ID: 1142327265

View in Genome Browser
Species Human (GRCh38)
Location 16:89423954-89423976
Sequence ACAACCTTGTAAGCGGGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142327265 Original CRISPR ACAACCTTGTAAGCGGGTAA GGG Intronic
900865737 1:5267529-5267551 AGAACCCTGTAAGCAGCTAAGGG - Intergenic
904770099 1:32876300-32876322 AGAGCCTTCTAATCGGGTAAAGG + Intergenic
908755046 1:67461885-67461907 ACAACCTTGTAAGCTAGACAAGG - Intergenic
909813051 1:79954992-79955014 ACCACCTTGCCAGCAGGTAATGG + Intergenic
912278866 1:108291423-108291445 GCAATCTTGGAAGTGGGTAATGG - Intergenic
912289360 1:108402934-108402956 GCAATCTTGGAAGTGGGTAATGG + Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067789307 10:49275784-49275806 GCAACCTGGTATGCAGGTAAGGG - Intergenic
1068424943 10:56847659-56847681 AGAAACTTGTAAGGGAGTAAGGG + Intergenic
1070014001 10:72506223-72506245 ACAAGCTTTTAAGTGGTTAAGGG + Intronic
1077845082 11:6014629-6014651 GCAACTTTGGAACCGGGTAATGG + Intergenic
1079301308 11:19281443-19281465 ACAACCTGGTAAGAGGATAAAGG + Intergenic
1080214464 11:29825420-29825442 ACCACCTTGTAACTAGGTAACGG + Intergenic
1081524303 11:43914325-43914347 ACAACCTTGTAAGGGAGGCAAGG - Intronic
1085818699 11:79769604-79769626 ACAACTTTGGAACTGGGTAATGG + Intergenic
1086699962 11:89889966-89889988 GCAAAGTTGTAAGAGGGTAAGGG - Intergenic
1086706208 11:89954550-89954572 GCAAAGTTGTAAGAGGGTAAGGG + Intergenic
1090168364 11:124576202-124576224 AGAGCCTTGTAAGCAGGTACAGG + Intergenic
1093501042 12:19812618-19812640 ACTACCTTGCAAGGGGGAAATGG + Intergenic
1097676575 12:62608892-62608914 ACAACATTGTAAGCTCTTAAAGG - Intergenic
1099043492 12:77685781-77685803 ACAACATTGAAAGCTGTTAATGG - Intergenic
1099229413 12:80004526-80004548 ACAACTTTGGAACTGGGTAACGG - Intergenic
1103984598 12:124758901-124758923 AGAACATTGTCACCGGGTAATGG - Intergenic
1107330606 13:39295847-39295869 ACAACTTTGGAACTGGGTAATGG + Intergenic
1111218974 13:85179922-85179944 GCAACTTTGTAACTGGGTAATGG + Intergenic
1113137020 13:107102276-107102298 ACAACCTTTTAGGCTGGTGATGG + Intergenic
1119432458 14:74577411-74577433 ACAACCTTGGAAACAGGCAAAGG + Intronic
1129109914 15:73331250-73331272 CCAACCTTGCAAGTGGGTCAGGG - Intronic
1131166080 15:90143205-90143227 ACAGGATTGTAAGCAGGTAAAGG + Intergenic
1137358764 16:47792891-47792913 ACAACTTTGGAACTGGGTAATGG - Intergenic
1137711392 16:50569287-50569309 AGAACCTTGGAAGCAGGAAAAGG - Intronic
1138612518 16:58137706-58137728 AAAACCTTATAAGCAGCTAAAGG + Intergenic
1142327265 16:89423954-89423976 ACAACCTTGTAAGCGGGTAAGGG + Intronic
1145218289 17:21068626-21068648 AGAACCATGTGAGGGGGTAAAGG - Intergenic
1146080044 17:29771645-29771667 ACAACCTAGTAAGTAGGTAAGGG + Intronic
1149374126 17:56026975-56026997 ACTACCTTGACAGCTGGTAAAGG + Intergenic
1149398442 17:56269389-56269411 ACAACTCTGGAAGCAGGTAATGG + Intronic
1151783325 17:76262129-76262151 ACAACCTTGTCATCCGGGAACGG + Intergenic
1153255732 18:3168687-3168709 AAAACCTTTTAATCGTGTAAAGG + Intronic
