ID: 1142328225

View in Genome Browser
Species Human (GRCh38)
Location 16:89432393-89432415
Sequence CAGCCGCCTCCCAGAGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 364}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328215_1142328225 25 Left 1142328215 16:89432345-89432367 CCCCAGGCTGGCAGCCGCTGTTT 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328216_1142328225 24 Left 1142328216 16:89432346-89432368 CCCAGGCTGGCAGCCGCTGTTTG 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328219_1142328225 11 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328217_1142328225 23 Left 1142328217 16:89432347-89432369 CCAGGCTGGCAGCCGCTGTTTGT 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328222_1142328225 -10 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364
1142328221_1142328225 -2 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG 0: 1
1: 0
2: 1
3: 33
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328225 Original CRISPR CAGCCGCCTCCCAGAGCCCG TGG Intronic
900093094 1:929024-929046 CTGCCACCTCCCGGAGCCAGCGG + Intronic
900096622 1:942513-942535 CAGCCGCCTCCCGGGCCGCGCGG - Intronic
900384481 1:2403517-2403539 CAGCCACTCCACAGAGCCCGAGG + Exonic
900401952 1:2476299-2476321 CAGCCGCCTCCCAAGGCTGGGGG - Exonic
900410074 1:2508393-2508415 CAGCCGCCCCGCAGACCCCATGG - Intergenic
900502342 1:3012613-3012635 CCGCCGCCTCCCCAGGCCCGTGG + Intergenic
902767536 1:18627449-18627471 CAGCCTCTTCCCTCAGCCCGAGG - Intergenic
903060428 1:20664905-20664927 GAGCAGCCTCGCAGAGCCTGGGG - Intronic
903171579 1:21557892-21557914 CAACCCCCTCCCAAAGCCAGAGG + Intronic
903281656 1:22253594-22253616 CAGCCTCCTTCCAGAGCCCCGGG - Intergenic
903402845 1:23069800-23069822 CCACCGCCTTCCAGAGCCCCAGG + Intronic
903421008 1:23217669-23217691 CAGCCCCCGCCCAGCACCCGGGG + Intergenic
903648803 1:24910805-24910827 CTGCTGCCTCCCAGGGCCCTTGG + Intronic
903658419 1:24962795-24962817 CAGCCACCTCCCAGGCTCCGAGG + Intronic
903847684 1:26288236-26288258 CTGCCGCCTCCCAGGGCCGGGGG + Intronic
904272905 1:29362185-29362207 CAGCCTCCTCCCGGAGGCCCTGG - Intergenic
904286267 1:29454874-29454896 CAGCCCCCTCCCTGAGGCAGAGG - Intergenic
904312778 1:29640098-29640120 CACCAGCTTCCCAGGGCCCGAGG - Intergenic
904417973 1:30374506-30374528 CAGCCCCCTCCCTGAGGCAGAGG + Intergenic
905694507 1:39965043-39965065 CAGCCTCTTCCCAGAGGCCCAGG + Intronic
906114671 1:43348849-43348871 GAGCCGCCTCTCGGGGCCCGAGG + Exonic
906704271 1:47883259-47883281 CAGGCTTCTCCCAGAGCCCTTGG + Intronic
907527675 1:55063353-55063375 CGGTCACCTGCCAGAGCCCGAGG - Exonic
910788018 1:91021722-91021744 CCGCCGCCTCCCCGAACCCGGGG + Intronic
912246263 1:107964872-107964894 CAGCCGCGTCCCGGAGCCGTCGG - Exonic
913451893 1:118998261-118998283 CAGGGGCCTCCCAGGGCCCAAGG - Intergenic
915088612 1:153405824-153405846 CAGCTGCAGCCCAGAGCCTGTGG - Intergenic
915096283 1:153465008-153465030 CAGCTGCAGCCCAGAGCCTGTGG + Intergenic
915247632 1:154567880-154567902 CAGCCGGCTCCCTGAGGCCCAGG + Exonic
915285022 1:154847037-154847059 CACCCCCCTCCCTGAGCCCTGGG + Intronic
915740260 1:158113695-158113717 CGGCGGCCGCCCGGAGCCCGAGG + Intergenic
918181410 1:182088174-182088196 CAGCCGCCTCCTGCAGCCCCAGG - Intergenic
918332102 1:183471376-183471398 ATCCCGCCTCCCAGAGCCCAAGG + Intergenic
919705309 1:200669936-200669958 CGGCCCCCTCCCAAAACCCGGGG - Exonic
919817888 1:201453127-201453149 TGGCCCCCTCCCAGAGCCCAGGG + Intergenic
919923921 1:202182399-202182421 CAGACGCTTCCCAGAGCCTTTGG - Intergenic
920218392 1:204377751-204377773 CTGCCCCCTTCCAGAGGCCGTGG + Intergenic
920869386 1:209781444-209781466 CAGCTGCCTCCCAGAGTAAGAGG + Exonic
