ID: 1142328223

View in Genome Browser
Species Human (GRCh38)
Location 16:89432381-89432403
Sequence GGAGGCGGCTGCCACGGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328223_1142328235 18 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328235 16:89432422-89432444 CTGTGTTGAGGGGTGCTGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 242
1142328223_1142328233 7 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328223_1142328232 6 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328223_1142328234 8 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328223 Original CRISPR GGAGGCGGCTGCCACGGCGA TGG (reversed) Intronic
900284092 1:1891015-1891037 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
900738040 1:4311631-4311653 GGAGACGGCTGCCAAGGGCAGGG - Intergenic
901055288 1:6446336-6446358 GGAGGTGGCTGCCAGGTGGAAGG + Intronic
901279965 1:8026305-8026327 GGCGGCGGCAGCCGCGGCGACGG - Exonic
902350113 1:15847974-15847996 GGAGGCGGGTGCCGGGGCGGCGG - Exonic
902479082 1:16702277-16702299 GGAGGTGGCTGCCAGGTGGAAGG - Intergenic
902940942 1:19799857-19799879 GGAGGCGGCTGCGAAGGCAAAGG + Exonic
903115628 1:21176573-21176595 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
903398294 1:23019611-23019633 GAAGGCGGCAGCCGCGGCGGCGG + Exonic
904048531 1:27623868-27623890 GGAGCCGGTGGCCACGGCCAAGG - Exonic
904618938 1:31764109-31764131 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
904684624 1:32251271-32251293 GGTGGTGGCTACGACGGCGAAGG + Exonic
904822732 1:33256176-33256198 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
905067077 1:35192799-35192821 GGTGGCGGCTGCTGCGGCGGTGG + Exonic
905212777 1:36385865-36385887 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
905422828 1:37859899-37859921 GGCTGTGGCTGCCAGGGCGAGGG - Intergenic
905463075 1:38134010-38134032 GGAGGCGGCGGCCGGGGCGGCGG + Intergenic
906556606 1:46719046-46719068 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
906961417 1:50421470-50421492 GGCGGCGGCGGCAACAGCGACGG - Exonic
910145725 1:84078089-84078111 GGCGGCGGCGGCGACGGCGGTGG - Intronic
910145727 1:84078095-84078117 GGCGGCGGCGGCGGCGGCGACGG - Intronic
910646944 1:89524733-89524755 GGAGGCGGCTACCACGGTGGTGG - Intergenic
911073184 1:93847905-93847927 GGCGGCGGCGGCGGCGGCGAAGG + Intergenic
912305207 1:108560120-108560142 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
912408956 1:109466771-109466793 GGAGGCGGCGGACACGGCGGGGG - Exonic
912776404 1:112508825-112508847 GGAGGCGGCTGCTACACCTAGGG + Exonic
915440410 1:155942207-155942229 GGCGGCGGCTGCCCTGGTGACGG + Exonic
916436702 1:164784309-164784331 GGTGCCGGCTGCCTGGGCGAGGG - Intronic
916890262 1:169106623-169106645 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
917345179 1:174022148-174022170 GGCGGCGGCTGCCGCGGCGGTGG - Exonic
922279940 1:224114166-224114188 GGAGGCGGCGGCCAAGGCGACGG + Exonic
923171553 1:231421889-231421911 GGCGGCGGCGGCGGCGGCGACGG + Exonic
923282794 1:232461008-232461030 CGAGGCGGCTCCCTTGGCGAAGG + Exonic
924415166 1:243850293-243850315 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
1062888361 10:1036702-1036724 GCAGGCAGCTGACACGGCGTTGG - Intergenic
1063776700 10:9273220-9273242 CGGGGCGGCTGCCCCGGCGGGGG + Intergenic
1064443053 10:15370881-15370903 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1064573116 10:16716233-16716255 GGAGGTGGGTGCCAGGGCCAGGG + Intronic
1065140530 10:22714651-22714673 GGAGGCGGCTGCGGCGCCGCGGG + Intergenic
1068204178 10:53827435-53827457 GGAGGCGGCGGCGGCGGCGGGGG + Exonic
1068783332 10:60944296-60944318 AGCGGCGGCCGCCACGGCGGCGG - Intronic
1069818407 10:71212897-71212919 GGAGGCGGCGGCGGCGGAGACGG + Exonic
