ID: 1142328222

View in Genome Browser
Species Human (GRCh38)
Location 16:89432380-89432402
Sequence GAGGCGGCTGCCACGGCGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328222_1142328235 19 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328235 16:89432422-89432444 CTGTGTTGAGGGGTGCTGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 242
1142328222_1142328233 8 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328222_1142328232 7 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328222_1142328234 9 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328222_1142328225 -10 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328222 Original CRISPR GAGGCGGCTGCCACGGCGAT GGG (reversed) Intronic
902190929 1:14762580-14762602 CAGGCGCCTGCCACCGCGACTGG - Intronic
903907147 1:26695692-26695714 CAGGCGGCCGCGACGGCGCTGGG + Intergenic
904033889 1:27549092-27549114 GAGGCTGTTGCCACTGCCATAGG + Exonic
905449246 1:38046492-38046514 GAGGAGGCGGCGGCGGCGATTGG - Exonic
912748297 1:112264438-112264460 GAGGTGGCTGCCAAGGAGACAGG - Intergenic
914226668 1:145725273-145725295 CAGGCGCCTGCCACTGCGCTCGG - Intronic
915195070 1:154183163-154183185 GAGGAGGCTGCAACGCCGAGCGG - Intronic
920892292 1:210000754-210000776 GAGGCGCCTGCCACCGCGCCAGG + Intronic
921366492 1:214379458-214379480 GAGTCGGCTGCCACCAGGATAGG - Intronic
921509308 1:216010481-216010503 TAGGGGGCTTCCAAGGCGATCGG - Intronic
922599024 1:226835751-226835773 CAGGAGGCTTCCAAGGCGATCGG - Intergenic
922606683 1:226894060-226894082 AAGGCGGCTGCCACGGGCAGCGG + Exonic
923944768 1:238872145-238872167 CAGGCGCCTGCCACGGCGCCCGG + Intergenic
1069386224 10:67885121-67885143 GAGGCGGCGGCGGCGGCGATTGG + Exonic
1070283355 10:75066301-75066323 GAGAGGGCTGCCACAGCTATGGG - Intergenic
1071544985 10:86522046-86522068 GACGCAGGTGCCACGGAGATGGG + Intergenic
1074740830 10:116483134-116483156 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1077253955 11:1572416-1572438 GAGGCGGCTGCCGCGGGGGGGGG + Intergenic
1077490181 11:2857486-2857508 GAGGCGGCCGCCAGGGGCATCGG + Intergenic
1078000528 11:7491227-7491249 GAGGGGGCTGCCAGGCAGATTGG + Intronic
1078479508 11:11663803-11663825 GAGTCGGCTTCCAGGGCGATTGG - Intergenic
1079250829 11:18786343-18786365 CAGGCGCCTGCCACGGCGCCTGG + Intronic
1084122311 11:67076869-67076891 CAGGCGCCTGCCACGACGCTCGG - Intergenic
1084711542 11:70846952-70846974 GAGCCTGCTGCCACGGGGACTGG + Intronic
1086434846 11:86770786-86770808 GGGGCGGCTGCCAGGCCGAGGGG + Intergenic
1087046818 11:93850061-93850083 GAGGCGGCGGCCACAGGGCTGGG + Intronic
1087510822 11:99090877-99090899 CAGGCGCCTGCCACCGCGACGGG - Intronic
1093071113 12:14708101-14708123 TAGGCGGCTTCCGAGGCGATCGG + Intergenic
1093952592 12:25180947-25180969 CAGGCGCCTGCCACCACGATCGG + Intronic
1094017873 12:25884184-25884206 CAGTCGGCTGCCTCGGGGATGGG - Intergenic
1094626599 12:32130344-32130366 CAGGCGCCTGCCACCGCGCTCGG + Intronic
1096537143 12:52282373-52282395 CAGGCGCCTGCCACCGTGATGGG + Intronic
1097046260 12:56189551-56189573 GAGGCGGCGGCCGCGGCGGCGGG - Intronic