921909089 1:220528308-220528330 CAGCCGCATCCACGCGCCCGGGG - Intronic
1062951262 10:1505655-1505677 CAGCCACCTCCCCATGCCCGTGG + Intronic
1062951277 10:1505704-1505726 CAGCCGCCTCCCCATGCCCGTGG + Intronic
1062951293 10:1505753-1505775 CAGCCGCCTCCCCATGCCCGTGG + Intronic
1063204825 10:3820903-3820925 CAGCAGGATCCCAGACCCCGTGG - Intergenic
1064255435 10:13739274-13739296 CAGCTGCTTCCCAGAGGCAGGGG - Intronic
1067183110 10:44005334-44005356 CAGCGGACTTCCAGAGCCCGGGG - Intergenic
1067525982 10:47038909-47038931 CAGCAGCCATCCAGAGCCTGAGG - Intergenic
1067595396 10:47553448-47553470 CCGCCGCCTACCCCAGCCCGCGG + Intergenic
1069945239 10:71981144-71981166 CAGACCCCTACCAGAGCCAGCGG - Intronic
1070139759 10:73730428-73730450 CTGCCGCCTACCCCAGCCCGCGG + Intergenic
1070886574 10:79905061-79905083 CCGCCGCCTACCCCAGCCCGCGG - Intergenic
1072808970 10:98445226-98445248 CATCTGCCTCCCAAAGCCCCAGG + Intronic
1073143215 10:101262385-101262407 CAGCCGCCTCCCGCAGCCTCTGG + Intergenic
1075129544 10:119726233-119726255 CCGCCGCCTCCCTGGGCGCGCGG + Exonic
1076693071 10:132233572-132233594 CAGCCGCCACCCAGGCCCCTTGG - Intronic
1077177643 11:1197913-1197935 CAGCCGCTGCCCCGCGCCCGTGG + Intronic
1080765726 11:35295298-35295320 CATCAGCCTCCCAGAGCACTAGG + Intronic
1082811785 11:57482903-57482925 CAGCCCCCTCCCCAAGCCCCGGG + Intergenic
1083347152 11:62001520-62001542 CAACCCCCTCCCAGATCCCAGGG - Intergenic
1083710161 11:64543013-64543035 CTGCCGCCTCCCCGGGCCCGGGG - Intergenic
1083767941 11:64851129-64851151 CACCCAGCTACCAGAGCCCGTGG - Intergenic
1084036004 11:66510765-66510787 CAGCAGGAGCCCAGAGCCCGGGG - Intronic
1084161285 11:67351810-67351832 CAGCAGGCTCCCAGAGTCCCCGG - Exonic
1084399972 11:68937799-68937821 AAGGGGCCTCCCAGAGCCTGGGG + Intronic
1085051680 11:73383187-73383209 CTGCCCCCTCCCACAGCCCTGGG - Intronic
1087241779 11:95789367-95789389 CGCCCGCCTCCCGGAGCCCACGG + Intronic
1088606944 11:111541328-111541350 CGGCCGCCTCCCGGAGCGGGCGG - Intronic
1089650752 11:119911174-119911196 CAGCTGGCTTCCAGAGCCCGGGG + Intergenic
1091225869 11:133956331-133956353 CGGCCGCCTCCCAGAGCTGCGGG - Intronic
1093435480 12:19130217-19130239 TCGCCGCCTCCCGGGGCCCGCGG - Intronic
1096310008 12:50512355-50512377 CATCGGCCTCCCAGAGTCCCGGG + Intronic
1099501124 12:83415365-83415387 AAGCCGCCTCCCAGAGATCAGGG - Intergenic
1099614139 12:84913015-84913037 CGGCGTCTTCCCAGAGCCCGGGG + Intronic
1099989607 12:89708717-89708739 CAGCCGGCTCGCAGGGCTCGGGG + Exonic
1102544664 12:113645892-113645914 GAGCCGCCACCCAGTGCCCGTGG + Intergenic
1103400799 12:120641413-120641435 CAGCCTCCTCCCGCGGCCCGTGG + Intronic
1103749709 12:123150661-123150683 GAGCCGCCGCCCAGATCCCCAGG + Intergenic
1104568352 12:129904096-129904118 CGGCCGCGTCCCCGAGCCGGCGG - Intergenic
1104744467 12:131202380-131202402 AAGGAGCCACCCAGAGCCCGGGG - Intergenic
1104769041 12:131349023-131349045 CAAGAGCCTCCCTGAGCCCGGGG - Intergenic
1104789912 12:131474843-131474865 AAGGAGCCACCCAGAGCCCGGGG + Intergenic
1104855459 12:131900436-131900458 CAGCCGCCTCCCAGCGGCTGTGG - Intronic
1104980520 12:132571367-132571389 CTGGCGCCTCCCTGGGCCCGGGG + Exonic
1105472063 13:20703729-20703751 CCGCCGCCGCCCCGAGCCGGGGG - Intronic
1107435036 13:40374420-40374442 CAGTGGCTTCCCAGAGCCCCTGG - Intergenic
1108981389 13:56520407-56520429 CAGGCGCCTCCCACAACACGTGG - Intergenic
1115721594 14:36167607-36167629 CAGTCCCCTCCCAAAGCCCAGGG + Intergenic
1117253661 14:53957048-53957070 CAGCCGCTTCCCAGAGCTGGAGG - Intronic
1118004012 14:61549075-61549097 CAGCCCCCTGCCAGCGCCCCTGG + Intronic
1118608040 14:67517285-67517307 ATGCTGCCTCCCAGAGCCTGGGG - Intronic