1071086974 10:81875759-81875781 GGAGGCGGCACCCCCGGCGGAGG - Exonic
1072615542 10:97046897-97046919 GGGGGCAGCTCCCACGGCGGGGG - Intronic
1073266366 10:102230670-102230692 AGAGGCGGCAGCCGCGGCGGCGG + Exonic
1074086144 10:110210053-110210075 GGTGGCGGCGGCCAGGGCGGCGG - Intronic
1075438455 10:122461609-122461631 GGTGGCGGCGGACAGGGCGAGGG - Exonic
1076372402 10:129963969-129963991 GGAGGCGGCTCCACCGGCGGCGG + Intergenic
1077043583 11:535078-535100 GGAGGAGGCGGCCGCGGCCACGG - Intronic
1077253954 11:1572415-1572437 TGAGGCGGCTGCCGCGGGGGGGG + Intergenic
1077441715 11:2572004-2572026 GGAAGCGGATGCCCCTGCGAAGG - Exonic
1077781177 11:5331228-5331250 GGAGGAGGCTGCCATTGCCAAGG + Intronic
1078008142 11:7547883-7547905 GGAGGCGGCAGGCATGGGGAAGG - Intronic
1081045667 11:38270055-38270077 GGGAGGGGCTGCCACAGCGAAGG + Intergenic
1082797284 11:57387424-57387446 GGAGGCAGCTGCCCAGGAGAGGG + Exonic
1083148395 11:60774954-60774976 GGAGGCTGGTGCCACGGTGCAGG + Intronic
1083448543 11:62727153-62727175 GGAGGAGGCGGCGGCGGCGATGG - Exonic
1083457997 11:62791791-62791813 GGACACGGCTGCCACAGCCATGG + Exonic
1083595550 11:63916969-63916991 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
1083595552 11:63916975-63916997 GGCGGCGGCGGCGACGGCGGCGG + Intergenic
1083880856 11:65547602-65547624 GGAGGCGGCGGGCAAGGGGAGGG + Intronic
1084316200 11:68347282-68347304 GGAAGCTGATGCCACGGCCAAGG + Intronic
1085346042 11:75768773-75768795 AGAGGCGGCAGCCGCGGCGCTGG - Exonic
1086434845 11:86770785-86770807 CGGGGCGGCTGCCAGGCCGAGGG + Intergenic
1087252999 11:95924225-95924247 GGTGGCGGCTCCCAGGGTGAGGG + Exonic
1087510823 11:99090878-99090900 ACAGGCGCCTGCCACCGCGACGG - Intronic
1089348411 11:117807056-117807078 GGAAGCGGGTGCCCCGGCCAAGG - Intronic
1092654967 12:10674344-10674366 GGAGGCCGCTGCTACGGGGCCGG - Intergenic
1092849224 12:12611933-12611955 GGAGGAGGCGGCGGCGGCGAAGG + Exonic
1094017874 12:25884185-25884207 GCAGTCGGCTGCCTCGGGGATGG - Intergenic
1094466012 12:30754688-30754710 GGAGGCGGCTGACCCGGCGAGGG - Intronic
1094653435 12:32399399-32399421 GGAGGCGGCGGCGGCGGCGGCGG + Intergenic
1096241395 12:49961978-49962000 GGCGGCAGCTGCCGCGGCGGGGG - Exonic
1097046261 12:56189552-56189574 GGAGGCGGCGGCCGCGGCGGCGG - Intronic
1097232826 12:57522740-57522762 GGCGGCGGCTGCGGCAGCGACGG + Exonic
1097648084 12:62260372-62260394 GGAGGTGGCAGCGACGGCGGCGG - Exonic
1097850266 12:64404472-64404494 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
1097929632 12:65169842-65169864 GGCGGCGGCGGCCGCGGGGATGG + Exonic
1098320572 12:69239608-69239630 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1099989638 12:89708841-89708863 GGAGGCGGCGGCGGCAGCGAAGG + Intronic
1101144826 12:101830948-101830970 AGAGGCGGCTGCGGCGGCGGCGG + Intergenic
1101482005 12:105107595-105107617 GAAGGCGGCCGCCATGGCGCCGG - Intronic
1101605913 12:106247718-106247740 GGCGGCGGCTGCTGCGGCGCCGG + Exonic
1102518484 12:113465341-113465363 GGAGGCGGCGCGCACGGCGCGGG - Intronic
1103581445 12:121918553-121918575 GGTGGCGGTTGCCATGGGGACGG + Exonic
1103779530 12:123389461-123389483 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1103972096 12:124678788-124678810 GGAGGCTGCTGCCATGGCGACGG + Intergenic
1104444714 12:128823865-128823887 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1105217515 13:18297721-18297743 GGAGGCGGCGGCGGCGGCGGTGG + Intergenic
1106478032 13:30114806-30114828 GGAGGCGGCGGCGGCGGCGGGGG + Intergenic
1108689271 13:52847309-52847331 GGCGGCGGCGGCAGCGGCGAAGG + Exonic
1108727782 13:53201087-53201109 GGCGGCGGCGGCAGCGGCGAAGG - Intergenic
1110443376 13:75549760-75549782 GGAAGCGGCGGCGGCGGCGAAGG + Intronic
1112261026 13:97878631-97878653 GGAGGCGGCAACCATGGAGAAGG + Intergenic
