ID: 1142328226

View in Genome Browser
Species Human (GRCh38)
Location 16:89432396-89432418
Sequence ATGCCACGGGCTCTGGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328226_1142328232 -9 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328226_1142328233 -8 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328226_1142328235 3 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328235 16:89432422-89432444 CTGTGTTGAGGGGTGCTGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 242
1142328226_1142328234 -7 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328226 Original CRISPR ATGCCACGGGCTCTGGGAGG CGG (reversed) Intronic
900093095 1:929027-929049 AGGCCGCTGGCTCCGGGAGGTGG - Intronic
900502343 1:3012616-3012638 CTGCCACGGGCCTGGGGAGGCGG - Intergenic
900813058 1:4822609-4822631 ATGCCACGGTCTCTGCTCGGGGG - Intergenic
901771590 1:11533142-11533164 GTGCCAGTGGCTGTGGGAGGGGG - Intronic
903695060 1:25200376-25200398 ATGGCAGGGGCACTGGGAGAGGG + Intergenic
904260098 1:29283284-29283306 ATGGGACGGACTCTGGGAGGTGG - Intronic
904813943 1:33181675-33181697 AGGCGATGGGCGCTGGGAGGAGG + Intronic
905247760 1:36626778-36626800 GTGGGAAGGGCTCTGGGAGGAGG + Intergenic
906945348 1:50290043-50290065 AGGCCACAGGCTCTGGGCTGGGG - Intergenic
907745182 1:57206275-57206297 ATGCCACAGGCTGTGGAGGGAGG - Intronic
908231429 1:62109146-62109168 ATGCCAGGCGTTCTGGTAGGTGG + Intronic
914327203 1:146630998-146631020 ATGACACAGCCTCTGGAAGGAGG - Intergenic
915461076 1:156070848-156070870 ATGCCAGGGGCAAGGGGAGGAGG + Intergenic
915769174 1:158400784-158400806 ATGATTAGGGCTCTGGGAGGAGG - Intergenic
916121338 1:161530907-161530929 AAGCCACCGGCTCTGGAAGCTGG - Intergenic
916941824 1:169685259-169685281 GTTCCAGGGGCTCTGGGAGTGGG - Intronic
917519794 1:175738494-175738516 TTGCCAAGGGCTGGGGGAGGAGG + Intronic
918332104 1:183471379-183471401 CTGCCTTGGGCTCTGGGAGGCGG - Intergenic
919817889 1:201453130-201453152 GTGCCCTGGGCTCTGGGAGGGGG - Intergenic
920373541 1:205494182-205494204 ATGCCAAGGGCTTTGTGAGGTGG + Intergenic
921086155 1:211795028-211795050 TTGCCAGGGGCTGGGGGAGGGGG + Intronic
921207671 1:212862335-212862357 TTGCCACAGGCTAGGGGAGGGGG - Intronic
924558008 1:245133670-245133692 ATGCCAGGGGCTCTGGGGAGGGG + Intergenic
1063151413 10:3339900-3339922 TAGCCAAGGGCTCTGGGCGGAGG + Intergenic
1063211242 10:3883140-3883162 AGAGCAGGGGCTCTGGGAGGAGG + Intergenic
1064008723 10:11718159-11718181 TGGCCAGGGGCTGTGGGAGGGGG - Intergenic
1064978792 10:21145800-21145822 ATGCCAAGGGCTCCGGCAGCTGG + Intronic
1068129487 10:52879835-52879857 ATGCCAGAGGCTCAGGGAAGAGG - Intergenic
1068981555 10:63068328-63068350 TTGCCAGGGGCTGGGGGAGGAGG + Intergenic
1069993365 10:72328511-72328533 ATGGGACGGGCACTGGGCGGGGG - Intergenic
1070160380 10:73863293-73863315 ATGCCAGGTGATCTGGGAGTTGG - Intronic
1070922665 10:80197945-80197967 ATCCCACTGGGTCTTGGAGGGGG + Intronic
1072628317 10:97128521-97128543 CTCCCTCGGGCTCTGGGAGCAGG + Intronic
1072740667 10:97907232-97907254 ATGCCACGGGCAGCAGGAGGAGG + Intronic