1118777057 14:68979582-68979604 GAGACGCCTCCCCGAGCTCGGGG + Intergenic
1119264245 14:73254730-73254752 CAGCCACCTGCCAGAGACCAGGG - Intronic
1119406159 14:74401040-74401062 CAGCAGGCTCCCAGAGGACGAGG + Intergenic
1119717449 14:76868891-76868913 CAGCCCCCTCCCAGGTGCCGCGG - Intronic
1119970823 14:78968210-78968232 CAGCAACCTCCCAAAGCTCGTGG + Exonic
1120967834 14:90183355-90183377 CAGCAGCCTCCCAAAGCACTGGG - Intronic
1122263396 14:100535622-100535644 AAGCAGCCTCCCTGAGCCGGGGG - Intergenic
1122721147 14:103723369-103723391 CAGCCAACGCCCACAGCCCGTGG + Intronic
1122724322 14:103740270-103740292 CAGCTCCATCACAGAGCCCGAGG - Exonic
1122905044 14:104797743-104797765 CTGCCTCCTCCCAGAGCTCAGGG + Intergenic
1122919834 14:104875461-104875483 GAGCCACCACCCAGAGCCCCAGG + Intronic
1123676438 15:22714619-22714641 CAGGGGCCTCGCAGAGCCGGCGG - Intergenic
1124613401 15:31224297-31224319 CAGCCCTCTCCCAGAGCCGGTGG - Intergenic
1124952558 15:34337438-34337460 TAACCTCCTCCCAGACCCCGAGG - Exonic
1125730863 15:41892238-41892260 CAGCCACCTCCAGGAGCCCTTGG + Intronic
1126669580 15:51104082-51104104 CAGCAGCCTCCCAGTTCCCCAGG + Intronic
1126852545 15:52805943-52805965 CTGCCGCCTTCCAGGGCCGGAGG + Intergenic
1128877675 15:71215352-71215374 CAGCCGGCACCCACAGCCCCAGG + Exonic
1129522496 15:76194658-76194680 CAGCCGCCACCAGGAGCCAGAGG - Intronic
1129605635 15:77023722-77023744 CAGACCCCTCCCAGAGCTCAGGG - Intronic
1129784952 15:78303973-78303995 CAGCCCCCTCCAAGAGCACCGGG - Intergenic
1130996972 15:88909298-88909320 CAGCCTCATCGCAGAGCTCGGGG - Intronic
1132583256 16:694806-694828 CAGCCGCCTCCCGGCTCCGGGGG - Intronic
1132671660 16:1104429-1104451 CTGCCACCTCTCAGAGCCTGGGG - Intergenic
1132807773 16:1782997-1783019 CCGCCGCCTCCAGGAGCTCGCGG - Exonic
1133060260 16:3170440-3170462 ACGCCGCCTCCCAGATTCCGGGG - Intergenic
1133286262 16:4692230-4692252 CAGCCAGCGCCCAGGGCCCGTGG - Intergenic
1133765704 16:8836336-8836358 CAGCCACTCCCCAGAGCCCCTGG - Intronic
1134028506 16:10973246-10973268 CAGACGCCTCCCAGAGCAGGCGG + Intronic
1135514862 16:23123285-23123307 CCTCGGCCTCCCAGAGTCCGAGG - Intronic
1135976132 16:27109894-27109916 CGGGCGGCTCCCGGAGCCCGGGG - Intergenic
1136505547 16:30700666-30700688 GACCCGCCTTCCAGGGCCCGGGG - Exonic
1140218631 16:73027984-73028006 CAGACGCCTCCCAGAGTCAAGGG + Intronic
1141630588 16:85285833-85285855 CTTCCGCCTCCCAGAGCTTGTGG + Intergenic
1141647112 16:85373513-85373535 CAGCTGCCTCCCGGGGCCCCTGG + Intergenic
1141829396 16:86501284-86501306 CAGCGGCCTCCTTGAGCCCTTGG - Intergenic
1141919526 16:87126713-87126735 CAGCCCACTCCCAGTGCCCTTGG - Intronic
1142216869 16:88834329-88834351 CAGCCTCTTCCCAGACCACGTGG - Intronic
1142216883 16:88834364-88834386 CAGCCTCTTCCCAGACCACGCGG - Intronic
1142216895 16:88834397-88834419 CAGCCTCTTCCCAGACCACGCGG - Intronic
1142216940 16:88834538-88834560 CAGCCTCTTCCCAGACCACGCGG - Intronic
1142245677 16:88969107-88969129 CAGCCGAATCCCAGAGCCGGTGG - Intronic
1142265319 16:89061768-89061790 CAGCCTCCTGCCAGGGCCCTGGG + Intergenic
1142328225 16:89432393-89432415 CAGCCGCCTCCCAGAGCCCGTGG + Intronic
1142395129 16:89827967-89827989 CAGTGGCCTCCCCGAGCCCCGGG - Intronic
1142610606 17:1107704-1107726 CAGAGGCCTCCCTGAGCCCACGG + Intronic
1143092618 17:4457916-4457938 CAGCAGCTTCCCAGCGCCAGAGG - Intronic
1143323536 17:6083493-6083515 CAGCAGCCTCCCAAAGCGCTAGG + Intronic
1143900022 17:10167299-10167321 CATCCGCCTCCCAGAGTGCTGGG + Intronic
1144422045 17:15107707-15107729 CCTCAGCCTCCCAGAGCCCTGGG - Intergenic
1144698103 17:17319276-17319298 CAGCCCCTCCCCACAGCCCGGGG - Intronic
1144869959 17:18363299-18363321 CCGCGGCGTCCCAGAGCCCGGGG - Intronic