1112507819 13:99985466-99985488 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
1113419010 13:110155363-110155385 TGAGGCGCCTGCCATGGTGATGG - Exonic
1114664039 14:24368210-24368232 GGAGGCGGCAGCGACGGAGGAGG + Intronic
1115399143 14:32938832-32938854 GGAGGCGGCGGCGGCGGCGGGGG - Intronic
1116928608 14:50668046-50668068 GGAGGCGGCGGCGCCGGCGGAGG - Exonic
1117478264 14:56118615-56118637 GGAGGCGGCGGCGTCGGCGGCGG + Exonic
1117690262 14:58298887-58298909 GGAGGCGGCTGCAACTGCGGCGG - Intronic
1118734355 14:68691153-68691175 GGAGGCGGTTGCCATGGAAACGG - Intronic
1119003983 14:70907810-70907832 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1119003985 14:70907816-70907838 GGCGGCGGCGGCGACGGCGGCGG + Exonic
1119197186 14:72725706-72725728 GGAGGCGGCTTAAACAGCGATGG - Intronic
1119649914 14:76376253-76376275 GGAGGAGGCGGCCGCGGCGGGGG - Intronic
1120521875 14:85533874-85533896 GGCGGCGGCGGCGACGGCGGCGG - Intronic
1120813989 14:88834166-88834188 GGAGGAGGCTGCCACAGTGAGGG + Intronic
1121539013 14:94711237-94711259 GGAGGCGACTGCCAGGCGGAGGG - Intergenic
1122130894 14:99604157-99604179 GGAGGCGGCTGCTGCGTCGGCGG + Intergenic
1122162372 14:99793587-99793609 GCGGGCGGCGGCGACGGCGACGG + Intronic
1122245584 14:100401209-100401231 AGAGGCTGCAGCCACGGGGAGGG - Intronic
1122444995 14:101761707-101761729 GGCTGCGGCAGCCACGGCGGCGG - Intergenic
1122717325 14:103703487-103703509 GGAGGTGGCTGCCAGTGGGAGGG - Intronic
1123818623 15:24004015-24004037 GGAGGCCACTGCCATGGAGATGG + Intergenic
1124830608 15:33145595-33145617 GGTAGCGGCTACCACGGGGAGGG - Intronic
1124971143 15:34490537-34490559 GGAGGCGGCGGCGGCGGCGGTGG - Intergenic
1125918538 15:43510683-43510705 CGAGGCGGTTGCCTCGGCGCCGG - Intronic
1126767007 15:52019449-52019471 GGCGGCGGCGGCGGCGGCGACGG + Intronic
1127542394 15:59953465-59953487 CCAGGCGGCAGCCACGGAGATGG + Intergenic
1128161003 15:65422878-65422900 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1128522851 15:68386932-68386954 TGAGGGGGCGGCCAAGGCGAAGG - Intronic
1129817137 15:78565305-78565327 GGAGGCGGGGGCCAGGGCGATGG + Intergenic
1130538218 15:84802150-84802172 GGAGGCGGCGGCAGCGGAGATGG + Exonic
1130564422 15:84981689-84981711 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
1131948439 15:97653097-97653119 GGGGGCTGCTGCCACCGCGCCGG - Intergenic
1132701634 16:1224656-1224678 GGAGGGGGCTGCCAAGGAGAGGG + Intronic
1133212874 16:4272869-4272891 GGCGGCGGCGGCGGCGGCGAGGG + Exonic
1133311135 16:4847529-4847551 TGAGGCGGCGGCGGCGGCGACGG + Intronic
1135023801 16:18983996-18984018 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1135276867 16:21120743-21120765 GCACGCGGCTGCCACTGCAATGG - Exonic
1135517615 16:23148939-23148961 GGCGGCGGCGGGCACGGCGGCGG + Exonic
1135582679 16:23641530-23641552 GGAGGCGGCGGCCATGGAGTTGG + Exonic
1137236325 16:46621305-46621327 GGAGGCAGCGGCCATGGCGCCGG - Exonic
1137617269 16:49855518-49855540 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1137617681 16:49856879-49856901 GGAGGCGGCGGCCGCGGTGGCGG + Intronic
1137617793 16:49857319-49857341 GGCGGCGGCAGGCACGGCGCGGG + Intronic
1137708028 16:50548668-50548690 GGCGGCGGCAGCCGCGGCGGCGG - Intronic
1138044232 16:53704120-53704142 GGAGGCGGGGTCCAGGGCGAGGG + Exonic
1138244712 16:55458994-55459016 GGAGGCGGCTTCCAAGGCAGAGG - Intronic
1138328066 16:56191747-56191769 GGAGGCGGCGGCGGCGGCGCGGG - Intronic
1139409908 16:66751176-66751198 GCAGGCGGCTGGAACGGGGAAGG + Intronic
1139917806 16:70439019-70439041 GGCGGCGGCGGCGGCGGCGACGG - Intronic
1141972501 16:87492910-87492932 GGCGGCGGCGGCGACGGCGACGG + Intergenic
1141972502 16:87492916-87492938 GGCGGCGACGGCGACGGCGACGG + Intergenic