1073398153 10:103235387-103235409 TTGCCAGGGGCTGGGGGAGGAGG + Intergenic
1073425774 10:103454838-103454860 ATGCTCCGGGCTCGGGGAGTGGG - Exonic
1074469212 10:113711803-113711825 CTTCCACGGGCTCTGGAAGTAGG + Intronic
1074561121 10:114536097-114536119 ATGCCAGGGGCTGGGGGAAGGGG - Intronic
1074874121 10:117601085-117601107 ATGGCACGGGTCCTGGGAGGAGG + Intergenic
1075671692 10:124267623-124267645 ATGCCATGGGCTCTGACAGCTGG - Intergenic
1076209789 10:128631171-128631193 ATCCCACGGGGTATAGGAGGTGG - Intergenic
1076262421 10:129078333-129078355 ATGCCAAGGGCCCTGCCAGGGGG + Intergenic
1076428115 10:130381717-130381739 ATGGCAGGGGCTGAGGGAGGAGG - Intergenic
1076447297 10:130525348-130525370 AAGGCTCGGGCTCCGGGAGGAGG + Intergenic
1076482188 10:130792123-130792145 AACACAGGGGCTCTGGGAGGGGG - Intergenic
1076531156 10:131145837-131145859 AATCCACATGCTCTGGGAGGAGG + Intronic
1076706877 10:132307266-132307288 CTGCCACGGGCGGTGGGCGGAGG + Intronic
1077294247 11:1817152-1817174 GTGCCAGGGGCTGGGGGAGGTGG + Intergenic
1080606489 11:33869161-33869183 ATTCCGGGGGCTCTGGGAGAGGG - Intronic
1080623598 11:34008340-34008362 ATGACAGGGGCTCTAGGTGGAGG - Intergenic
1080747514 11:35121646-35121668 TTGCCAGGGGCTGGGGGAGGAGG - Intergenic
1081796486 11:45824039-45824061 AAGCCACGGTGTGTGGGAGGAGG - Intergenic
1083629704 11:64089234-64089256 GGGCCCCGGGCTCTGGGTGGGGG + Intronic
1083691579 11:64412259-64412281 TTGTCAGGGGCTCCGGGAGGGGG - Intergenic
1083710160 11:64543010-64543032 AGGCCCCGGGCCCGGGGAGGCGG + Intergenic
1083767939 11:64851126-64851148 AGTCCACGGGCTCTGGTAGCTGG + Intergenic
1083772535 11:64876463-64876485 GTGCCACAGGATCTGAGAGGTGG - Intronic
1083895263 11:65616533-65616555 GTGCCCTGGGCTCTGGGACGTGG + Intronic
1084072488 11:66745241-66745263 ATGCACCGGGTGCTGGGAGGGGG + Intronic
1084578523 11:70007090-70007112 TTGCCAGGGGCTCAGGGAGGGGG - Intergenic
1084763017 11:71285985-71286007 TTGCCAGGGGCTGGGGGAGGAGG - Intergenic
1085051679 11:73383184-73383206 CTGCCCAGGGCTGTGGGAGGGGG + Intronic
1087282257 11:96224713-96224735 ATGTCATGTGCTCTGGGAAGGGG - Intronic
1088740609 11:112763853-112763875 ATGCCATTGACTCTGGGAGTGGG - Intergenic
1089743297 11:120599875-120599897 ATGTCACGGGCTCTGGGGCAGGG - Intronic
1090262331 11:125330579-125330601 AAGCCAAGGGTGCTGGGAGGTGG - Intronic
1090744286 11:129694112-129694134 GTGTCAAGGGCCCTGGGAGGAGG + Intergenic
1090930353 11:131292374-131292396 ATTGCAAGGGCTCTGGAAGGTGG + Intergenic
1091616152 12:2052760-2052782 CTGCCGCGGGCGCCGGGAGGGGG + Intronic
1091631098 12:2161513-2161535 CTGCCATGGGCTCTGTGATGGGG - Intronic
1092491506 12:8949691-8949713 ATGCCGCGGGGTCTGGTGGGAGG - Exonic
1093157485 12:15704558-15704580 CTGCCAGGGGCTGTGGAAGGTGG + Intronic
1095981833 12:47978554-47978576 ATGCCAAGGTCCCTGGGAGCAGG - Intronic
1096053571 12:48632104-48632126 TTGCCATGGGCTTTGGGAGAGGG + Intergenic
1096916010 12:55034446-55034468 ATGCCCAGGGGTCTGGCAGGAGG - Intergenic
1102544665 12:113645895-113645917 TTTCCACGGGCACTGGGTGGCGG - Intergenic