1144958124 17:19029843-19029865 CATGAGCCTCCCAGAGCCAGAGG + Intronic
1144977034 17:19144677-19144699 CATGAGCCTCCCAGAGCCAGAGG - Intronic
1145963732 17:28902600-28902622 CAGCCGCCTCCCCGCGCTCCTGG + Exonic
1145983272 17:29027033-29027055 CAACCCCCTCCCTGAGCCTGTGG - Intronic
1147268001 17:39246495-39246517 CAGCCTCCTCCCAGGTCTCGAGG - Intergenic
1148615143 17:48996114-48996136 CCTCCGGCTCCCGGAGCCCGAGG - Intergenic
1148786079 17:50146874-50146896 CAGCCCTGTCCCAGAGCCTGGGG - Intronic
1149433812 17:56616790-56616812 CAGCCCCCTCCCAAAGCACAGGG - Intergenic
1149507246 17:57204469-57204491 CAGCCTACTCCCACAGCCAGAGG + Intergenic
1150104990 17:62456140-62456162 CAGCAGACTACCAAAGCCCGCGG + Intergenic
1150230517 17:63547279-63547301 CATCCTCCTCCCAAAGCCCTGGG - Intronic
1150283239 17:63941349-63941371 CAGCCGCCTCTCAGACTTCGTGG - Exonic
1150610769 17:66731398-66731420 CAGCCACATCCCTGAGCCCTAGG - Intronic
1151579081 17:74968151-74968173 AAGAAGCCTCCCAGAGCCCCAGG + Intronic
1151969726 17:77451393-77451415 AAGGAGCCTCCCAGAGCGCGGGG - Intronic
1152070588 17:78131993-78132015 GCGCCCCCTCCCAGAGCCCAAGG - Exonic
1152088394 17:78233823-78233845 CAGCAGCCTACCCGAGCCCAGGG - Intronic
1152546685 17:81003949-81003971 CAGCCGCCTCCCGAGGCCCCAGG + Intronic
1152598848 17:81251424-81251446 CAGCCCCCTCCCCCAGCCCTGGG - Intronic
1152795070 17:82302653-82302675 CAGCCTGGTCCCAGAGCCCGGGG + Intergenic
1152924535 17:83081028-83081050 CAGTCGCCCCCCAGCGCCCCCGG + Intronic
1153451862 18:5238547-5238569 CAGCCGCTCCCCAGACACCGGGG - Intergenic
1154095672 18:11413151-11413173 GAGGCCCCCCCCAGAGCCCGAGG + Intergenic
1155507786 18:26549023-26549045 CAGCCGCCGCCCCGACCCCCCGG - Exonic
1157095102 18:44680206-44680228 CCGCCGCCTCCGCGCGCCCGGGG + Intronic
1157299105 18:46466939-46466961 CAGCAGCCTCCCAAAGCCCTGGG - Intergenic
1157414389 18:47489896-47489918 GAGCCGCCATCCAGAGCCGGTGG + Intergenic
1159717804 18:71848116-71848138 CAGGCTCCTCCCACAGCACGTGG - Intergenic
1160719125 19:589882-589904 CCGCCGCCGGCCGGAGCCCGAGG - Exonic
1160748761 19:723844-723866 CATCGGCCTCCCAGAGCGCTGGG + Intronic
1160797582 19:953069-953091 CTCCCACCTCCCAGAGCCGGTGG + Intronic
1161278718 19:3433740-3433762 CAGGCCCTTCCCAGAGCCCAAGG + Intronic
1161337369 19:3721804-3721826 CAGCCCCCTCCCCCAGCCCGGGG + Exonic
1161341993 19:3748023-3748045 CAGATGAGTCCCAGAGCCCGAGG + Exonic
1161736847 19:5996773-5996795 CAACCTCCTTCCAGAGCCAGCGG + Intronic
1163148612 19:15398596-15398618 CAGCCGCCACCGAGACCTCGGGG + Intronic
1163453260 19:17391317-17391339 CCGCCGCCTCCCAGCGCGCCAGG + Intergenic
1163722119 19:18903297-18903319 CAGCGGCCTCCCAGCGGCCCTGG + Exonic
1165305525 19:35000553-35000575 CCGCCCCCTCCCCAAGCCCGCGG - Intronic
1165382435 19:35490569-35490591 CCTCCCCCTCCCAGAGCCCCGGG - Intronic
1165462236 19:35950847-35950869 CAGGGGACTCCCAGAGCCAGAGG + Intergenic
1165755139 19:38288552-38288574 CAGCAGCCTCCCAGAGTCCATGG - Intronic
1165834321 19:38744995-38745017 CAGCAGCCTCCCAGAGAGCTGGG + Intronic
1166111822 19:40627306-40627328 CCGCTCCTTCCCAGAGCCCGAGG + Exonic
1166259276 19:41626778-41626800 CAGTCCCCTCTCAGAGCCCCAGG + Intronic
1166553322 19:43681559-43681581 GTGCCGCCTCCCAGAGCACTGGG + Intergenic
1166832281 19:45645759-45645781 CATCCTCCTCCCGGAGCTCGGGG - Intergenic
1166882974 19:45940281-45940303 CCCCCGCCTCCCGGAGCCCTGGG - Exonic
1166990810 19:46691680-46691702 CAGCAGCTTCCCCCAGCCCGGGG + Intronic
1167420642 19:49400974-49400996 CAGCAGCCTCCTAGAGCACTAGG - Intronic
1167525845 19:49983311-49983333 CAGCCACCTGCCAGAGCTCAGGG - Intronic
1167605781 19:50480740-50480762 CAGCCGCCCACCACAGCCCCAGG + Exonic