1142136265 16:88453295-88453317 GGAGCAGGCGGCCACTGCGAGGG - Exonic
1142172980 16:88632449-88632471 GGAGGCCGCTGCCCAGGCGCAGG - Intergenic
1142198433 16:88749607-88749629 CGAGGCGGCTTCCACGGCTCTGG - Intronic
1142281176 16:89148469-89148491 GGAGGTGGCTCCCAAGGCCATGG + Intronic
1142328223 16:89432381-89432403 GGAGGCGGCTGCCACGGCGATGG - Intronic
1142482921 17:229672-229694 GGAGGCTGCTTCCATGGCCATGG + Intronic
1145077503 17:19867818-19867840 GGGCGCTGCTGCGACGGCGACGG + Exonic
1145770079 17:27486587-27486609 GGAGGCAGCAGCCCCGGGGATGG + Intronic
1146492386 17:33292277-33292299 GGAGGCGGCAGCGGCGGCGCCGG - Exonic
1146716204 17:35089078-35089100 GGAGGCGGCGGCGGCGGCGCTGG - Intronic
1146773132 17:35587405-35587427 GGAGGCGGAGGCGAAGGCGAGGG - Exonic
1147307399 17:39573622-39573644 GGCGGCGGCGGCGGCGGCGATGG - Intergenic
1147406981 17:40219381-40219403 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1147448393 17:40488853-40488875 GGAGGAGGCCACCACTGCGAAGG + Exonic
1147486427 17:40819135-40819157 GGAGGCGGCGGACGCGGCGGCGG - Exonic
1148126968 17:45242074-45242096 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1148262222 17:46193494-46193516 GGCTGCGGCTGCGGCGGCGAAGG + Intronic
1148467234 17:47872501-47872523 GGCGGCGGCGGCGGCGGCGATGG + Intergenic
1148489188 17:48012380-48012402 GGCCGCGGTTGCCATGGCGACGG + Intergenic
1148664046 17:49361774-49361796 GCACGCAGCTGCCTCGGCGAAGG + Intronic
1148936087 17:51165747-51165769 GGAGGCGGCAGCCAGGGAGCAGG + Intronic
1149038401 17:52158993-52159015 GGAGGCGGCTGCCAGGGACTGGG - Intronic
1149994704 17:61400350-61400372 GGGGGCGGCGGCCGCGGCGGCGG + Exonic
1149995879 17:61405696-61405718 GCAGGCGGCGGCAACGGCGGAGG + Exonic
1150108612 17:62479138-62479160 GGCGGCGGCTGCCCGGGCGGGGG + Exonic
1150259153 17:63774241-63774263 GGTGGCGGCGGCGGCGGCGAAGG + Exonic
1150561933 17:66302358-66302380 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
1152066472 17:78115283-78115305 GCTGGCGTCTGCCAAGGCGAGGG - Intronic
1152077510 17:78168590-78168612 GGCGGCGGCAGCGGCGGCGACGG + Exonic
1153299448 18:3580516-3580538 GGAGGCGGCGGCAGCGGAGATGG + Intronic
1153514490 18:5891374-5891396 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1155392727 18:25352320-25352342 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
1155654336 18:28177055-28177077 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1157826877 18:50820130-50820152 GAAGGAGGCAGCCACGGCGGCGG - Intronic
1157867055 18:51196774-51196796 GGAGGCGGCGGCCGCGGCGGCGG - Exonic
1158137591 18:54224216-54224238 GGCGGCGGCTGCGGCGGCGGCGG - Exonic
1160719163 19:589997-590019 GGCGGCGGCGGCCCCGGCGCGGG - Exonic
1160930692 19:1568273-1568295 GGCGGCGGCGGCGACGGCGGCGG + Intergenic
1161080592 19:2308156-2308178 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1161162157 19:2767579-2767601 TGAAGCGGCTGCCACGGGCAAGG - Exonic
1161471253 19:4457698-4457720 GGTGGCGGCTGGCCCGGCGGCGG + Exonic
1161628827 19:5341074-5341096 GGTGGCGGCTGCGGCGGCGGCGG + Intergenic
1161802718 19:6424742-6424764 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1162046840 19:8005592-8005614 GGCGGTGGCGGCGACGGCGACGG + Exonic
1162296716 19:9818874-9818896 CGAGGCGGCTGACAGGGCGGCGG + Exonic
1163609746 19:18294684-18294706 GGAGGCGGCTGTGACGGTGGTGG + Intergenic
1163611345 19:18303494-18303516 GGAGGAGGCTGCCAGGGCCTAGG - Intergenic
1163748117 19:19059978-19060000 GGAGGAGCCGGCCACGGGGAAGG - Intronic
1164402207 19:27910081-27910103 GGCAGCGGCTGCCACGGTGGAGG - Intergenic
1164693204 19:30226030-30226052 GGAGGCGGCGGCCCAGGCGCAGG - Intergenic
1164722903 19:30445080-30445102 GCAGGCGGCTGCCAAGGCTGCGG + Exonic
1165070612 19:33253140-33253162 GGGGGCGGCTGCCTCTGGGAAGG + Intergenic