1103945103 12:124521586-124521608 CTGCCAGGGGCTGCGGGAGGCGG + Intronic
1104023292 12:125008236-125008258 AGGCGGCGGGATCTGGGAGGAGG - Intronic
1104056525 12:125234984-125235006 ATGCTACAGGCTCTAGGAGCAGG - Intronic
1104886141 12:132109755-132109777 GTGCCAGGGGCTGGGGGAGGGGG - Intronic
1108522230 13:51256846-51256868 TTGCCAGGGCCTCGGGGAGGAGG - Intronic
1112326022 13:98443368-98443390 ATGCCACGTGCCTTGGGAGGGGG - Intronic
1113801153 13:113087048-113087070 GTGCCAGGGGCTGGGGGAGGAGG - Intronic
1115875772 14:37859612-37859634 GTGCAAAGGGCCCTGGGAGGAGG + Intronic
1118004014 14:61549078-61549100 ATCCCAGGGGCGCTGGCAGGGGG - Intronic
1119661736 14:76457034-76457056 CTGCCACAGGCTCAGGAAGGGGG - Intronic
1122165310 14:99818801-99818823 AAGCCACGGGTTTTAGGAGGAGG + Intronic
1122308804 14:100781872-100781894 TTGCCAGGGGCTGGGGGAGGAGG - Intergenic
1122829842 14:104390451-104390473 TTGCCAGGGGCTCGGGGAAGAGG + Intergenic
1122919835 14:104875464-104875486 CTGCCTGGGGCTCTGGGTGGTGG - Intronic
1123019696 14:105391852-105391874 AGGCCAGGTGCCCTGGGAGGTGG - Intronic
1123459795 15:20459481-20459503 GTGCCATGGGCCCTGGCAGGTGG - Intergenic
1123658267 15:22540939-22540961 GTGCCATGGGCCCTGGCAGGTGG + Intergenic
1124266025 15:28235318-28235340 GTGCCATGGGCCCTGGCAGGTGG - Intronic
1124312132 15:28635431-28635453 GTGCCATGGGCCCTGGCAGGTGG + Intergenic
1124613400 15:31224294-31224316 AGGCCACCGGCTCTGGGAGAGGG + Intergenic
1124964023 15:34419939-34419961 CTGCCAGGGGCTGGGGGAGGCGG + Intronic
1124980637 15:34566170-34566192 CTGCCAGGGGCTGGGGGAGGCGG + Intronic
1125730864 15:41892241-41892263 AGGCCAAGGGCTCCTGGAGGTGG - Intronic
1125748487 15:42013059-42013081 ATGCAGCAGGCTCTGGGATGAGG + Intronic
1125776172 15:42216211-42216233 ATGCCAGGCGCTGAGGGAGGGGG + Intronic
1125876640 15:43153446-43153468 TTGCCAGGGGCTGTGGGAGAGGG - Intronic
1126172436 15:45705548-45705570 ATTCTACGGGTTCTGGGAGGAGG + Intergenic
1128093217 15:64933111-64933133 ATGCCACAGGGTCTCGGAGGAGG + Intronic
1128497461 15:68206593-68206615 CTGCCATGGGGTTTGGGAGGGGG - Intronic
1131269553 15:90938608-90938630 ATGCCCAGGACTCTGGGGGGTGG + Intronic
1132235839 15:100220678-100220700 GTGCCAGGGGCTCGGGGAGGAGG - Intronic
1132402383 15:101520736-101520758 AAGGCACGGGCACAGGGAGGTGG - Intronic
1132671659 16:1104426-1104448 AGGCCCCAGGCTCTGAGAGGTGG + Intergenic
1132682259 16:1147529-1147551 CTGCCAAGGGCTGGGGGAGGGGG - Intergenic
1132829683 16:1921365-1921387 TTGCCAGGGGCTGTGGGAAGGGG - Intergenic
1136393907 16:29982666-29982688 ATGCCAAGGGCTGTGGGTTGTGG + Intronic
1136399124 16:30008311-30008333 AAGCCAAGGGCTCTGAGAAGGGG + Intronic
1138291970 16:55855588-55855610 ATGACACAGGCTCAGGGTGGGGG + Intronic
1139429553 16:66903886-66903908 CTGCCACCGCCACTGGGAGGTGG + Intergenic
1139850826 16:69950913-69950935 CAGCCCCGGGCCCTGGGAGGAGG - Intronic
1139879809 16:70173825-70173847 CAGCCCCGGGCCCTGGGAGGAGG - Intronic
1139956115 16:70693812-70693834 ATGCCATGTGCTTTGGGAGAGGG + Intronic