1167768441 19:51499522-51499544 CAGCCTCATCCCACAGCCCCAGG - Exonic
1168078556 19:53993214-53993236 CAGCCGCCGCCCCGAGCGCAGGG + Intronic
1168078782 19:53994244-53994266 CAGACGCCTCCCAACACCCGAGG + Intronic
1168420158 19:56196658-56196680 CCTCCGCCTCCCAGAGCACTGGG - Intronic
925075860 2:1014972-1014994 CAGCCCCCTCCCGGGGCCCCCGG - Intronic
925083837 2:1092075-1092097 CAGCCCCCTCACATAGCCCCAGG + Intronic
925289117 2:2735102-2735124 CAGCCACCCCGCAGAGCCCGGGG + Intergenic
925614838 2:5735172-5735194 CAGCTGCGTCCCCAAGCCCGTGG - Intergenic
929429765 2:41877325-41877347 GGGCCGACTCCCAGAGCCCTGGG - Intergenic
929756352 2:44768672-44768694 CGGCCGCGTCCCGGAGCCCCGGG - Intronic
929789576 2:45013269-45013291 CCGGAGCATCCCAGAGCCCGAGG - Intergenic
930575272 2:53139398-53139420 CCGCCGCCTCCCTCAGCCTGTGG + Intergenic
932091896 2:68813332-68813354 CCGAGACCTCCCAGAGCCCGTGG + Exonic
932882625 2:75518104-75518126 CAGCCACAGCCCAGAGCACGTGG - Exonic
933691330 2:85181552-85181574 CAGGCAGCTCCCAGAGCCCAGGG + Intronic
934612569 2:95752057-95752079 CAGACACATCCCAGAGCCCAGGG - Intergenic
934672005 2:96220135-96220157 CATCACCCTCACAGAGCCCGGGG - Intergenic
935858841 2:107305074-107305096 AAGCCGGCTCCCAGAGATCGTGG + Intergenic
937377936 2:121350497-121350519 CAGTCTCTTCCCAGAGCCCCAGG - Intronic
938837726 2:135124413-135124435 CCGCAGCCTCCCAGAGCGCTAGG - Intronic
942346220 2:175005296-175005318 CAGCAGCCTCGCACAGCCCCCGG + Intronic
943372541 2:187032636-187032658 CTCCCGCCTCCCAAAGCCCTGGG + Intergenic
943919582 2:193687222-193687244 CATCCGCCTCCCAAAGCACTGGG - Intergenic
944221728 2:197310420-197310442 CCGGTGCCTCCGAGAGCCCGCGG - Intronic
944495929 2:200307052-200307074 CCGCCGCCTCCCGGAGCGCTGGG + Intronic
946187083 2:217987270-217987292 CAGCAGCCCCCCAGAGACCCAGG + Intronic
947201426 2:227617822-227617844 CAGCCCCTGCCCAGAGGCCGGGG - Intronic
947213475 2:227728632-227728654 CAGCATCTTCCCAGAGGCCGGGG - Intergenic
947535194 2:230935646-230935668 CAGCCCAGTCCCAGAGCCCAGGG - Intronic
947744875 2:232502290-232502312 CAGCCCCCTCCCCTTGCCCGTGG - Intergenic
948495246 2:238344668-238344690 GGGCCGCAGCCCAGAGCCCGAGG + Intronic
948753316 2:240144766-240144788 CAGCCTCCTCCCAGGACCCTCGG + Intergenic
1170756835 20:19212569-19212591 CCGCCGCCTCCCGGCGCTCGGGG - Intergenic
1170821630 20:19759205-19759227 CAGGCGCCTCTCAGGGCCCAGGG - Intergenic
1171217522 20:23362689-23362711 CGGCCGCCTCCCAGTGCGCCCGG - Intronic
1173755398 20:45511398-45511420 CAGCTGCTTCCCATTGCCCGAGG - Intergenic
1173918788 20:46728458-46728480 CAGCCTCCTCCTAGAGCCTCCGG - Intronic
1174173612 20:48631783-48631805 AAGCTGCCTCCCAGAACCTGTGG + Intronic
1174851758 20:54002200-54002222 CAGCAGGCTCCCTGAGCCCAAGG - Intronic
1175516226 20:59571951-59571973 AAGGCGTCTCCCACAGCCCGGGG + Intergenic
1175677921 20:60962595-60962617 CACCCGCCTCCCAGAGCAGCAGG + Intergenic
1175886358 20:62293309-62293331 CAGCCGCCGTCCACAGCCCCCGG - Intronic
1175970330 20:62683273-62683295 CGGCCGCTCCCGAGAGCCCGAGG - Intronic
1176017501 20:62943129-62943151 CAGCCTCCACCCAGAGCTCTTGG + Exonic
1176018660 20:62951879-62951901 CAGCCACCACCCAGGGGCCGAGG - Intergenic
1176162107 20:63653291-63653313 CCGCCGCCCCACAAAGCCCGTGG + Intronic
1176189668 20:63802567-63802589 CAGCACCCTCCCAGAAACCGCGG + Intronic
1176194958 20:63832452-63832474 CCGCCGCCTCCCACCTCCCGAGG - Intergenic
1176546888 21:8206095-8206117 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1176554793 21:8250304-8250326 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1176565839 21:8389142-8389164 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1176573714 21:8433329-8433351 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1178534956 21:33403519-33403541 GAGCCGCCGCCGAGCGCCCGGGG + Exonic