1153843869 18:9031214-9031236 TCAACCTTTTAAGTGGGTTAAGG + Intergenic
1157206451 18:45704236-45704258 ACAACTTTGGAACTGGGTAATGG - Intergenic
1157331838 18:46709926-46709948 TCAATCTTGTAACAGGGTAAGGG - Intronic
1158032868 18:52987986-52988008 ACAACCTTTTAAGTCAGTAAAGG + Intronic
1160573904 18:79837803-79837825 ACAACTTTGGAACTGGGTAAAGG - Intergenic
925627990 2:5861325-5861347 CCAACATTGTCAGCAGGTAACGG - Intergenic
929612674 2:43283370-43283392 GCAACTTTGGAACCGGGTAATGG + Intronic
929902908 2:46021221-46021243 ACAACCTTGTGAGGAGGTACTGG + Intronic
932278769 2:70471807-70471829 ACAACCTTGTCAATGGGCAAGGG + Intronic
937359743 2:121220423-121220445 ACAACCTGGTAAACAGGAAAGGG + Exonic
940288823 2:152058313-152058335 ACAACTTTGGAACTGGGTAATGG + Intronic
944968788 2:204967604-204967626 AGAACCATGAAAGTGGGTAAGGG - Intronic
945558614 2:211310219-211310241 ACAATCTTGTAAGAAGATAAAGG + Intergenic
1177206229 21:18014951-18014973 ACAACTTTGGAACTGGGTAATGG + Intronic
1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG + Intronic
954573919 3:51664301-51664323 ACAACCTTCCAAGCTGGAAAGGG - Exonic
958537787 3:95425966-95425988 ACAACTTTGTAACTGAGTAATGG - Intergenic
959214901 3:103438509-103438531 ACAACTTTGGAACTGGGTAATGG - Intergenic
970544966 4:17119046-17119068 ACAACCTTTTCAGAGGATAAAGG + Intergenic
981275331 4:142892767-142892789 ACAACTTTGGAACTGGGTAATGG + Intergenic
1000739555 5:164950876-164950898 ACAAGCTTGCAAAGGGGTAAAGG - Intergenic
1001487931 5:172133066-172133088 AAAAGCGTGGAAGCGGGTAATGG + Intronic
1006599782 6:35217705-35217727 ATAACCATGTCAGCGGGTAAGGG + Intronic
1009952652 6:70414056-70414078 AGAACCACGAAAGCGGGTAAAGG - Intronic
1010167792 6:72938025-72938047 ACAACCTTGTAAGGTGGTCAGGG - Intronic
1016242839 6:141952335-141952357 GCAACTTTGGAAGTGGGTAATGG + Intergenic
1016321961 6:142856136-142856158 ACATCCTGGTAAGGGGGAAATGG + Intronic
1032346448 7:131120873-131120895 ACAACTTTGGAACTGGGTAACGG - Intronic
1046880287 8:119299937-119299959 ACAACTTTGGAATTGGGTAATGG - Intergenic
1048201824 8:132380951-132380973 ACAACCTTGGAAGAGGAGAAGGG + Intronic
1051330051 9:16014940-16014962 ACACTCTTGTTAGCGGCTAATGG - Intronic
1188026747 X:25217903-25217925 ACAATCTTGTCAGAAGGTAAAGG - Intergenic
1188067996 X:25685143-25685165 ACAATCTTGTAAACGACTAAAGG + Intergenic
1191674381 X:63779168-63779190 GCAACTTTGGAACCGGGTAACGG - Intronic
1191772478 X:64776042-64776064 ATAACATTGTATGCAGGTAATGG - Intergenic
1192571140 X:72206356-72206378 ACCACCTTGCAAGATGGTAAAGG - Exonic
1192852134 X:74968313-74968335 ACAACCCTTAAAGCGTGTAAAGG + Intergenic
1195034997 X:100964371-100964393 ACAACTTTGAAACTGGGTAATGG + Intergenic
1195899308 X:109780991-109781013 CCACCCTTGTAGTCGGGTAAGGG - Intergenic
1197034862 X:121861060-121861082 GCAGCCTTGGAAGTGGGTAATGG - Intergenic
1197995990 X:132373873-132373895 ACTACTTTGTAATCTGGTAAAGG + Intronic
1201539146 Y:15087358-15087380 GCAACCTTTTAAGCAGTTAATGG + Intergenic