1097929633 12:65169843-65169865 GCGGCGGCGGCCGCGGGGATGGG + Exonic
1099292051 12:80786309-80786331 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1099872837 12:88370159-88370181 CAGGGGGCTTCCAAGGCGATCGG - Intergenic
1100940348 12:99717672-99717694 TAGGGGGCTTCCAAGGCGATCGG - Intronic
1101144827 12:101830949-101830971 GAGGCGGCTGCGGCGGCGGCGGG + Intergenic
1108803826 13:54130918-54130940 TAGGGGGCTTCCAAGGCGATTGG + Intergenic
1110687042 13:78387816-78387838 GAGGAGGCAGCCATGGCGATAGG - Intergenic
1114661043 14:24345038-24345060 GAGGCGGGTGCCACAGTGAATGG - Intergenic
1119780845 14:77275945-77275967 GAGGCGGTTGCCACGGAGACTGG - Exonic
1120651258 14:87135702-87135724 CAGGCGGCTGCCACGACGCCTGG - Intergenic
1122245583 14:100401208-100401230 GAGGCTGCAGCCACGGGGAGGGG - Intronic
1123818624 15:24004016-24004038 GAGGCCACTGCCATGGAGATGGG + Intergenic
1128522850 15:68386931-68386953 GAGGGGGCGGCCAAGGCGAAGGG - Intronic
1129817138 15:78565306-78565328 GAGGCGGGGGCCAGGGCGATGGG + Intergenic
1132701635 16:1224657-1224679 GAGGGGGCTGCCAAGGAGAGGGG + Intronic
1134631128 16:15756939-15756961 CAGGCGCCTGCCACGGCGCCCGG + Intronic
1135582680 16:23641531-23641553 GAGGCGGCGGCCATGGAGTTGGG + Exonic
1137645013 16:50066198-50066220 GAGGCGGCTGCGGCGGCGAATGG + Exonic
1141218074 16:82043539-82043561 CAGGCGCCTGCCACGGCGCCCGG - Intronic
1142281177 16:89148470-89148492 GAGGTGGCTCCCAAGGCCATGGG + Intronic
1142328222 16:89432380-89432402 GAGGCGGCTGCCACGGCGATGGG - Intronic
1145770080 17:27486588-27486610 GAGGCAGCAGCCCCGGGGATGGG + Intronic
1146716203 17:35089077-35089099 GAGGCGGCGGCGGCGGCGCTGGG - Intronic
1148467235 17:47872502-47872524 GCGGCGGCGGCGGCGGCGATGGG + Intergenic
1149752983 17:59163920-59163942 CAGGCGCCTGCCACGGCGCCAGG - Intronic
1150258995 17:63773471-63773493 GAGGCGGCGGCCAGGCCGAGAGG - Exonic
1150624823 17:66835099-66835121 GCGGCGGCGGCCACGGTCATTGG + Exonic
1151812880 17:76454982-76455004 CAGGCGGCTGCCACCGCGCCCGG - Intronic
1155928875 18:31685336-31685358 GACGCGGCTCCGACGGCGCTCGG - Intronic
1155962046 18:32003093-32003115 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1158787345 18:60730671-60730693 CAGGCGCCTGCCACGGCGTCTGG - Intergenic
1159929259 18:74294918-74294940 CAGGAGGCTTCCAAGGCGATCGG - Intergenic
1161121915 19:2532006-2532028 GAGGCGCCTGCCATGGCGCCCGG - Intronic
1163308318 19:16496428-16496450 GTGGCGGCTGCCTCTGCGAATGG + Exonic
1163998812 19:21078434-21078456 CAGGCGCCTGCCACGGCGCCCGG + Intergenic
1164960932 19:32428988-32429010 CAGGCGCCTGCCACCGCGCTTGG + Intronic
1166242923 19:41506086-41506108 GAGGAGGCTGCAACGCCGATCGG + Intergenic
1167238958 19:48331868-48331890 GAGGCGCCTGCCACCGCGCCTGG - Intergenic
1167424968 19:49425522-49425544 GAGGCGGCCGACACATCGATGGG - Intronic
1168232617 19:55042834-55042856 GAGCCGGCTGCCATGGTGAGCGG - Intronic
1168714926 19:58521222-58521244 CAGGCGCCTGCCACCGCGCTCGG - Intronic
929793018 2:45037663-45037685 TAGGCGGCTTCCGAGGCGATCGG + Intergenic
932254943 2:70276347-70276369 TAGGCGCCTGCCACCGCGCTCGG + Intronic
934141308 2:89050406-89050428 CAGGAGGCTTCCAAGGCGATTGG - Intergenic