1179505530 21:41837523-41837545 CAGCCCCCTCCCCCAGCCCCTGG - Intronic
1179546270 21:42114253-42114275 GAGCAGCCTGCCAGAGCCTGGGG + Intronic
1179605858 21:42514559-42514581 CAGCTGGTTCCCGGAGCCCGTGG + Exonic
1179657979 21:42857255-42857277 CACTCACCTCCCAGAGCCCCAGG + Intronic
1179730076 21:43362734-43362756 CAGCCGCCTCCCTGAGTGCATGG - Intergenic
1179874178 21:44259259-44259281 CACCCGCCTCCCATAGCTCAGGG + Intronic
1180070320 21:45432579-45432601 CTGCCGCATCTCAGAGCCTGTGG + Intronic
1180156742 21:45981779-45981801 CCGCCGCCGCCCAGAGACCGAGG - Exonic
1181395544 22:22618645-22618667 CAGCCTGGTCCCACAGCCCGGGG - Intergenic
1181725340 22:24806971-24806993 GAGCCACCTCCAAGAGCCAGGGG + Intronic
1182007388 22:26972136-26972158 CAACCGCCTCCCAGACCCATTGG - Intergenic
1182123482 22:27800983-27801005 CCGCAGCCTCCCGGAGTCCGTGG + Exonic
1183073598 22:35412698-35412720 CAGCCGCCTCCCCAAACCCAAGG - Intronic
1183281893 22:36936629-36936651 CAGCCGCTTCCCTGAGCTGGAGG + Exonic
1183409855 22:37648444-37648466 CTGCCACCTCCCCCAGCCCGCGG - Intronic
1184106855 22:42372512-42372534 CATCGGCCTCCCAGAGCGCTGGG - Intergenic
1184240182 22:43207712-43207734 CAGCCATAGCCCAGAGCCCGTGG - Intronic
1184411499 22:44328874-44328896 CAGCCACCTCCCAGACCCGCAGG + Intergenic
1184504653 22:44893456-44893478 CAGCGGCCTCCTGGAGACCGAGG - Exonic
1184759862 22:46537904-46537926 GAGCCGCGGCCCCGAGCCCGAGG - Intergenic
1184951842 22:47848661-47848683 CAGCGGCCTCCCAGTCCACGTGG - Intergenic
1184996003 22:48208083-48208105 CACCAGCCTCCCAGGGCCAGGGG + Intergenic
1185065267 22:48628896-48628918 CAGCCCCCACCCACAGCCCCAGG - Intronic
1185220697 22:49627816-49627838 CAGGAGCCTCCCAGAGACCTGGG - Intronic
1185244100 22:49764029-49764051 AACCCGGCTCCCAGAGTCCGGGG + Intergenic
1185260028 22:49856560-49856582 AAGCCGCCTCCCAGCTCCCCCGG + Intronic
1185351661 22:50342908-50342930 CAGGCCCCTCCCAGAGGCCGCGG - Intergenic
1203251763 22_KI270733v1_random:122380-122402 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1203259813 22_KI270733v1_random:167462-167484 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
950103548 3:10374192-10374214 CAGCCACTTCACTGAGCCCGGGG - Intronic
950241190 3:11371421-11371443 CAACGGCCTCCCAGGGCCCCGGG - Intronic
952430472 3:33218728-33218750 GCGCCGCCGCCCAGAGCCCGGGG + Exonic
953547878 3:43877606-43877628 CAGCCAGCTCCCTGAGCCCTGGG - Intergenic
954600479 3:51863641-51863663 CAACTGCCTCCCAGATCCCCCGG - Intergenic
958878015 3:99637965-99637987 CAGCCCCGTCCCACCGCCCGCGG - Intergenic
959849698 3:111071936-111071958 CAGCCTCCGCCCAGAGCCTGAGG + Exonic
960691274 3:120349044-120349066 AAGCCGCTGCCCAGCGCCCGTGG + Exonic
961081863 3:124034088-124034110 CCGCCTTCTCCCAGAGCGCGGGG + Intergenic
961446233 3:126983023-126983045 CATGCGCCGCCCAGAGCCCGGGG - Intergenic
961473960 3:127135637-127135659 GAGCCGCCTCGCAGAGACAGCGG - Intergenic
961658446 3:128455968-128455990 CAGCCTCCTCCCTGGGCCCTGGG - Intergenic
962346848 3:134624862-134624884 CAGCCCCTGCCCAGAGCCAGAGG - Intronic
963827289 3:149970206-149970228 CCGCCGCCTCCCACAGCCGGAGG + Intronic
964476724 3:157104247-157104269 CAAGCCCCTCCCAGAGCCAGGGG + Intergenic
964791942 3:160460704-160460726 CAGCCCCCTCCAAGAGCACAGGG + Intronic
966182241 3:177197679-177197701 CCGCCGCCTCCCGGCGTCCGCGG - Intergenic
968450562 4:674174-674196 CAGCCGCCGCCCAGTGCTCTGGG - Intronic
968552910 4:1233187-1233209 CAGCCGCCAGCAAGAGACCGAGG + Intronic
968674705 4:1871320-1871342 CCGCCGCCTCGCAGAAGCCGCGG - Intergenic
