ID: 1142328221

View in Genome Browser
Species Human (GRCh38)
Location 16:89432372-89432394
Sequence TGCCACGGCGATGGGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328221_1142328233 16 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328221_1142328225 -2 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328221_1142328232 15 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328221_1142328235 27 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328235 16:89432422-89432444 CTGTGTTGAGGGGTGCTGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 242
1142328221_1142328234 17 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328221 Original CRISPR TGCCACGGCGATGGGTCCTG AGG (reversed) Intronic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900683160 1:3929010-3929032 GGTCACGCCCATGGGTCCTGGGG - Intergenic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
906700183 1:47852134-47852156 AGCCACCGCCATGGGCCCTGGGG + Intronic
909534837 1:76725014-76725036 TGCCATGGGGATGTTTCCTGGGG - Intergenic
911608237 1:99932510-99932532 GGCCAAGGCGGTGGATCCTGAGG - Intergenic
915162665 1:153931048-153931070 AGCCAAGGAGATGGGGCCTGGGG + Exonic
915312677 1:155012203-155012225 TGCCACGGAGACCGGCCCTGGGG + Intronic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
920096122 1:203487670-203487692 CGTGACGTCGATGGGTCCTGCGG + Exonic
1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG + Intergenic
1065428460 10:25630180-25630202 TCCCACGGCCAGGGGTTCTGAGG + Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1073142880 10:101260837-101260859 TGCCAGGGCAGTGGGTTCTGAGG - Intergenic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1075389561 10:122082937-122082959 TGCCGCCGCGATGTCTCCTGGGG - Exonic
1076763380 10:132616728-132616750 TGACATGGCGATGTGTCATGTGG + Intronic
1076850463 10:133089956-133089978 GGCAACAGCGATGGTTCCTGAGG - Intronic
1077054009 11:581392-581414 TGACACGGGGATGTGGCCTGTGG + Intronic
1077235311 11:1479304-1479326 AGGCATGGAGATGGGTCCTGAGG - Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1078450357 11:11436355-11436377 TGGCAAGGGGATGTGTCCTGTGG - Intronic
1078907116 11:15697854-15697876 TGCCACAGCTAAGGCTCCTGGGG + Intergenic
1081065781 11:38537333-38537355 GGTCACGGAGATGGCTCCTGAGG + Intergenic
1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG + Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1090580652 11:128154968-128154990 TGCCTCGGAGATGGGTCTTTGGG + Intergenic
1093097624 12:14989824-14989846 TGCCATGGACATGGGGCCTGTGG - Intergenic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1094470209 12:30795946-30795968 TACCGCGGCGCTGGGTCCTGCGG - Intergenic
1096780018 12:53986222-53986244 TGCCCCGGCCATGGGTGCTAAGG + Intronic
1102013431 12:109632776-109632798 CTCCACGGCGATGAGCCCTGAGG - Intergenic
1103411064 12:120711270-120711292 TGCCACGGCTATGTGTTTTGAGG - Intronic
1106129980 13:26932112-26932134 TGTTACAGCCATGGGTCCTGAGG + Intergenic
1108642734 13:52397542-52397564 GGCCAGGTCAATGGGTCCTGTGG + Exonic
1110369849 13:74727705-74727727 TCCCACAGCTATGGATCCTGAGG + Intergenic
1113459649 13:110472986-110473008 TGGCAGGCCGATGGGACCTGGGG - Exonic
1113974097 13:114213419-114213441 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1113974144 13:114213579-114213601 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG + Exonic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1128945151 15:71814741-71814763 TGGCATGGCCATGGGTCCAGAGG + Intronic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1132633694 16:932261-932283 ATCCTCAGCGATGGGTCCTGTGG + Intronic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1137286552 16:47020902-47020924 AGCCAAGGCGATGGATCATGAGG - Intergenic
1139370085 16:66461664-66461686 TGCCATGGCCAGGGGTCATGGGG + Intronic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152781942 17:82230607-82230629 TGGCTCAGCGGTGGGTCCTGGGG + Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
1168567660 19:57438592-57438614 TGCCACTGCAATGGACCCTGTGG - Intronic
1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG + Intronic
925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG + Intronic
926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG + Intergenic
926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG + Exonic
931339068 2:61380904-61380926 TGCCATGCCGATTGGTCTTGTGG - Intronic
933902726 2:86861427-86861449 TGGCCAGGCCATGGGTCCTGTGG - Intronic
935579482 2:104744317-104744339 TGACACGGGGCTGAGTCCTGGGG - Intergenic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
938230596 2:129655300-129655322 CGCCACGGCCATTGTTCCTGTGG - Intergenic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
1170559422 20:17544037-17544059 TGCCACGGAGTTGGCTTCTGGGG - Intronic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1178215444 21:30592500-30592522 GGCCATGGCTATGGGTGCTGTGG + Exonic
1180906856 22:19419665-19419687 AGCCACAGCTCTGGGTCCTGAGG - Intronic
1183110629 22:35645998-35646020 TGCCTCGGAGATGGCACCTGGGG - Intergenic
1183228741 22:36567760-36567782 GGACACGGAGCTGGGTCCTGAGG - Intronic
1183830693 22:40417154-40417176 GGGCACGCCCATGGGTCCTGTGG - Intronic
1185107894 22:48884824-48884846 GGCCCCGGCGATGGCGCCTGTGG + Intergenic
953916704 3:46925094-46925116 GGGCAGGGTGATGGGTCCTGTGG - Intronic
956463913 3:69500114-69500136 AGCCACAGCTCTGGGTCCTGGGG - Intronic
961166509 3:124767169-124767191 GGCAATGGCAATGGGTCCTGGGG + Intronic
965670522 3:171143155-171143177 TGCCAGGGCTTTGGTTCCTGTGG + Intronic
968161570 3:196431823-196431845 GGCCACGGCGATGGCTCCGAGGG + Intronic
968392681 4:205788-205810 TGCCAGGGAGTGGGGTCCTGGGG - Intergenic
971242945 4:24905132-24905154 GGCCACGGCGGTGGATCATGAGG - Intronic
976213175 4:82692239-82692261 AACCACTGCCATGGGTCCTGAGG + Intronic
982442433 4:155452730-155452752 TACCACAGCGATGGCTACTGAGG + Intergenic
984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG + Intronic
1001550412 5:172598453-172598475 GGCCAGGGTGATGGCTCCTGTGG + Intergenic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1006502295 6:34466482-34466504 TGCCACTGCGCTGGGTCCCTTGG + Intronic
1007262699 6:40575021-40575043 AGCCATGGCAATGGGTCCTTAGG + Intronic
1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG + Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034558555 7:151865159-151865181 TGCCATGGCCAAGGGGCCTGAGG + Intronic
1036649234 8:10631794-10631816 ACCAAGGGCGATGGGTCCTGGGG + Intronic
1044806959 8:96018177-96018199 TGGCAGGGCTATGAGTCCTGAGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1061184153 9:129042354-129042376 TGCCACGGCCCTGGGGACTGTGG + Exonic
1062471003 9:136704432-136704454 TGCCACGATGATGTTTCCTGAGG - Intergenic