1140006357 16:71079941-71079963 ATGACACAGCCTCTGGAAGGAGG + Exonic
1140372714 16:74421723-74421745 CAGCCCCGGGCCCTGGGAGGAGG + Intronic
1140432200 16:74913760-74913782 TTGCCACGGGCTGAGGGAAGGGG + Intronic
1140744103 16:77965730-77965752 AGGCCAGGGGCTCTAGGATGTGG + Intronic
1141064534 16:80903098-80903120 GTGCCCAGGGCTGTGGGAGGGGG + Intergenic
1141138069 16:81479506-81479528 CTGCCAGGGGCTGGGGGAGGGGG - Intronic
1141162631 16:81639411-81639433 ATGCCAGGGGCTGGGGGAGGGGG - Intronic
1141630589 16:85285836-85285858 AAGCCACAAGCTCTGGGAGGCGG - Intergenic
1141677282 16:85524483-85524505 CTGCTACTGGCTCTGGGAGCAGG - Intergenic
1141905895 16:87027042-87027064 ATCCCAGGAGCTCTGAGAGGTGG + Intergenic
1142037257 16:87869735-87869757 ATGACGCGGGCGCCGGGAGGGGG - Intergenic
1142328226 16:89432396-89432418 ATGCCACGGGCTCTGGGAGGCGG - Intronic
1142551319 17:741840-741862 ATCTCAAGAGCTCTGGGAGGTGG + Exonic
1143113817 17:4569462-4569484 TTGCCAGGGGCTGGGGGAGGTGG + Intergenic
1143868113 17:9938780-9938802 TTGCCAGGGGCTGGGGGAGGAGG - Intronic
1144566177 17:16361391-16361413 TTGCCAGGGGCTGAGGGAGGAGG + Intergenic
1144839166 17:18175034-18175056 ATTGCAGGGGCTCAGGGAGGTGG - Intronic
1145893770 17:28439054-28439076 TTGCCAAGGGCTGTGGGAGAGGG - Intergenic
1146273318 17:31498468-31498490 AAACCAAGGGCTCTGGCAGGAGG + Intronic
1147244623 17:39111785-39111807 ATGCCACGGCCCCTGGGGTGAGG + Intronic
1147422632 17:40330328-40330350 GTCCCACAGGCCCTGGGAGGAGG - Intronic
1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG + Intronic
1148786078 17:50146871-50146893 ATGCCCCAGGCTCTGGGACAGGG + Intronic
1150007251 17:61477428-61477450 ATGCCGTGGGCTGGGGGAGGCGG - Intronic
1150296881 17:64015102-64015124 TTGCCAGGGGCTGTGGGAGAGGG + Intronic
1150825060 17:68466925-68466947 TTGCCAAGGGCTTGGGGAGGAGG - Intergenic
1151190576 17:72394932-72394954 AGGCCAGGGGGTCTGGAAGGGGG + Intergenic
1151310339 17:73288815-73288837 ATGGCGTGGGCACTGGGAGGGGG - Intronic
1151764455 17:76125007-76125029 CTGTCCCGGGCTCTGGCAGGTGG + Intergenic
1152070587 17:78131990-78132012 GGGCCTTGGGCTCTGGGAGGGGG + Exonic
1152344431 17:79742650-79742672 ATGCCACAGCATCTGGGTGGGGG - Intergenic
1153857521 18:9165514-9165536 TTGCCAGGGGCTCAGGGAGAGGG - Intronic
1154044549 18:10892458-10892480 TTGCCACGGGCTGGGGGAAGAGG + Intronic
1157575235 18:48739101-48739123 ATGTCACAGGCCCTGGGAGGTGG - Intronic
1160797585 19:953072-953094 AGCCCACCGGCTCTGGGAGGTGG - Intronic
1161173061 19:2822970-2822992 AGGCCAAGGGCTCTGGGATCTGG + Intronic
1161374221 19:3930989-3931011 GTGCCAGGGGCTGGGGGAGGTGG - Intergenic
1161709907 19:5841968-5841990 AAGCCACGGGTCCTGGGAGGGGG - Intergenic
1161716116 19:5877120-5877142 AAGCCAGGGGTCCTGGGAGGGGG - Intronic
1162838649 19:13339357-13339379 GTGCCAAGGGCTGGGGGAGGGGG + Intronic
1163164599 19:15487086-15487108 TTGCCAGGGGCTGTGGGAGGGGG - Intronic
1163166802 19:15503969-15503991 TTGCCAGGGGCTGGGGGAGGGGG - Intergenic
1163293550 19:16396932-16396954 CTGCCAGGGGCTGTGGGTGGGGG + Intronic