968820216 4:2844146-2844168 CAGCGGCCTCCCCGCCCCCGAGG - Intronic
968882509 4:3308766-3308788 CAGCCGCTTCCCAGAGCTAAAGG - Intronic
969057912 4:4413632-4413654 CTGCCGCCTCCCTGTGCCTGTGG - Intronic
969639208 4:8387005-8387027 CAGGGGCCTCCCAGAACCCCAGG + Intronic
969703789 4:8781428-8781450 CAGCTGCCTCCCGGAGCCCTGGG - Intergenic
971729143 4:30353645-30353667 CCTCCGCCTCCCAGAGTCCTGGG + Intergenic
972311291 4:37886111-37886133 CATCGGCCTCCCAGAGCGCTGGG - Intergenic
972437190 4:39045183-39045205 CTGCGGCCTCCCGGAGCGCGCGG + Intronic
973340410 4:48997624-48997646 CAGCCTCATCCCAGAGCCTGAGG + Intronic
973745845 4:53962713-53962735 CACAGGCCTCCCAGAGCCTGTGG + Intronic
974374617 4:61060752-61060774 CAGAGCCCTCCCAGAGCCCATGG + Intergenic
976734061 4:88292820-88292842 CAGCCGCCTCCCAAAGCACTTGG - Intergenic
978518652 4:109596215-109596237 CAACTGCCTCCCAGATCCCCCGG + Intronic
980789641 4:137603492-137603514 CAGGTTCCTCCCAGAGCACGTGG - Intergenic
981315444 4:143336352-143336374 CCGCCGCCTCCCCCACCCCGGGG - Intergenic
981782684 4:148444922-148444944 CACCGGCCACCCAGGGCCCGGGG - Intergenic
985633890 5:1026754-1026776 CAGCATCCTCCCAGCCCCCGAGG + Intronic
985905201 5:2829892-2829914 CAGCCTCCTCCCAGAGCAACAGG - Intergenic
987642793 5:20633691-20633713 CACATGCCTCCCAGAGCCTGAGG + Intergenic
988578627 5:32449705-32449727 CCTCAGCCTCCCAGAGCGCGGGG - Intergenic
992659681 5:78945897-78945919 GAGCCACCTCTCAGAGCCCAGGG - Intronic
994042776 5:95276697-95276719 CAGCCGCCTCCCAAAGTGCTGGG - Intronic
995512192 5:112921313-112921335 CAGCCGCCGCCCACACCGCGAGG + Intronic
997739077 5:136237989-136238011 CTCCCGCCTCCTGGAGCCCGAGG + Intronic
998375299 5:141686724-141686746 CAGAAGCCTCCCAGACCCCCAGG - Intergenic
999252482 5:150190795-150190817 AAGCCGGCTCCCTGAGCCTGCGG + Intronic
1000219076 5:159194414-159194436 CACCCGCCTCCCAAAGCGCTGGG + Intronic
1001598884 5:172916096-172916118 CAGCCGCCTGCCAGGGACTGTGG - Intronic
1002318934 5:178363696-178363718 CAGCCGACACCCACAGCCGGTGG - Intronic
1002589690 5:180281794-180281816 CAGCCACCACCCAGAGGACGGGG - Intronic
1003983957 6:11417129-11417151 CAGCCGCCTCCCAGAGGGGCAGG - Intergenic
1004427327 6:15515260-15515282 CTTCAGCCTCCCAGAGCCCCAGG + Intronic
1006052754 6:31356582-31356604 GATCCGCCTCCCTGAGGCCGCGG - Intronic
1006570325 6:34997990-34998012 CAGGCGCATCCCACAGCCTGTGG - Intronic
1006911477 6:37566252-37566274 CGGCCGCCTCCCAGAGCTGCAGG - Intergenic
1007164693 6:39821137-39821159 CAGCCTGCCCCAAGAGCCCGAGG - Intronic
1007821119 6:44561351-44561373 CCACCGCCTACGAGAGCCCGGGG - Intergenic
1011128760 6:84033782-84033804 CCGCCGCCTCCCACCGCCCAGGG - Exonic
1012472602 6:99588894-99588916 CAGCCGCCTCCCGGTGCTCCGGG + Intergenic
1013828618 6:114245750-114245772 CAGCAGACTCCCAGAGTCCTAGG + Intronic
1016936320 6:149451329-149451351 CAGCGGCCACCGAGAGCCCCGGG - Exonic
1017811634 6:157988111-157988133 CAGCCCCCTCCCAGGGCCTCAGG + Intronic
1018861430 6:167713126-167713148 CAGCCACTTCCCTGAGCCTGGGG - Intergenic
1019198629 6:170296582-170296604 CCGTCGCCTCGCACAGCCCGGGG - Intronic
1019300120 7:298598-298620 CAGCCACGTTCCAGAGCCGGGGG - Intergenic
1019411583 7:909038-909060 CAGTGGCCTCCCAGACCCCGCGG - Intronic
1019710426 7:2515911-2515933 CAGCCGGCTCCCAAGGCCGGGGG - Intronic
1020115557 7:5474165-5474187 CAGCCCCCTCCCTCAGCCCCAGG - Intronic
1023797615 7:43806835-43806857 CACCAGCCTCCCAGAGGCTGTGG - Intronic
1024504851 7:50153687-50153709 GTGCCCCCTCCCAGAGCCCCAGG - Intronic
1025983926 7:66431059-66431081 CTGCAGCCTCCCAGAGCACTGGG - Intergenic
1026411480 7:70127385-70127407 CAGCCCCCTCCCAAAGCCCTGGG + Intronic
1026968593 7:74454706-74454728 CAGCCCCCTCCCCGGGGCCGGGG - Intronic
