ID: 1142328219

View in Genome Browser
Species Human (GRCh38)
Location 16:89432359-89432381
Sequence GGTCCTGAGGTCACAAACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328219_1142328233 29 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328219_1142328232 28 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328219_1142328225 11 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328219_1142328234 30 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328219 Original CRISPR GGTCCTGAGGTCACAAACAG CGG (reversed) Intronic
902341471 1:15786072-15786094 GGACTTGAGGTCATAACCAGAGG - Intronic
902680999 1:18043598-18043620 AGTGATGAGCTCACAAACAGGGG - Intergenic
903765344 1:25730649-25730671 GGCACTGAGGTCTGAAACAGAGG + Intronic
904768874 1:32870291-32870313 GGTCCTGGGGACACAGAGAGAGG + Intronic
905252847 1:36660624-36660646 GGTCTTGAGCTCCCAGACAGTGG - Intergenic
905931844 1:41793424-41793446 GTTCCTAGGGTCACACACAGAGG + Intronic
909348931 1:74625668-74625690 GGTCCTGAGGTTACCAAGATGGG - Intronic
909720791 1:78767383-78767405 GGCCCTGAGATCCCCAACAGAGG + Intergenic
911164512 1:94712955-94712977 GGTCCTGAGCAGACAAACTGAGG + Intergenic
915679759 1:157569583-157569605 GGTTATGAGGTCGCAGACAGTGG + Intergenic
916859680 1:168789653-168789675 GGCCCTGAGGCCACAAATGGAGG + Intergenic
919052953 1:192533849-192533871 GGTCCTCAGGTCAAAAACCTTGG - Intergenic
920684408 1:208098165-208098187 GGAGCTGAGGAAACAAACAGGGG - Intronic
922188970 1:223300227-223300249 GTTCCTGAGGTCACAAATGCTGG - Intronic
922555427 1:226528682-226528704 GGTCCTGAGGTCTCCAAAAGAGG - Intergenic
924521814 1:244812254-244812276 AGGCCTGAGGCCAGAAACAGTGG + Intergenic
1065361533 10:24893923-24893945 CGTCATGAGGTGACAAACTGTGG - Intronic
1067432130 10:46251743-46251765 GGTCCTGAGGGCCCAAATGGAGG - Intergenic
1067738438 10:48877547-48877569 GGTGGTCAGGCCACAAACAGGGG - Intronic
1070648243 10:78216218-78216240 GGACCTGAGGTCACACAGAGAGG + Intergenic
1071254560 10:83859509-83859531 GATCCTGAGAGCAGAAACAGGGG - Intergenic
1072588356 10:96803178-96803200 GGTCCTGTGGTCCCACCCAGAGG + Intergenic
1073536441 10:104280939-104280961 TGTCCTGAGGTCACCAACTGTGG + Intronic
1077485772 11:2837777-2837799 GGTCCTGAGGTAGGAACCAGAGG + Intronic
1081380250 11:42406314-42406336 GGACCTGAGGTCTGAAGCAGTGG - Intergenic
1082635053 11:55584679-55584701 GGTACAGAGGTCACAAGCAAGGG - Intergenic
1085382781 11:76135471-76135493 TTTCCTGGGGTCACAAACAATGG - Intronic
1087048825 11:93866604-93866626 GGTACAGAGGTCACAAGCAAGGG + Intergenic
1090855041 11:130603473-130603495 GGTCCCAAGGTCCCAAACACAGG - Intergenic
1098564460 12:71916834-71916856 GGCCCTGAGGTCACAAAGTTTGG - Intronic
1101581164 12:106042027-106042049 AGTCCTGAGGACAAAACCAGAGG + Intergenic
1103600313 12:122050575-122050597 GGGGCTGTGGTCACATACAGGGG + Intronic
1105414477 13:20197265-20197287 GCTCCTGAGGTCCCAGTCAGAGG + Intergenic
1105589189 13:21775476-21775498 GGTCTTGAGGGCAAAAACTGAGG + Intergenic
1106137884 13:26988028-26988050 GGTCCTGAGCTCATGAACTGTGG + Intergenic