1163373307 19:16914597-16914619 AGGGCTGGGGCTCTGGGAGGAGG + Intronic
1163392718 19:17040045-17040067 CTGCCAGGGGCTTTGGGAGAGGG - Intergenic
1163401396 19:17095364-17095386 TTGCCAGGGACTCCGGGAGGGGG - Intronic
1163681672 19:18686100-18686122 TTGCCAGGGGCTAGGGGAGGGGG - Intronic
1164570008 19:29367201-29367223 ATGCAACGTGTTCTGGGAGGTGG + Intergenic
1164699896 19:30277891-30277913 ATGTCATGCCCTCTGGGAGGAGG + Intronic
1165108098 19:33486322-33486344 TTGCTGCGGGCTCTGGCAGGAGG - Intronic
1165382432 19:35490566-35490588 ACCCCCGGGGCTCTGGGAGGGGG + Intronic
1165410107 19:35654679-35654701 ATCCCAAGGGCCCTGGCAGGAGG - Intronic
1165849786 19:38843116-38843138 AGGCCATGGGCTGAGGGAGGAGG - Intronic
1167147541 19:47692077-47692099 GTTCCAAGGGCTCAGGGAGGTGG - Intronic
1167524460 19:49975058-49975080 ATCCCCCGAGCTCTGAGAGGAGG - Intergenic
925320028 2:2957955-2957977 TTGCCAAGGGCTCAGGGAGGAGG + Intergenic
925340711 2:3133581-3133603 GTGCCAGGGGCTGGGGGAGGGGG + Intergenic
926359166 2:12068916-12068938 TTGCCAGGGGCTGTGGGTGGGGG - Intergenic
928904392 2:36355526-36355548 GTGCGCCGGGCTCGGGGAGGAGG + Intergenic
929429764 2:41877322-41877344 CTGCCCAGGGCTCTGGGAGTCGG + Intergenic
929490068 2:42388194-42388216 ATGCCAGGTGCTCAGGGAGGGGG - Intronic
929606589 2:43238877-43238899 ATGCCAAGAGCTGTGGGAGCTGG + Intronic
932763650 2:74457117-74457139 ATGTCAGGAGATCTGGGAGGAGG + Intronic
933993051 2:87647388-87647410 ATGCCAGGGGACATGGGAGGTGG - Intergenic
934519876 2:95013465-95013487 CTGGCACGGGCTGGGGGAGGCGG - Intergenic
936055532 2:109259347-109259369 ATGCCTCCGGCTCTGGATGGTGG - Intronic
936300807 2:111303491-111303513 ATGCCAGGGGACATGGGAGGTGG + Intergenic
938732588 2:134158254-134158276 GTGCCATGGACACTGGGAGGAGG - Intronic
941471403 2:165892696-165892718 TTGCCAGGGGCTCCGGGAAGAGG + Intronic
943462358 2:188184640-188184662 ATGCCTCCGGATCTGGCAGGGGG - Intergenic
943799623 2:192041955-192041977 ATCCCATGGGCTGGGGGAGGTGG + Intronic
944703530 2:202266092-202266114 ATAGCCCGGGCTCTGGGAGGAGG + Intronic
946159430 2:217827060-217827082 ATGTCATGGGGGCTGGGAGGAGG - Intronic
947497896 2:230651988-230652010 GTGCCAGGGGCTGGGGGAGGGGG - Intergenic
947744874 2:232502287-232502309 CTGCCACGGGCAAGGGGAGGGGG + Intergenic
1168835257 20:873369-873391 ACGCCAAGGGCTCAGGGAGAAGG - Intronic
1169536235 20:6544275-6544297 TTGTCAAGGGCTCAGGGAGGGGG - Intergenic
1170601327 20:17843587-17843609 CTGCCAGCGGCTCTGGGAGGTGG + Intergenic
1171217521 20:23362686-23362708 ATGCCGGGCGCACTGGGAGGCGG + Intronic
1171458669 20:25286409-25286431 ATGCCAAGTCCTCAGGGAGGGGG - Intronic
1171975700 20:31593531-31593553 TTGCCTCAGGCTCTGTGAGGTGG + Intergenic
1172065003 20:32213212-32213234 ATGCCAGGCGCAGTGGGAGGCGG + Intronic
1173213748 20:41059495-41059517 ATTCCAAGGGCTGTGGCAGGAGG + Intronic
1174185409 20:48702772-48702794 ATGCAGCGGCCTCAGGGAGGTGG - Intronic
1174476560 20:50799959-50799981 ATCACCTGGGCTCTGGGAGGTGG + Intronic
1174525218 20:51165013-51165035 AGTCCATGGGCTCTGGGAGTTGG - Intergenic
1175287371 20:57845890-57845912 ATGCCACGGCCTCTAGAAGCTGG + Intergenic