1165157410 19:33796719-33796741 GGAGGCGGCGGCCGCGAAGAGGG + Intronic
1165349622 19:35268879-35268901 GGCGGCGGCTGCGGCGGCGGCGG + Intergenic
1165791770 19:38496878-38496900 GGAGGCAGCAGCCACGTCCAGGG - Exonic
1165837718 19:38769908-38769930 GGCGGCGGCCGCCAGGGGGACGG + Intergenic
1166108820 19:40610642-40610664 GGAGCCAGCTGCCAGGGTGAGGG + Exonic
1166211648 19:41310313-41310335 GGAGGCCGTGGCGACGGCGACGG + Exonic
1166304251 19:41928590-41928612 GGAGGCGGCGGCGGCGGCGCGGG + Intronic
1166358673 19:42242519-42242541 GGAGGCGGCGGCAGCGGCGGCGG - Exonic
1167424969 19:49425523-49425545 GGAGGCGGCCGACACATCGATGG - Intronic
1167505815 19:49870576-49870598 GGCGGGGGCTGACACAGCGAGGG - Intronic
1167558508 19:50210622-50210644 GGAGGCGGCTGCGACTGCCGCGG + Exonic
1168288491 19:55346051-55346073 CGAGGCGGCTGCCTTGCCGAGGG - Intronic
1168339514 19:55615133-55615155 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1202713123 1_KI270714v1_random:28184-28206 GGAGGTGGCTGCCAGGTGGAAGG - Intergenic
925221968 2:2149009-2149031 GGAGGCGGCTGTCACCAAGAGGG + Intronic
926299217 2:11590244-11590266 TGAGGCGGCAGCCACAGAGAGGG - Intronic
926697711 2:15782369-15782391 GGCTGCGGCTGCCCCGGGGAGGG + Intergenic
928118387 2:28564362-28564384 GGAGGAGGCTGCCACAGCATAGG - Intronic
930872761 2:56184648-56184670 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
932492957 2:72133147-72133169 AGTGGCGGCTGCCCCTGCGAGGG - Exonic
932621869 2:73269454-73269476 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
932635672 2:73385946-73385968 GGAGGAGGCTGCAGCGGCGGCGG + Exonic
934011545 2:87825363-87825385 GGCGGCGGCGGCCTCGGCGTAGG - Intronic
934079064 2:88452317-88452339 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
935679877 2:105626782-105626804 GGAGGTGGCTGCCCAGGAGAGGG - Intergenic
936290773 2:111222346-111222368 GGAGGCTGCTGCCAGGGCAAGGG - Intergenic
936533246 2:113291350-113291372 GGCGGCGGCTGTCACGGGGCTGG + Intergenic
936559103 2:113520945-113520967 GGAGGCGGCGGCCGCGGCCAAGG + Intergenic
936939643 2:117871072-117871094 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
937985615 2:127636874-127636896 GCAGGCGGCTGCCACGGCCCAGG - Exonic
938825810 2:135004413-135004435 GCAGGCGGCTGCCCAGGAGAGGG + Intronic
942346217 2:175005264-175005286 GGCGGCGGCGGCGGCGGCGACGG + Intronic
942454823 2:176130408-176130430 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
942748722 2:179264630-179264652 GGCGGCGGCAGCAGCGGCGACGG + Exonic
944547541 2:200812357-200812379 GGAGGCGGCGGCCGCAGCGGTGG - Exonic
945648934 2:212537130-212537152 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
945699414 2:213151716-213151738 GGCGGCGGCTGCGGCGGCGGCGG + Intronic
946019808 2:216633395-216633417 GGACCCGGCTGCGGCGGCGAGGG + Exonic
946352647 2:219165349-219165371 GGTGGAGGCTGCCAAGGCCATGG + Exonic
946354590 2:219176954-219176976 GGAGGGAGCTGCGAGGGCGAGGG - Intronic
946354920 2:219178472-219178494 GGAGGAGGCGGCCACGGCCGAGG + Exonic
946410376 2:219512590-219512612 GGAGGCGGCTGCCTGGGCATGGG + Intergenic
948254510 2:236556259-236556281 GGTGGCGCTTGCCACGGAGATGG + Intergenic
948875409 2:240824309-240824331 GGAGGCTGCAGCCAGGGCAAGGG - Intergenic
1169126013 20:3127151-3127173 GGAGAGGTCTGCCACTGCGAGGG - Intronic
1169265043 20:4162275-4162297 TGAGGCGGCTGCCACAGTCATGG + Intronic
1169754972 20:9034246-9034268 TGAGGCGGCTCCCACAGCCAAGG - Intergenic
1171877073 20:30586317-30586339 GGAGGCGGCTGCACCGGGGCAGG + Intergenic
1172037336 20:32019230-32019252 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1172252560 20:33490090-33490112 GGCGGCGGCGGCGGCGGCGACGG + Intronic
1172474461 20:35226684-35226706 GGCGGCGGCGGCGGCGGCGAAGG + Exonic