1107872733 13:44762057-44762079 CTTCCTGAGGTCACCAAAAGTGG - Intergenic
1111824072 13:93246336-93246358 TGTCCTGGGGGCACAAAGAGAGG - Intronic
1113947170 13:114050908-114050930 GGTCCATGGCTCACAAACAGAGG + Intronic
1114459737 14:22878783-22878805 GGGCCTGAGAGCACAAGCAGCGG + Exonic
1117255386 14:53971863-53971885 GGTCCGGAGGTGATAAGCAGAGG + Intergenic
1120515851 14:85469096-85469118 GGTCCTTATGTCACCCACAGTGG + Intergenic
1120747301 14:88164025-88164047 GGGGCAGAGGTCACACACAGAGG - Intergenic
1121485159 14:94309091-94309113 GGGCCTGAGGTCAGAGATAGAGG + Intronic
1122117882 14:99536728-99536750 TGGCCTGAGGTCAGAAACTGGGG - Intronic
1122737178 14:103849480-103849502 GGACCTGTGGGCACAGACAGTGG + Intergenic
1123104784 14:105835882-105835904 GGTGCTGAGGTCATAAAAGGGGG - Intergenic
1128455964 15:67831590-67831612 GGTTCTGAGGGCACTAACAGAGG + Intronic
1129781847 15:78277550-78277572 GGTGTTGAGCTCACAACCAGTGG - Intronic
1130156688 15:81356757-81356779 GTTGCTGAGGTCACAAGCATGGG - Intronic
1130714398 15:86317246-86317268 AATCATGATGTCACAAACAGAGG + Intronic
1131737409 15:95348435-95348457 GGCCCTGAGGTCCCAAACACTGG + Intergenic
1131995796 15:98131657-98131679 GGTTCTGAACTCAGAAACAGTGG - Intergenic
1132049318 15:98593746-98593768 GGTCACGAGGTCACATAGAGAGG + Intergenic
1134270502 16:12728956-12728978 GCTCCTAAGCTCACAGACAGGGG - Intronic
1136449067 16:30342486-30342508 AGTTCAGAGGTCAGAAACAGTGG - Intergenic
1136774066 16:32862037-32862059 GTTTCTGACGTCATAAACAGTGG + Intergenic
1136896543 16:33999478-33999500 GTTTCTGACGTCATAAACAGTGG - Intergenic
1138906299 16:61339210-61339232 GGTTCAGGGGTCACAAACAGAGG - Intergenic
1139288807 16:65839001-65839023 GGTCCCGAAGTCAGAAACAAAGG - Intergenic
1141257350 16:82415137-82415159 GGTCTAGAGGTCAGCAACAGAGG - Intergenic
1141591645 16:85073246-85073268 GGCCCTGAGGACCCACACAGAGG - Intronic
1142138792 16:88463411-88463433 GGTCCTGGGGTCACATCCGGGGG - Intronic
1142328219 16:89432359-89432381 GGTCCTGAGGTCACAAACAGCGG - Intronic
1203076490 16_KI270728v1_random:1124144-1124166 GTTTCTGACGTCATAAACAGTGG + Intergenic
1142670085 17:1484098-1484120 GGTGCTGGGGTCACAGACACAGG - Intronic
1142735816 17:1898679-1898701 GTTCCTGAGGACAGACACAGAGG + Exonic
1145842822 17:28010458-28010480 GTTTCTGATGTCACAGACAGTGG - Intergenic
1147454411 17:40527680-40527702 GGTCCAGCAGTCACACACAGTGG + Intergenic
1149368011 17:55964985-55965007 GGTCCTCAGGTCACAGACCCAGG + Intergenic
1149636060 17:58170324-58170346 GATGCTGAGGTCACATCCAGGGG + Exonic
1149666883 17:58371195-58371217 CATCCTGAAGTGACAAACAGTGG - Intronic
1149696895 17:58623152-58623174 GTTCCTGTGGGCACAGACAGGGG - Intronic
1149851418 17:60037767-60037789 TCTCCTAAGGTCAGAAACAGAGG + Intergenic
1150192859 17:63261352-63261374 GGACCTGAGGAAACAAAAAGAGG + Intronic
1151572425 17:74933538-74933560 TGTCCTGAGGCCTCCAACAGAGG + Exonic
1156623864 18:38885090-38885112 GGTCCTGAGTTGGCAAGCAGTGG - Intergenic
1156839096 18:41590251-41590273 GGTCCTGAAGTGAAAAATAGTGG + Intergenic
