ID: 1142328232

View in Genome Browser
Species Human (GRCh38)
Location 16:89432410-89432432
Sequence CCGTGGCATGCACTGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328219_1142328232 28 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328222_1142328232 7 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328224_1142328232 0 Left 1142328224 16:89432387-89432409 CCGTGGCAGCCGCCTCCCAGAGC 0: 1
1: 0
2: 3
3: 44
4: 347
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328221_1142328232 15 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328226_1142328232 -9 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124
1142328223_1142328232 6 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328232 Original CRISPR CCGTGGCATGCACTGTGTTG AGG Intronic
903833490 1:26188653-26188675 CCGTGGGCTGCGCTGTGTGGGGG - Exonic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
911430093 1:97774152-97774174 CCGTTGCATGCCCTGTGAGGGGG + Intronic
912017385 1:105059099-105059121 CTGTGGCATACACTGTTTAGGGG + Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
915125324 1:153659615-153659637 CAGTGGCTTTCACTGTGTTGAGG - Intronic
920441985 1:205986845-205986867 CCTCGGCCTGCACTGTGTTCTGG - Intronic
922693543 1:227713608-227713630 CCGTGGGTTGCACAGTTTTGTGG - Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
1064405111 10:15054728-15054750 ACTTTGCATCCACTGTGTTGTGG + Intronic
1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG + Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069764868 10:70847968-70847990 CAGCGGCATGAACTGTGCTGGGG + Intronic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1072654612 10:97321077-97321099 CCTGGGCACGCACTGGGTTGCGG + Exonic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076407507 10:130222506-130222528 CCGTGGCTTGTGCTGTGTTAAGG + Intergenic
1076919056 10:133441910-133441932 GCGTGGCAGGCGGTGTGTTGGGG + Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078326763 11:10387573-10387595 CCGTGAGATGCTCTGTGTGGCGG - Intronic
1078937486 11:15964615-15964637 ATGTGCCAAGCACTGTGTTGGGG + Intergenic
1084951457 11:72668492-72668514 CCCTGGCTTGCTATGTGTTGGGG - Intronic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1091216708 11:133906767-133906789 CCCTGGGATGCACTGGGATGTGG - Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092290769 12:7158380-7158402 CCTTAGCACTCACTGTGTTGGGG + Exonic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103008758 12:117441684-117441706 CCAGGGCATCCAATGTGTTGGGG - Intronic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106569509 13:30914428-30914450 AACTGGCATGCACTGTGATGAGG + Intronic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1110252745 13:73398958-73398980 ACATGGCATGCACTGTTTTTCGG - Intergenic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113443497 13:110347641-110347663 CCAGGGCATGCAGTGTGTGGTGG - Intronic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1119602109 14:75983044-75983066 CAGAGGCAAGCCCTGTGTTGCGG - Intronic
1120604289 14:86553610-86553632 CTGTGGCATTCACTGTAGTGTGG + Intergenic
1120925898 14:89796823-89796845 CCGTGGCCTGCAGTGTGGAGAGG + Exonic
1121445487 14:93975983-93976005 CCTAGGCATGCACGGTATTGTGG - Intronic
1122790754 14:104183212-104183234 ACGTGGAATCCACTGTCTTGGGG + Intergenic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1132336587 15:101051981-101052003 CTGTGACCTGCACTGTGTTCTGG - Intronic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1144874416 17:18390037-18390059 CAGTGGCATGCAGTGAGATGAGG - Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1149452549 17:56761101-56761123 GGGTGGCATCCACTGTGTTTAGG - Intergenic
1153431752 18:5025043-5025065 CCATGGCATGCACAGGGTTGGGG - Intergenic
1154448866 18:14458971-14458993 CGGTGGCTTGCACAGGGTTGGGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG + Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1158568922 18:58580061-58580083 CCATGGAATGCACTGTCTTGTGG + Exonic
1159120041 18:64158298-64158320 GCGTGGCATGCCCTGTGTCTAGG + Intergenic
1165139798 19:33691880-33691902 CCATGGCATGAACTGTCCTGGGG + Intronic