1172502318 20:35436326-35436348 GGAGGGGGCTGCCAGGGGGCGGG - Intronic
1173454152 20:43189972-43189994 GGCGGCGGCGGCAACGGCGGCGG - Intergenic
1173922276 20:46755287-46755309 GGAGGCAGCTGCCACGGCCCAGG - Intergenic
1175267184 20:57709920-57709942 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1175429395 20:58891300-58891322 GGAGGAGGCGGCGGCGGCGAGGG - Intronic
1176039423 20:63056471-63056493 GGAGCCGGTTGCCACAGTGACGG - Intergenic
1176128481 20:63486501-63486523 GGTGTCGGCAGCCACGGCAAGGG + Intergenic
1179290380 21:40013217-40013239 GGAGGCGGCTTCCATCGGGATGG + Exonic
1180100087 21:45579843-45579865 GGAGGCGGGTGCCCCTGGGATGG + Intergenic
1180559231 22:16601991-16602013 GGCGGCGGCGGCCGCGGCGGCGG + Intergenic
1180600502 22:17012328-17012350 GGAGGAGGCTGCCACTCCCAGGG + Intergenic
1181478024 22:23180568-23180590 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1182352629 22:29707293-29707315 GCAGGAGGCAGCCTCGGCGAGGG - Intergenic
1182576432 22:31276454-31276476 GGCGGCGGCAGCCCCGGCGGCGG + Intronic
1182903954 22:33920749-33920771 GGAGGCGGCGGCGGCGGCCAAGG - Intronic
1183396553 22:37574764-37574786 GGAGGCGGCTGCCAGCGAGAGGG - Intronic
1183444508 22:37844224-37844246 GGCGGCGGCTGCCATGGCAACGG + Exonic
1183524953 22:38317356-38317378 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1183710953 22:39502767-39502789 AAAGGCGACTGTCACGGCGAGGG - Intronic
1184337500 22:43862390-43862412 GGCGGCGGCGGCGACGGCGACGG - Exonic
1184557411 22:45240838-45240860 GGTGGCGGCGGCGGCGGCGACGG - Intergenic
1185139017 22:49089887-49089909 GGAGGCGGCTGGCACGCAGGAGG + Intergenic
1185342310 22:50297149-50297171 GGAGGTGGCAGCCATGGCGGTGG + Intronic
951907900 3:27721929-27721951 GGCGGCGGCTGCAGCGGCGGAGG + Exonic
953989877 3:47475826-47475848 GGCGGCGGCGGCGGCGGCGACGG + Exonic
954356813 3:50088882-50088904 GGAGGCGGGTGACAGGGGGAGGG + Intronic
954404973 3:50340643-50340665 GGAAGCGGTGGCCACGGCCAGGG + Exonic
956813551 3:72888065-72888087 GGCGGCGGCGGCGACGGCGAAGG - Exonic
958949405 3:100400752-100400774 GGAGTCGGCAGCAACGGCGCCGG - Exonic
961081614 3:124033192-124033214 GGAGGCGGCTGCTGCGGCGGCGG + Intergenic
961567542 3:127774336-127774358 GCAGGAGGCTGCCAGGGAGAGGG - Intronic
961827625 3:129606981-129607003 GGCGGCGGCGGCTACGGGGAGGG - Intergenic
966849402 3:184155442-184155464 GGAAGCGGCGGCCGCGGCGGCGG + Exonic
968582993 4:1403538-1403560 GGGGGCCGCTGCCTCGTCGACGG + Exonic
968820219 4:2844158-2844180 GGAGGCCGCTGCGGCGCCGAGGG + Intronic
968850561 4:3074949-3074971 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
969375503 4:6760914-6760936 GGAGGCAGGTGCCACGGCCCAGG - Intergenic
969413345 4:7043444-7043466 GGTGGCGGCAGCCGCGGCGGCGG + Exonic
970445537 4:16120780-16120802 GGAGGCGGTGGCCACGGCCCTGG - Intergenic
971288443 4:25312678-25312700 GGCGGGGGCTGCCGCGGCGGAGG - Intergenic
973896801 4:55421781-55421803 AGAGGGGGCTGCCACTGTGATGG - Intronic
975778702 4:77818673-77818695 CGCGGAGGCGGCCACGGCGACGG + Intronic
975778964 4:77819617-77819639 GGCGGCGGCGGCGGCGGCGACGG + Intergenic
978126827 4:105146137-105146159 GGAGGCGGGGGCCAGAGCGAGGG + Intronic
979785592 4:124712469-124712491 GGCAGCGGCGGCCACGGCGGCGG - Exonic
981034373 4:140154110-140154132 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
981270880 4:142846377-142846399 GCAGGCGGCGGCGACGGCGCAGG + Intronic
981366666 4:143912144-143912166 GGAGGCGGCGGCGCCGGCGGAGG - Intergenic
982157387 4:152535766-152535788 GGAGGCGGCTACCACGGGCCGGG - Exonic
985679685 5:1249420-1249442 GGACCCCGCTGCCACGGCCAGGG + Intergenic
986571278 5:9168534-9168556 GGAGGAGGATGCCACGGCCAAGG + Intronic
987050802 5:14144902-14144924 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
