTTGGG + Exonic
997713472 5:136025479-136025501 CCTAGGAAAGAAACTGGTTCTGG - Intergenic
998055742 5:139075514-139075536 CCTTAAAAACAAACTGCTCCTGG + Intronic
998640147 5:144000657-144000679 TCTTAGAAAAAAAATCCTTCTGG + Intergenic
1001853006 5:174985644-174985666 CTAAAGAAGCAAACACCTTCAGG - Intergenic
1003342145 6:5231919-5231941 CCTAACACACAAACACCTACTGG - Intronic
1004344715 6:14838122-14838144 CCAAAGAAACACATGCCTTCAGG + Intergenic
1011129023 6:84035024-84035046 CATAAGAACGAAACTCCTTGTGG - Intronic
1011194323 6:84766311-84766333 CCTGAGAAACAAACTCAGTTGGG + Intergenic
1015011861 6:128359063-128359085 ACTAAGATACAGACTCCTCCAGG + Intronic
1015511566 6:134043020-134043042 CCCAAAAAAGAAACTCCTTATGG + Intronic
1016548827 6:145254696-145254718 CCCAGGAAGCAAACCCCTTCTGG - Intergenic
1017399313 6:154040554-154040576 CCTAAGTCACAAACTGCATCTGG + Intronic
1019012627 6:168854121-168854143 CCAAAGGAACAACCTCTTTCCGG + Intergenic
1021404648 7:20250810-20250832 ACTAAGATATAAACTCCTTTGGG - Intergenic
1023548900 7:41347740-41347762 CATGAGAAACAAACTCTTGCAGG - Intergenic
1024852921 7:53742279-53742301 CCTATGAAGCAAACACCATCGGG + Intergenic
1024920812 7:54552631-54552653 ACTAAAATACAAACTCCTTGAGG - Intronic
1028517728 7:91697072-91697094 ACTAAGAAACAAACACTTTGAGG + Intronic
1032570153 7:132987334-132987356 CCAAAACAACAAACTCCTCCTGG + Intronic
1033495843 7:141894835-141894857 ACTAAGAAAGGAACTCCTCCAGG - Intergenic
1033789110 7:144769666-144769688 CCTATGAAACAAGCACCATCTGG - Intronic
1035407491 7:158609165-158609187 CCACAGAAACAAACTCTTTGGGG + Intergenic
1038940635 8:32300731-32300753 CCTTAGACACAAATTCCTTCAGG + Intronic
1042030581 8:64471584-64471606 CTTAAGAAACAAACTCATGGTGG + Intergenic
1042362839 8:67902173-67902195 CCTGGGTAACACACTCCTTCCGG - Intergenic
1043202753 8:77391697-77391719 CCTAAGCAAGAAATTTCTTCAGG - Intergenic
1043293278 8:78631104-78631126 CCTAGAATACAATCTCCTTCTGG - Intergenic
1048745214 8:137606904-137606926 CCTAAGAAAGAAACATGTTCAGG + Intergenic
1052088453 9:24296433-24296455 CCAAAGAAACAAACTTCTTAGGG - Intergenic
1052350375 9:27452445-27452467 GGTAAGAAACAAACCACTTCTGG + Intronic
1052389807 9:27866470-27866492 CCTAAGAAACCATTTCCTTTTGG - Intergenic
1055867371 9:80831642-80831664 CCTAAGCTTCAAATTCCTTCAGG + Intergenic
1057896202 9:98910943-98910965 ACTAATAAACCAACTCCTTTGGG - Intergenic
1058515391 9:105767468-105767490 CCTATGGAAAAAACGCCTTCTGG + Intronic
1059819228 9:117953426-117953448 CATAACATACAAACTCCTTATGG - Intergenic
1060219404 9:121756387-121756409 CCCAAGACACACACTCCATCGGG - Intronic
1185496391 X:557401-557423 CCTAAAATTCAAACTCCTTCTGG - Intergenic
1186123845 X:6391745-6391767 CCTGAGGCACAAACTCCTTTAGG - Intergenic
1186492934 X:9988840-9988862 CTTAAGACACAATCTCCTCCTGG + Intergenic
1189719452 X:43900219-43900241 CATAAGAAACAAAAGCTTTCAGG + Intergenic
1190164678 X:48063197-48063219 ACTAGAATACAAACTCCTTCAGG - Intronic
1194086828 X:89538465-89538487 CCTAAGAGACAAACTGTGTCTGG + Intergenic
1194927157 X:99838541-99838563 CATAAGAAAAAAACTACTTCAGG + Intergenic
1196803590 X:119564992-119565014 CCTCAAAACTAAACTCCTTCAGG - Intronic
1198017696 X:132628786-132628808 GCAAAGAAACAAGGTCCTTCTGG - Exonic
1198120324 X:133586110-133586132 AATAAGAAACAAACTCCCTAAGG + Intronic
1199595522 X:149503645-149503667 CCTAGGCAACAGACTGCTTCCGG + Intronic
1199598354 X:149525566-149525588 CCTAGGCAACAGACTGCTTCCGG - Intronic
1200106877 X:153719168-153719190 GGAAAGAAACATACTCCTTCTGG + Intronic
1200439487 Y:3194333-3194355 CCTAAGAGACAAACTGTGTCTGG + Intergenic
1201968930 Y:19770416-19770438 CCTACAAAAGAAACTCCTTCGGG + Intergenic