1175432197 20:58913271-58913293 GTGCCACGGTCTGTGGGAAGAGG - Intergenic
1175790580 20:61737792-61737814 ATGGCAGGGACTCGGGGAGGGGG - Intronic
1175910609 20:62403607-62403629 AAGCCACCGGGTTTGGGAGGAGG + Intronic
1175977632 20:62719589-62719611 TTGCCAGGGGCTGGGGGAGGAGG - Intronic
1175988846 20:62777634-62777656 TTGCCAGGGCCTCAGGGAGGTGG + Intergenic
1175997944 20:62819741-62819763 TAGCCAGAGGCTCTGGGAGGAGG - Intronic
1176018198 20:62948909-62948931 CTGCCTGGGGCTCTGGCAGGTGG - Intergenic
1176099521 20:63358648-63358670 AGGCCATGGTCTCTGGGAGCTGG - Intronic
1178815192 21:35923122-35923144 AAACCACGGGCTCTGGGTGATGG + Intronic
1179403952 21:41110233-41110255 ATGCTATGGCCTGTGGGAGGCGG - Intergenic
1179505529 21:41837520-41837542 GTGCCAGGGGCTGGGGGAGGGGG + Intronic
1179554574 21:42164063-42164085 CTACCACGGGCAATGGGAGGTGG - Intergenic
1179730787 21:43366167-43366189 TTGCCAAGGGCTGGGGGAGGAGG + Intergenic
1180232668 21:46436713-46436735 AAGCCACGGGGCCTGGCAGGCGG + Intronic
1180625429 22:17190757-17190779 CTGCCACTGGCCCTGGGAAGGGG + Intronic
1180877575 22:19181879-19181901 ACTCCACTGGCCCTGGGAGGTGG - Intronic
1181007614 22:20021410-20021432 ATGCGAGGGACTCTGGCAGGTGG + Intronic
1181034919 22:20165308-20165330 GTGCCGCAGGCACTGGGAGGTGG - Intergenic
1181410384 22:22714183-22714205 ATGCCAGGTGCTCTGGGTTGAGG + Intergenic
1181460504 22:23083322-23083344 ATATCACGGGCTCCAGGAGGAGG + Intronic
1181508901 22:23380051-23380073 GTGCCGCAGGCACTGGGAGGTGG + Intergenic
1182676516 22:32043419-32043441 ATGCAGCGGGTTCTGGGATGCGG + Intronic
1183112539 22:35661036-35661058 GTGACACAGGCTGTGGGAGGGGG + Exonic
1183210796 22:36449977-36449999 ATGCCACCATCCCTGGGAGGGGG - Intergenic
1183391392 22:37547218-37547240 ATGCCTCGGGCCCAGGGTGGGGG - Intergenic
1183675842 22:39298418-39298440 ATGCCACAGGGTTTGGGCGGCGG + Intergenic
1183684136 22:39351642-39351664 AAGCCACTGGCTTTGTGAGGGGG + Intronic
1184339117 22:43876102-43876124 ATGGCACTGGCTCAGGCAGGTGG + Intergenic
1184738806 22:46415098-46415120 TTGCCAGGAGCTCAGGGAGGAGG + Intronic
1185067612 22:48639950-48639972 ATGCCACAGGCCTTGGGCGGCGG - Intronic
1185244102 22:49764032-49764054 GTGCCCCGGACTCTGGGAGCCGG - Intergenic
950166544 3:10804854-10804876 TTGCCAGGGGCTCAGGGAGAGGG + Intergenic
950477282 3:13222143-13222165 GTGCCAGGGGCTGGGGGAGGGGG - Intergenic
950485681 3:13272713-13272735 ATGTCATGGGCTGTGGGAGGGGG + Intergenic
952768078 3:36972540-36972562 TTGCCAGGGGCTGGGGGAGGGGG - Intergenic
953246800 3:41200044-41200066 ATGCGCCGGGCCCTGGGTGGGGG + Intronic
955842600 3:63128263-63128285 TTGCCACTGCCTGTGGGAGGTGG - Intergenic
956254460 3:67269036-67269058 TTGCCAGGGGCTCAGAGAGGTGG + Intergenic
960691275 3:120349047-120349069 CTGCCACGGGCGCTGGGCAGCGG - Exonic
961481859 3:127185901-127185923 TTGCCAAGGGCTGGGGGAGGGGG - Intergenic
961789754 3:129366952-129366974 TTGCCAGGGGCTGGGGGAGGAGG - Intergenic
962072643 3:132047475-132047497 AAGCCACTGACTTTGGGAGGTGG + Intronic