987108707 5:14664894-14664916 GGAGGCGGCGGCCACGGCGCGGG + Exonic
987747599 5:21996246-21996268 GGAGGCAGCTGGCATGGCGAGGG - Intronic
989273179 5:39555963-39555985 GGAGGCAGCTGCCAGGGACAGGG - Intergenic
991767781 5:70006042-70006064 GGAGGCAGCTGGCATGGCCAGGG - Intergenic
991847015 5:70881120-70881142 GGAGGCAGCTGGCATGGCCAGGG - Intergenic
993252756 5:85549860-85549882 GGAGGAGGCTGCCAGGAAGAAGG + Intergenic
993386551 5:87268573-87268595 GGGGGCGGCTGCCACAGGCAGGG - Exonic
993900976 5:93584318-93584340 GGAGGCGGCGGCGGCGGCGGAGG - Exonic
994072823 5:95620837-95620859 GGCGGCGGCGGCAGCGGCGAGGG - Exonic
994367127 5:98928904-98928926 GGCGGCGGCTACGACGGAGACGG - Exonic
996262458 5:121490465-121490487 GGAGGAGGGGGCCACGGGGATGG - Intergenic
996978485 5:129461437-129461459 GGCGGCGGCTGCCACGAGGCCGG - Exonic
997233059 5:132257664-132257686 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
998098656 5:139413463-139413485 GGAGGCGGGGGCCAGGGCGAAGG - Exonic
1001506374 5:172283719-172283741 GGAGGAGGCTGCAGCGGCGGCGG - Exonic
1003645528 6:7910638-7910660 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1004561870 6:16760232-16760254 GGAGGCGGCGGCCGCCGCGGAGG - Intronic
1004799917 6:19134839-19134861 GGAGGCGGCTGTCAGTGAGATGG - Intergenic
1005135983 6:22570121-22570143 GGCGGCGGCGGCGGCGGCGACGG + Exonic
1005267358 6:24126150-24126172 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
1005267380 6:24126252-24126274 GGCGGCGGTGGCGACGGCGATGG + Exonic
1006475226 6:34248821-34248843 GGAGGTGGTTCCCACGGCGCTGG + Intronic
1006717846 6:36131404-36131426 GGTGGTGGCTGCCCCGGGGAGGG + Intronic
1006937096 6:37726058-37726080 GCAGTCGGCTGCCACTGGGAGGG + Intergenic
1007902221 6:45422756-45422778 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
1011194008 6:84764003-84764025 GGAGGCTGCAGCCGCGGCGGCGG - Exonic
1012401261 6:98844388-98844410 GGGGGCGGCGGGCACGGCGCTGG - Intergenic
1014947502 6:127515688-127515710 GGAGGCGGAGGCGACGGCCAGGG + Exonic
1015965590 6:138693083-138693105 GGCGGCGGCCGCGGCGGCGAGGG + Intergenic
1017672025 6:156777855-156777877 GGGGGCGGCGGCGACGGCGGCGG + Intergenic
1017672310 6:156778946-156778968 GGCGGCGGCGGCCGCGGCGGCGG + Exonic
1017738097 6:157381575-157381597 CGAGGCGGCGGCCCCGGCGCCGG - Exonic
1018100195 6:160431282-160431304 AGTGGCGGCCGCCACGGCGCAGG + Intronic
1020418250 7:7969601-7969623 CGAGGCGGCGGCAGCGGCGACGG - Exonic
1021451279 7:20785412-20785434 GGAGGCGGCGGCTGCGGCGGCGG + Exonic
1021451280 7:20785415-20785437 GGCGGCGGCTGCGGCGGCGGCGG + Exonic
1022207949 7:28180778-28180800 GGAGGCGGCGGCTGCGGCGGCGG + Intergenic
1022441241 7:30435301-30435323 GGAGGAGGCTGCCTGGGGGAAGG + Intronic
1023638814 7:42237986-42238008 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
1023937293 7:44748948-44748970 GCCGGGGGCCGCCACGGCGAGGG + Exonic
1024975341 7:55109041-55109063 GGAGGGGGCTGCAAGGGAGAAGG + Intronic
1025739047 7:64182025-64182047 GGCGGCGGCTGCGGCGGCGGCGG - Intronic
1025916926 7:65873345-65873367 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
1029456213 7:100673833-100673855 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1029461135 7:100694364-100694386 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
1029996758 7:105014165-105014187 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1030739067 7:113086575-113086597 GGCGGCGGCTGCGGTGGCGAGGG + Intronic
1030766949 7:113421868-113421890 GCAGGTGGCTGCCACGGGGTTGG - Intergenic
1032345164 7:131110043-131110065 GGAGGCGGCGGCGGCGGCGGCGG + Intergenic
1033654345 7:143362762-143362784 GGCGGCGGCGGCGGCGGCGACGG - Intronic
1034441150 7:151086674-151086696 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1034531122 7:151697056-151697078 GGAGGCGCCTGGCATGGGGAAGG + Intronic