934227933 2:90150138-90150160 CAGGAGGCTTCCAAGGCGATTGG + Intergenic
935479017 2:103561865-103561887 GAGGTGGCTTCCACGGCCTTGGG + Intergenic
936559104 2:113520946-113520968 GAGGCGGCGGCCGCGGCCAAGGG + Intergenic
937248529 2:120509555-120509577 GAGGGCGCTTCCACGGGGATTGG + Intergenic
944740073 2:202603321-202603343 GAGGCGTGTGCCACTGCGCTCGG - Intergenic
945153054 2:206810081-206810103 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
948254511 2:236556260-236556282 GTGGCGCTTGCCACGGAGATGGG + Intergenic
948793482 2:240390891-240390913 GAGGCGGCCGCCTGGGCGAAAGG - Intergenic
948874700 2:240820355-240820377 GACGCGGCCGCCGCGGGGATGGG + Intergenic
1169243265 20:4003110-4003132 TAGGCGCCTGCCACGGCGCCCGG + Intronic
1169265044 20:4162276-4162298 GAGGCGGCTGCCACAGTCATGGG + Intronic
1171958033 20:31474914-31474936 GAGGCGGATTCCACGGTGCTGGG - Intronic
1172091253 20:32434615-32434637 GAGGCGGCCACCACTGCCATCGG + Exonic
1172127518 20:32633767-32633789 GAGGGGGCTGTCAGGGCGACTGG - Intergenic
1172448486 20:35005542-35005564 GTGGCGGCTTCCAGGGCAATTGG - Intronic
1174317483 20:49713817-49713839 GAGGCGGCGGCGGCGGCGAGTGG - Exonic
1175001176 20:55632261-55632283 GAGGCAGTTGCCAGGACGATAGG + Intergenic
1175358752 20:58390231-58390253 AAGGAGGCTGCCACGGTGCTGGG + Intronic
1175715502 20:61252403-61252425 GCGGCGGCGGCGGCGGCGATCGG + Intergenic
1177606602 21:23387125-23387147 GAGGCGTGAGCCACGGCGCTCGG - Intergenic
1179290381 21:40013218-40013240 GAGGCGGCTTCCATCGGGATGGG + Exonic
1180100088 21:45579844-45579866 GAGGCGGGTGCCCCTGGGATGGG + Intergenic
1180620837 22:17160504-17160526 GAGGCGCCTGCCACCGCGCCTGG - Intronic
951417922 3:22447901-22447923 CAGGCGCCTGCCACCGCGACTGG + Intergenic
952006432 3:28847241-28847263 GAGGGGGCTGCCAGGGAGACAGG - Intergenic
954087112 3:48253640-48253662 CAGGCGGCTGCCACCACGCTAGG + Intronic
961012904 3:123448103-123448125 GCGGCGGCTGCCTCGGCGGGCGG - Exonic
961245865 3:125452758-125452780 TAGGCGCCTGCCACCGCGCTCGG + Intronic
972584246 4:40421876-40421898 CAGGCGGCAGCCACTGCGCTTGG + Intergenic
973896800 4:55421780-55421802 GAGGGGGCTGCCACTGTGATGGG - Intronic
978995311 4:115144022-115144044 CAGGCGTCTGCCACGGCGCCCGG - Intergenic
983434516 4:167695255-167695277 CAGGCGCCTGCCACGGCGCCTGG - Intergenic
984630046 4:182051518-182051540 CAGGCGCCTGCCACCGCGCTCGG + Intergenic
986571279 5:9168535-9168557 GAGGAGGATGCCACGGCCAAGGG + Intronic
994067069 5:95555235-95555257 GAGGCGGCTGGCCCGGCGGCAGG + Exonic
996262457 5:121490464-121490486 GAGGAGGGGGCCACGGGGATGGG - Intergenic
998529275 5:142870150-142870172 GAGGAGGGTGCCACGACGCTTGG + Intronic
999618823 5:153452937-153452959 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1000606976 5:163336507-163336529 CAGGAGGCTTCCAAGGCGATTGG - Intergenic
1001354266 5:171004617-171004639 CAGGGGGCTTCCAAGGCGATGGG + Intronic
1005267381 6:24126253-24126275 GCGGCGGTGGCGACGGCGATGGG + Exonic
1006475227 6:34248822-34248844 GAGGTGGTTCCCACGGCGCTGGG + Intronic
1008850164 6:56014047-56014069 TAGGGGGCTTCCAAGGCGATTGG + Intergenic
1012401260 6:98844387-98844409 GGGGCGGCGGGCACGGCGCTGGG - Intergenic