1158130225 18:54144900-54144922 GGTCCTGAGGTCAGAATTTGGGG + Intergenic
1160794308 19:937448-937470 GGTCGAGTGGTCACCAACAGCGG - Intronic
1163091991 19:15026664-15026686 TGAGCTGAGGTCACAAACTGGGG - Intergenic
1164100028 19:22046509-22046531 GGTCTTGAACTCACAAACTGAGG - Intergenic
1164826818 19:31290137-31290159 TGTCCTGAGGTCCCACACAATGG + Intronic
1164930725 19:32173856-32173878 GGACCTGAGGTCATAAATTGGGG - Intergenic
1166348538 19:42182320-42182342 GGCCCTGAGGACACAGGCAGAGG + Intronic
925135829 2:1524529-1524551 GGACCTGAGGTTGCACACAGTGG - Intronic
929451602 2:42041839-42041861 GCTCCTGAGGGCAGAAGCAGGGG + Intergenic
931462289 2:62459443-62459465 GGTCAGGAGGTCAGAAACATGGG - Intergenic
931897396 2:66747366-66747388 GGTCCTGAGGTCAGTAAAAACGG - Intergenic
933709724 2:85316206-85316228 GGGCCTGAGGGCAGGAACAGAGG - Intergenic
933713338 2:85343557-85343579 GGGCCTGAGGGCAGGAACAGAGG + Intronic
933941139 2:87246022-87246044 GCTCCTTAGGTCATACACAGTGG + Intergenic
935700788 2:105810008-105810030 GGTGCTGAGGTCTCATTCAGTGG + Intronic
936352001 2:111719990-111720012 GCTCCTTAGGTCATATACAGTGG - Intergenic
936506840 2:113114932-113114954 GGTCCTGAGGTGAGAGAAAGAGG + Intronic
937272616 2:120662968-120662990 AGTCAGGAGGTCACATACAGGGG - Intergenic
938789564 2:134664678-134664700 AGTCGTGTGGTCACAAGCAGGGG + Intronic
940185164 2:150976548-150976570 TCTCCTGAGGTCACATGCAGTGG - Intergenic
940363754 2:152822987-152823009 GGTCTGGAGGTCTCAGACAGAGG - Intergenic
946149429 2:217754153-217754175 GGTCCAGAAGGCACAGACAGGGG + Intronic
948293234 2:236842818-236842840 GGAGCTGAGGTCACAAGCTGGGG - Intergenic
1170133302 20:13046087-13046109 GGTTCTGAGGTCACCCACACTGG + Intronic
1172004169 20:31806400-31806422 GGACCTCAGGTCACAAACCCAGG - Intergenic
1173827130 20:46055261-46055283 GCTCCAGAAGTCACATACAGAGG - Intronic
1176255702 20:64151623-64151645 GGCACTGAAGTCAGAAACAGAGG + Intergenic
1183293258 22:37015705-37015727 GGTCCAGATGTAACACACAGGGG - Intronic
1185083266 22:48721336-48721358 GGATCTGAGGTCACACGCAGCGG - Intronic
1185083275 22:48721399-48721421 GGACCTGAGATCACACACAGTGG - Intronic
951804957 3:26633756-26633778 GAGCATGAGGTCACAGACAGAGG + Intronic
952068130 3:29596974-29596996 ATTCCTGAGCTCACAAACAATGG + Intronic
952903691 3:38126231-38126253 GGTCCTGAGGTCTTATGCAGTGG - Exonic
953152211 3:40334811-40334833 GAACCAGAGGTCACAAACTGGGG - Intergenic
954473928 3:50725437-50725459 GGACCTGAGGTCACCAAAAATGG + Intronic
957504140 3:81097862-81097884 AGTCCTTTGGTCAGAAACAGGGG + Intergenic
957690720 3:83563049-83563071 TGGCCTGAGATCACAAAGAGAGG - Intergenic
961340051 3:126211931-126211953 GGTCAGGATGTCAAAAACAGGGG + Intergenic
962925976 3:139993678-139993700 AATGCTGAGGTCCCAAACAGTGG + Intronic
964863588 3:161229456-161229478 GCTGCTCAGGTCACGAACAGTGG - Intronic
968702970 4:2065395-2065417 CTTCCTGAGGTCACAGGCAGGGG + Exonic
971530270 4:27678965-27678987 AATCCTGAGCTCAGAAACAGTGG - Intergenic
974732382 4:65884952-65884974 GGTCCTGGGTACACAAACAATGG + Intergenic