965469957 3:169078639-169078661 TTGCCAGGGGCTTGGGGAGGTGG - Intergenic
967146721 3:186612709-186612731 ATGCCATGGGGTCTGTGAGAGGG - Intergenic
967292939 3:187939140-187939162 ATGACAAGGACTCTGTGAGGAGG + Intergenic
969544391 4:7815234-7815256 GTGCCAGGGGCTGGGGGAGGAGG + Intronic
970239670 4:13995337-13995359 ATGCCACATCCTCTGGAAGGGGG + Intergenic
973755071 4:54066076-54066098 CTGCCAGGGGCTCATGGAGGAGG + Intronic
976206511 4:82627607-82627629 ATGCCCCAGGCACTGGGATGAGG + Intergenic
985611356 5:891425-891447 CTGCCAGGGTCTCTGTGAGGAGG - Intronic
992663579 5:78984837-78984859 AGGCCGCGGGCGCTGGCAGGCGG - Intronic
997618613 5:135270523-135270545 ACTCCATGGCCTCTGGGAGGCGG + Intronic
998662423 5:144254673-144254695 TTGCCAGAGGCTGTGGGAGGGGG - Intronic
998995418 5:147865665-147865687 GTTCCAGGGGCTCTGGGAGTGGG - Intergenic
1002360643 5:178667949-178667971 ATTCAACGGGCTCTGGGAAGAGG + Intergenic
1002410972 5:179076224-179076246 ATGCCACGTGCAGTGGGAGTAGG - Intronic
1002575444 5:180171387-180171409 ATTCCCCGGGCTGTAGGAGGAGG - Intronic
1003207002 6:4021636-4021658 CAGCCACGGCCTCTGGGAGAAGG - Intronic
1003276318 6:4656256-4656278 TTCCCAGGGGCTCAGGGAGGAGG - Intergenic
1003539520 6:7006039-7006061 TTGCCAGGGGCTGTAGGAGGGGG + Intergenic
1003636808 6:7839472-7839494 ATACCAGGGGCTATGGGAGAGGG - Intronic
1004621660 6:17335949-17335971 ATGGGACTGACTCTGGGAGGGGG - Intergenic
1006840746 6:37026636-37026658 ATCCCACCGTCCCTGGGAGGTGG + Intronic
1007220722 6:40276650-40276672 AGGCAATGGGCTCTGGGAGGGGG + Intergenic
1008358540 6:50586399-50586421 ATGCCCAGGGCTATGGGAGATGG - Intergenic
1009970736 6:70623216-70623238 AGAGCCCGGGCTCTGGGAGGAGG + Intergenic
1012520594 6:100116644-100116666 ATGCCACAGGCACTGGGGTGAGG - Intergenic
1012551431 6:100467505-100467527 AGGCCACCGGCTCAAGGAGGTGG - Intergenic
1012765072 6:103357535-103357557 ATGGCAGTGGCTCTGGGTGGAGG - Intergenic
1013552808 6:111225728-111225750 ATGACACGAGATCGGGGAGGGGG + Intronic
1013612968 6:111812249-111812271 GTGACAAGGCCTCTGGGAGGAGG + Intronic
1019380224 7:717827-717849 AAGCCATGAGCACTGGGAGGTGG - Intronic
1021857649 7:24873188-24873210 AAGCCAAGGGCACTGGGAGATGG + Intronic
1023875785 7:44285520-44285542 AGGCCAAGGGCTCTGCGTGGTGG + Intronic
1024208691 7:47185591-47185613 AGGCCACAGGCTCCTGGAGGAGG + Intergenic
1024365969 7:48520887-48520909 ATGCCAAGAACTCTGGGAGCAGG + Intronic
1024504850 7:50153684-50153706 CTGCCTGGGGCTCTGGGAGGGGG + Intronic
1025710123 7:63900788-63900810 ATGACCCGGGCTCGGGGACGGGG + Intergenic
1027227119 7:76250909-76250931 CTGCCAGGGGCCCTGGGTGGGGG - Intronic
1029148033 7:98460403-98460425 TTGCCAGGGGCTGGGGGAGGAGG - Intergenic
1030537991 7:110792851-110792873 TTGCCAGGGGCTGGGGGAGGGGG - Intronic
1031387498 7:121170085-121170107 ATACCACGTGCTTTGTGAGGTGG - Intronic
1034128269 7:148693590-148693612 AGGCCAGAGGTTCTGGGAGGAGG - Intergenic
1034152398 7:148927166-148927188 CTGCCAAGGGCTCTCGGGGGTGG - Intergenic
1034216147 7:149407460-149407482 TTGCCAGGGGCTGGGGGAGGTGG - Intergenic