1013580129 6:111525804-111525826 CAGGCGCCTGCCACCGCGCTCGG - Intergenic
1014454825 6:121623667-121623689 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1015441121 6:133247798-133247820 GAGGCGGCGGCCACCGTGAGAGG - Intronic
1016264081 6:142211566-142211588 GAGGCGCCTGCCACCGCGCCCGG - Intronic
1016819037 6:148330726-148330748 GAGGCGCCTGCCACCACGACCGG + Intronic
1017470564 6:154733842-154733864 GAGGCGGCGGCCACTGCACTGGG - Exonic
1017747022 6:157456170-157456192 GAGGAGGCTGCCACGGCGCGTGG + Intronic
1019533089 7:1513345-1513367 CAGGCGGCTGCCACGGTCACTGG + Intergenic
1020418249 7:7969600-7969622 GAGGCGGCGGCAGCGGCGACGGG - Exonic
1020882916 7:13785432-13785454 CAGGCGCCTGCCACCGCGACTGG + Intergenic
1021645482 7:22785437-22785459 CAGGCGCCTGCCACCGCGCTGGG - Intergenic
1022100149 7:27164646-27164668 GAGGCGGCTGCTGCAGCGAGAGG - Intronic
1026471097 7:70694550-70694572 GAGGCGGCGGCGGCGGCGACAGG - Intronic
1026928824 7:74211598-74211620 GAGGCGCCTGCCACCACGACCGG + Intronic
1029124026 7:98285238-98285260 GTGGAGGCTGCCACGGCCCTTGG + Intronic
1029132945 7:98347630-98347652 CAGGCGCCTGCCACGGCGCCCGG - Intronic
1030766948 7:113421867-113421889 CAGGTGGCTGCCACGGGGTTGGG - Intergenic
1031525637 7:122819403-122819425 TAGGGGGCTTCCAAGGCGATCGG - Intronic
1033088603 7:138365032-138365054 CAGGAGGCTTCCAAGGCGATCGG - Intergenic
1038485596 8:27932906-27932928 CAGGCGTCAGCCACGGCGCTTGG + Intronic
1039725602 8:40212597-40212619 CAGGCGCCTGCCACCACGATTGG - Intergenic
1041516196 8:58701195-58701217 GGGGAGGCTGCCAGGGCCATGGG - Intergenic
1042274246 8:66986477-66986499 GTGGCAGCTGCCGTGGCGATAGG - Intronic
1043769723 8:84183353-84183375 GAGGCGGCGGCGGCGGCGACGGG - Intronic
1043786958 8:84415380-84415402 CAGGCGCCTGCCACGACGCTTGG + Intronic
1045341479 8:101258464-101258486 CAGGCGTCTGCCACCGCGACTGG - Intergenic
1046208674 8:111039699-111039721 CAGGCGGCTGCCACTGCGCCCGG - Intergenic
1052507451 9:29374167-29374189 GAGGTGGCTGTCACGACTATAGG + Intergenic
1053134717 9:35643331-35643353 CAGGGGGCTTCCAAGGCGATTGG - Intronic
1057234892 9:93350088-93350110 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1057305351 9:93909142-93909164 CAGGCGGCAGCCATGGCGCTGGG - Intergenic
1057384462 9:94594935-94594957 CAGGCGCCTGCCACGACGCTTGG + Intergenic
1060019909 9:120120294-120120316 GAGGCTGCAGCCTCGGCAATGGG - Intergenic
1062362252 9:136193593-136193615 GCGGAGGCGGCCTCGGCGATGGG - Intergenic
1062551135 9:137087113-137087135 GAGGCGGCGGCGGCGGCGGTGGG - Exonic
1188200927 X:27292370-27292392 CAGGGGGCTTCCAAGGCGATCGG + Intergenic
1189031764 X:37458995-37459017 CAGGGGGCTTCCAAGGCGATCGG + Intronic
1189854248 X:45208194-45208216 GTGGCTGCTGCCATGGGGATAGG + Intergenic
1189854532 X:45210267-45210289 GTGGCTGCTGCCATGGGGATGGG + Intergenic
1196248376 X:113428191-113428213 GAGGCTGATGCCACGTGGATAGG + Intergenic
1197188025 X:123609884-123609906 GAGGCGCCTGCCACCGCGCCCGG - Intronic
1198826214 X:140700853-140700875 CAGGCGCCTGCCACCGCGACTGG - Intergenic
1200786332 Y:7263813-7263835 GAGGCAGCCGCCATGGCGATGGG - Intergenic