976299852 4:83507271-83507293 GGTACAGAGGTCACAAGCAAGGG + Intronic
977346634 4:95824480-95824502 GGTCCTGATGTCAGTAACAGAGG + Intergenic
986837105 5:11651151-11651173 TGTCCTGAGGTCGCACAGAGTGG - Intronic
988630839 5:32929790-32929812 CTTCCTGAGGCCACTAACAGAGG - Intergenic
989154429 5:38330648-38330670 GCTCCTTGGGTCACTAACAGGGG - Intronic
989724731 5:44574760-44574782 GGCCCTGTGGTCACAAACTCCGG - Intergenic
992596101 5:78348733-78348755 GTTCCTGAGGCCACAAATGGAGG + Intergenic
993144503 5:84077194-84077216 TGTACTGATGCCACAAACAGTGG - Intronic
995501747 5:112814588-112814610 GGTTCTGAGGGCACAAACTAAGG - Intronic
996860283 5:128057969-128057991 TGTCCTGAGGTTACAAATAAGGG - Intergenic
997794770 5:136797430-136797452 GGTTGTAAGGTCACAAGCAGAGG + Intergenic
1000188138 5:158881093-158881115 GGGCCTGAGGACAGAAGCAGAGG + Intronic
1008041080 6:46798799-46798821 GTTCCTAAGGACAAAAACAGAGG + Intronic
1011812407 6:91148069-91148091 GGTACAGTGGTTACAAACAGGGG - Intergenic
1011894053 6:92201793-92201815 GGTCCTGTGGTCTCACCCAGAGG + Intergenic
1019337566 7:492527-492549 GGTCATGAGGTGGCAGACAGGGG + Intergenic
1022483528 7:30759866-30759888 GGTCCTGACATCACAAGGAGGGG - Intronic
1029027372 7:97431147-97431169 GGTCTTAAGGTCCCAGACAGAGG - Intergenic
1031744533 7:125477605-125477627 GGTCCTGGTAACACAAACAGTGG - Intergenic
1032151085 7:129430569-129430591 GGTCCTTTGGTCCCAAACTGGGG - Intergenic
1041195777 8:55400183-55400205 GATCCTGAGGAAACTAACAGGGG + Intronic
1044019183 8:87083548-87083570 GGTCCAGAAGTCAAAAGCAGGGG - Intronic
1051233741 9:14978083-14978105 GTTTCTGCGGTCACAATCAGGGG - Intergenic
1051285135 9:15488426-15488448 GGACCTCAGGTCTTAAACAGAGG + Intronic
1051711555 9:19935588-19935610 CGTCCTGAGGACACACACAAGGG - Intergenic
1053117388 9:35517493-35517515 TGTCCTGGGCCCACAAACAGGGG + Intronic
1055839502 9:80485387-80485409 GGTTATGATGACACAAACAGGGG + Intergenic
1058230514 9:102418610-102418632 TTTCCTGATGTCACAAAAAGAGG + Intergenic
1059662204 9:116412968-116412990 AGTCATGAGGTCACAGAGAGGGG - Intergenic
1060045693 9:120338375-120338397 GGTCCTGAGGTCACCTGCAGTGG + Intergenic
1185431293 X:13506-13528 GGTCCGGAGGACAGGAACAGTGG - Intergenic
1185431387 X:13761-13783 GGTCCGGAGGACAGGAACAGTGG - Intergenic
1185440558 X:225903-225925 GGTCCGGAGGACAGGAACAGTGG - Intergenic
1185440676 X:226222-226244 GGTCCGGAGGACAGGAACAGTGG - Intergenic
1188120726 X:26304255-26304277 GCTCTTGAGACCACAAACAGAGG - Intergenic
1189203693 X:39219660-39219682 GGTCCTCAAGTCAGAAACTGGGG + Intergenic
1195300859 X:103528593-103528615 GGTCCTGAGGACACAGAGAAGGG + Intergenic
1196664638 X:118303732-118303754 GGGTCTGTGGTCACACACAGAGG - Intergenic
1197213430 X:123846773-123846795 GGTCCTGTGGCCCCACACAGAGG + Intergenic
1199854316 X:151747762-151747784 GGTACTGGGGCCAGAAACAGGGG + Intergenic
1199880586 X:151971649-151971671 GGCCATGAGTTCACAAACAATGG + Intronic
1200105893 X:153712046-153712068 GTTTCTGATGTCATAAACAGTGG - Intronic
1201617000 Y:15911789-15911811 GCTACTGAGGTCAAAAATAGAGG + Intergenic