1034418397 7:150976971-150976993 CTGCCAAGGGCCCTGGGAGTTGG - Intronic
1034475837 7:151281345-151281367 ATGCCAGGGGCTGGGGGAGGGGG + Intergenic
1034838444 7:154373791-154373813 GTGCCAGGGGCTGCGGGAGGAGG - Intronic
1035698876 8:1622844-1622866 ATGCCCCGGGATGTAGGAGGGGG + Intronic
1037291432 8:17353270-17353292 TTGCCAGGGGCTGTGGTAGGTGG + Intronic
1038408611 8:27341163-27341185 CAGCCAAGAGCTCTGGGAGGAGG - Intronic
1038540071 8:28384900-28384922 GTGCCAGGCCCTCTGGGAGGTGG - Intronic
1041371942 8:57171210-57171232 ATGGCAGGGGCTCTAGGAAGAGG - Intergenic
1042392407 8:68251039-68251061 TTGCCAGGGGCTGTGGGAAGGGG + Intergenic
1042578241 8:70246719-70246741 TTGCCAGGGGCTAGGGGAGGAGG - Intronic
1044863020 8:96541677-96541699 CTGCCAGGGGCTGAGGGAGGGGG + Intronic
1045485090 8:102624891-102624913 TTGCCAGGGGCTGGGGGAGGGGG - Intergenic
1048616949 8:136085596-136085618 TTGCCAGGGGCTGTGGGAGTGGG - Intergenic
1048944689 8:139433677-139433699 ATGCCTTTGGCTCAGGGAGGAGG - Intergenic
1049196899 8:141320708-141320730 AAGCCAAGGTCTCGGGGAGGTGG - Intergenic
1049215923 8:141408195-141408217 TTGCCAGGGGCTGGGGGAGGAGG + Intronic
1053462631 9:38282354-38282376 CTGCCACGGCTTCTGGGAAGAGG + Intergenic
1057188177 9:93070641-93070663 ATGCCAAGGCATCTGGAAGGTGG - Intronic
1058366362 9:104213818-104213840 TTGCTAGGGGCTCTGGGATGGGG - Intergenic
1060222179 9:121770391-121770413 GAGCCACTGGGTCTGGGAGGGGG - Intronic
1060401084 9:123349976-123349998 CTTCCACCCGCTCTGGGAGGGGG - Intergenic
1060549597 9:124478626-124478648 ACGCCAGGCCCTCTGGGAGGAGG + Intergenic
1060891633 9:127192911-127192933 GTGCCAAGGGCTCTGGGAGGAGG + Intronic
1061294565 9:129669996-129670018 GTGCCAGGGGCTGGGGGAGGGGG - Intronic
1061426106 9:130499400-130499422 ATGCCCTGGCATCTGGGAGGTGG + Intronic
1061796922 9:133091011-133091033 ATGCCAAGGGTGCTGGGTGGTGG + Intergenic
1062454820 9:136630423-136630445 GAGCCAGGGGCTCTGGGAGTGGG + Intergenic
1062530066 9:136995834-136995856 ATCCCACTGGCAGTGGGAGGCGG - Intronic
1062675817 9:137743027-137743049 AAGCCAAGGGGACTGGGAGGAGG + Intronic
1062690055 9:137837034-137837056 CTGCCACTGCCTCTGGGATGAGG - Intronic
1185433039 X:20284-20306 TTGTCACGGGCTGGGGGAGGCGG - Intergenic
1186193898 X:7093163-7093185 TTGCCAGGGGCTGGGGGAGGGGG - Intronic
1186416904 X:9391769-9391791 TTGCCAGGGGCTGTGGGTGGAGG + Intergenic
1186756990 X:12681963-12681985 TTGCCACGGGCTGGGGGTGGAGG - Intronic
1194767278 X:97856327-97856349 ATCCCTTGAGCTCTGGGAGGTGG - Intergenic
1195426974 X:104744979-104745001 ATGCCACTTTCTATGGGAGGGGG - Intronic
1196440763 X:115717941-115717963 ATGCCAGGGGCTGGGGAAGGGGG - Intergenic
1196885887 X:120245045-120245067 AGGCCTCGGGCTCCGGGCGGGGG - Intergenic
1197307538 X:124862398-124862420 CTGCCACGGGCAATGGGGGGAGG - Intronic
1198368071 X:135963111-135963133 TTGCCAGGGGCTCGGGGATGGGG + Exonic
1200132939 X:153861367-153861389 AAGGCCCGGGCTCTGGGAAGGGG + Intergenic
1200232405 X:154450525-154450547 ATGCCAGGCACGCTGGGAGGAGG + Exonic
1200234075 X:154459860-154459882 TTGCCCCGGGCTCTGAGATGTGG + Intronic