1029110925 7:98212717-98212739 CAGCCGCCTCCCAGGCCTGGAGG + Exonic
1029637475 7:101794556-101794578 CTGCGGCCTCCCAGAGCACTAGG - Intergenic
1032125143 7:129188445-129188467 CTGCCGCCGCCCCGCGCCCGGGG - Intergenic
1033129937 7:138737213-138737235 CAGCTTCCTCCCACAGCACGTGG - Intronic
1033253079 7:139777478-139777500 CAGCCCCCACCCGGGGCCCGAGG - Intronic
1035728128 8:1837210-1837232 CAGTTGCTTCCCAGAGCCAGGGG + Intronic
1036291498 8:7496548-7496570 CCTCGGCCTCCCAGAGCCCTGGG + Intronic
1036329991 8:7814995-7815017 CCTCGGCCTCCCAGAGCCCTGGG - Intronic
1036779542 8:11635967-11635989 CAGCCGCCTCCCAAAGTGCTGGG - Intergenic
1037572857 8:20173173-20173195 TATCCGCCTCTCAGAGCCCTTGG + Intronic
1038032901 8:23660464-23660486 CACTCTCCTCCCAGAGCCTGAGG + Intergenic
1039184223 8:34898991-34899013 CCGCAGCCTCCCAAAGTCCGGGG + Intergenic
1040572229 8:48621233-48621255 CAGCCCCCTCTCTGAGGCCGAGG - Intergenic
1041110394 8:54477555-54477577 CAGCTGCCCCCCAGCTCCCGTGG - Intergenic
1041389166 8:57333768-57333790 CAGCCACTTGCCAGAGCCAGTGG - Intergenic
1041881068 8:62750574-62750596 CCGCCGCCTCCCAGGGACAGAGG - Intronic
1043847197 8:85177206-85177228 CCGCCCCCTCCCCAAGCCCGGGG - Intronic
1044934192 8:97277613-97277635 CGGCCTCCTCCCCGAGCCGGAGG + Exonic
1048152158 8:131904342-131904364 CAGTCGCCTCCCAACGCCCCCGG - Intronic
1048482617 8:134813666-134813688 CAGCCGCCTCCCAAAGTGCTGGG + Intergenic
1049221613 8:141431219-141431241 CAGAGGCCACCCAGGGCCCGAGG - Exonic
1049608532 8:143541259-143541281 CAGCCGCCACCCAGAACACGCGG + Intronic
1049673194 8:143878611-143878633 CAGCCGCCGCCCCTTGCCCGGGG - Intergenic
1049850077 8:144826327-144826349 CAGCCGCCCTCCAGACCCCCAGG - Intergenic
1051170335 9:14314384-14314406 CCGCCGCTGCCCAGAGCCCAGGG + Intronic
1052337956 9:27338686-27338708 CAGTGGCCTCCCTGTGCCCGAGG - Intronic
1052970154 9:34372445-34372467 CTGCCTCCTCCCAGCGCACGCGG + Exonic
1053617268 9:39781349-39781371 CAGCCCCCTCCAAGAGCACAGGG - Intergenic
1053875451 9:42540712-42540734 CAGCCCCCTCCAAGAGCACAGGG - Intergenic
1053897194 9:42753921-42753943 CAGCCCCCTCCAAGAGCACAGGG + Intergenic
1054236249 9:62561012-62561034 CAGCCCCCTCCAAGAGCACAGGG + Intergenic
1054266898 9:62926088-62926110 CAGCCCCCTCCAAGAGCACAGGG + Intergenic
1054460374 9:65459126-65459148 CCGCAGCCTCCCAGGGCCCAGGG - Intergenic
1054550391 9:66595542-66595564 CAGCCCCCTCCAAGAGCACAGGG + Intergenic
1055933915 9:81587636-81587658 CAGCCACCTCCCAGACTCCAGGG + Intronic
1057282028 9:93720160-93720182 CTGCCACCTCCCACAGCCCCAGG + Intergenic
1060222177 9:121770388-121770410 CACCCCCCTCCCAGACCCAGTGG + Intronic
1060756845 9:126219823-126219845 CAGCTGCCACCCACAGCCCAAGG - Intergenic
1060891634 9:127192914-127192936 CAGCCTCCTCCCAGAGCCCTTGG - Intronic
1061778923 9:132984514-132984536 CAGCAGCCTCCCAGAAGCCAGGG - Intronic
1061892861 9:133631906-133631928 CAGCCGCCTGCCAGTGACAGTGG + Intergenic
1062140024 9:134950942-134950964 CATCCGCCTCCCTGGGCGCGTGG + Intergenic
1062681152 9:137781962-137781984 CAGCCGCCTCACTGGGCCTGGGG + Intronic
1203468165 Un_GL000220v1:105531-105553 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1203475986 Un_GL000220v1:149503-149525 GAGCCGCCTGCCGGGGCCCGCGG + Intergenic
1187507011 X:19886843-19886865 CAGCCCCCTCCAAGACCCCGAGG + Intronic
1189028989 X:37430022-37430044 CAGGCCCCTCCCACAGCACGTGG + Intronic
1190321125 X:49179770-49179792 CAGCTGCCTCCCAGAGGACAAGG - Exonic
1192260986 X:69505684-69505706 CGGCGGCGTCCCAGAGCCCACGG + Exonic
1194713931 X:97269103-97269125 CATCCGCCTCCCAGAGTGCTGGG + Intronic
1197704323 X:129622982-129623004 CAGCTGCCTGCCAGAACCTGGGG - Intergenic