1166959669 19:46489922-46489944 GCGTGCCAGGCACGGTGTTGGGG + Intronic
1167048893 19:47067099-47067121 CGGTGGCATTGACTGTCTTGAGG + Exonic
1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG + Intronic
926304948 2:11631151-11631173 CAGCTGCATGCACAGTGTTGTGG + Intronic
938744033 2:134260130-134260152 CAGTGGCATGGAAGGTGTTGAGG + Intronic
939954441 2:148514749-148514771 AGGTGGCATGCTCTGTGCTGTGG - Intronic
942335306 2:174878070-174878092 CGATGGCAAGCACTTTGTTGGGG - Exonic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1170780821 20:19423863-19423885 TCGTATCATGCACTCTGTTGTGG - Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1175414072 20:58789991-58790013 CCGTGGTAGGCACTGTGGGGGGG + Intergenic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
954304026 3:49716200-49716222 CCGAGGCCTGTAGTGTGTTGGGG - Intronic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
961312010 3:126008403-126008425 GTGTGGGTTGCACTGTGTTGTGG + Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
962121472 3:132565186-132565208 CCCTGGCAAGCACTGTAATGAGG + Intronic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
965759263 3:172057758-172057780 CCAAGGCATGCACTGAGGTGGGG - Intronic
967090203 3:186128432-186128454 CCGTGTCAAGCACTCTGCTGGGG + Intronic
968523499 4:1045122-1045144 CCCTGGCCTGCACTGTGGGGAGG - Intergenic
969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG + Intronic
970608450 4:17704100-17704122 CTGGGGCATGCACTGTTGTGTGG - Intronic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG + Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
980603768 4:135061981-135062003 CCCAATCATGCACTGTGTTGTGG + Intergenic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
988164526 5:27568172-27568194 CACTGGCATGTACTATGTTGGGG - Intergenic
990355889 5:54965813-54965835 CCATGGCAACCACTGTGTTATGG - Intergenic
990972563 5:61525068-61525090 CCCTGGCATACACTATGCTGGGG + Intronic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG + Intronic
997657901 5:135568861-135568883 CCCTGGTATGCACTGTCTTCTGG + Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
999061527 5:148640553-148640575 CACTGGCATTCCCTGTGTTGTGG - Intronic
1004426337 6:15509697-15509719 CTGTGGCATGGCCTGTGTTCTGG + Intronic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1007398099 6:41588647-41588669 CCAGGGCGTGCTCTGTGTTGAGG - Exonic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1018462849 6:164015566-164015588 CCTTGTCTTGCACTGTGTTGGGG + Intergenic
1019121279 6:169806703-169806725 CTGTGGAGTGCTCTGTGTTGTGG - Intergenic
1024228212 7:47344566-47344588 CCGTGAAATCCACTGTGTGGTGG - Intronic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1031592693 7:123612559-123612581 CCATGGCTCGCACTGTGTTAAGG - Intronic
1035599621 8:889914-889936 CCGTGGGTTGCACGGTTTTGTGG + Intergenic
1038855001 8:31321321-31321343 CAGTGGCCTTCACTGGGTTGTGG + Intergenic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1039557322 8:38485806-38485828 CAGTGGCAGGGGCTGTGTTGTGG - Intergenic
1044085281 8:87936072-87936094 CCATCGCATGCCCTGTGATGGGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1049445143 8:142626671-142626693 AAGTGGCAAGCACTGTGGTGTGG - Intergenic
1049638826 8:143705246-143705268 CTGGGGCAAGAACTGTGTTGGGG - Intronic
1049717572 8:144100153-144100175 CCCTGGCATGGACTGAGGTGAGG - Intronic
1056929278 9:90861234-90861256 ACGTGGCATGCACTGCAGTGGGG + Intronic
1059217217 9:112575231-112575253 ACCTGGTATGCACTGTGCTGTGG - Exonic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1061925993 9:133806314-133806336 CCCTGGCATGCACAGAGATGTGG - Intronic
1062025329 9:134337623-134337645 CCCTGGCATGCAGAGAGTTGGGG + Intronic
1062547200 9:137069165-137069187 CCAAGGCAGGCACTGGGTTGGGG + Intronic
1203634250 Un_KI270750v1:96300-96322 CCGTGGGAACCACTGTGATGGGG + Intergenic
1186311973 X:8330096-8330118 TCATAGCATGCACTGTGTTCTGG + Intergenic
1188968253 X:36580980-36581002 CAGTGGCATCAAATGTGTTGGGG + Intergenic
1189992638 X:46609238-46609260 CCTGGGCATGAACTGTGATGTGG + Intronic
1190522169 X:51291566-51291588 CCATGCTATGCACTGTGTAGAGG - Intergenic
1201989977 Y:20013084-20013106 ACGTAGCATGTACTGTGTTCAGG + Intergenic