1034618016 7:152435838-152435860 GGCGGCGGCGGCCGCGGCGGCGG - Exonic
1036675267 8:10826680-10826702 GGCGGCCGCTGCCACCGCAATGG + Intronic
1036723754 8:11201212-11201234 GGAGGCGGCTGCGGCGGCGGCGG - Exonic
1037262941 8:17027639-17027661 AGTGGCGGCTGCCAAGGAGACGG + Exonic
1037865813 8:22441341-22441363 GAAGGCGGCGGCCGCGGCGTAGG + Exonic
1039454606 8:37698424-37698446 GGAGGCGGCGGCGGCGGCGGCGG - Exonic
1042758685 8:72247045-72247067 GGAGGTGGATGCCACAGAGATGG - Intergenic
1043769724 8:84183354-84183376 CGAGGCGGCGGCGGCGGCGACGG - Intronic
1044115250 8:88327516-88327538 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1044719752 8:95133992-95134014 GGCGGCGGCGGCGACAGCGAAGG - Exonic
1046659967 8:116938483-116938505 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1048244144 8:132775407-132775429 GGCGGCGGCGGCGGCGGCGATGG + Exonic
1048345597 8:133572267-133572289 GGAGGCGGCGGCTGCGGCGCGGG + Intergenic
1048980893 8:139703090-139703112 GGAGGCGGCGGCGGCGGCGGCGG - Intergenic
1049181873 8:141227043-141227065 GCAGGGGGCTGCCACTGGGACGG + Intronic
1049299224 8:141861034-141861056 GGAGGCTGCCGCCAGGGGGAGGG + Intergenic
1049828680 8:144686038-144686060 GGAGGCCTCTGGCGCGGCGACGG - Intergenic
1049893749 9:95236-95258 GGAGGAGGCGGCCGCGGCCAAGG - Intergenic
1050325059 9:4490515-4490537 GGTGGCGGCGGCAACGGCGGTGG + Exonic
1052881044 9:33601040-33601062 CGGGGCGGCTGCCAGGCCGAGGG - Intergenic
1053050615 9:34958238-34958260 GGAGGCGGCGGCGGCGGCGGCGG - Intronic
1053734974 9:41095320-41095342 GGAGGAGGTGGCCACGGCCAAGG - Intergenic
1055514203 9:77020308-77020330 GGAGGCGGCGGCCGTGGCGGCGG + Exonic
1056276346 9:84997847-84997869 GGTGGCATCTGCCACAGCGAGGG - Intronic
1057009554 9:91589521-91589543 GGAGGCGGCTTCCCCGGGGCTGG + Intronic
1057305352 9:93909143-93909165 GCAGGCGGCAGCCATGGCGCTGG - Intergenic
1058467523 9:105244510-105244532 GGAGGCGGCGGCCCGGGAGAGGG + Intergenic
1059136180 9:111808617-111808639 GGAGGCGGCTTCCAGGGCATAGG - Intergenic
1060468702 9:123930050-123930072 GGAGGCGGCGGCGGCGGCGAGGG - Exonic
1060599639 9:124869374-124869396 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1061438150 9:130579650-130579672 GGCGGCGGCGGCGACGGCGGCGG + Exonic
1061666184 9:132162072-132162094 GGCGGCGGCGGCCACAGCGGCGG + Exonic
1061919396 9:133774445-133774467 GGAGGCGGCTCCCAGGGAGAGGG + Intronic
1062311074 9:135937669-135937691 GTAAGCCGCGGCCACGGCGACGG + Intronic
1062339010 9:136085604-136085626 GGAGGCGGCTGCCAGGGGGTGGG + Intronic
1185508286 X:644533-644555 GGCGGCGGCGACCACGGCGGCGG - Exonic
1186604833 X:11078942-11078964 GCAGAAGGCTGCCACGGCCAAGG + Intergenic
1187067463 X:15854724-15854746 GGCGGCGGCGGCGGCGGCGAAGG + Exonic
1187181436 X:16946864-16946886 GGAGGCGGCAGCGGCGGCGGCGG + Exonic
1188005531 X:25013640-25013662 GGCAGCGGCCGCCACGGCCACGG - Exonic
1190062214 X:47218911-47218933 GGAGGCGGCGGCGGCGGCGGTGG - Intronic
1190285378 X:48957726-48957748 GGAGGCGGCGGCGGCGGCGGCGG + Intronic
1190440476 X:50470578-50470600 GGCGGCGGCGGCCAAGGCGGCGG + Exonic
1190713060 X:53083058-53083080 GGAGGCGGCGGCGGCGGCGGAGG + Exonic
1193114864 X:77766464-77766486 CGAGGCGGTTGCCACGCAGAGGG + Intronic
1193743280 X:85244121-85244143 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1197962677 X:132023370-132023392 GGAGGCGGCTGCTTCAGCGGCGG + Intergenic
1199445116 X:147912079-147912101 GGAGGCGGCGGCGGCGGCGGCGG + Exonic
1199612720 X:149631720-149631742 GGCGGCGACGGCGACGGCGACGG - Exonic
1199612721 X:149631726-149631748 GGCGGCGGCGGCGACGGCGACGG - Exonic
1199612722 X:149631732-149631754 GGCGGCGGCGGCGGCGGCGACGG - Exonic
1200786333 Y:7263814-7263836 GGAGGCAGCCGCCATGGCGATGG - Intergenic