ID: 1142328233

View in Genome Browser
Species Human (GRCh38)
Location 16:89432411-89432433
Sequence CGTGGCATGCACTGTGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328226_1142328233 -8 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328221_1142328233 16 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328223_1142328233 7 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328222_1142328233 8 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328224_1142328233 1 Left 1142328224 16:89432387-89432409 CCGTGGCAGCCGCCTCCCAGAGC 0: 1
1: 0
2: 3
3: 44
4: 347
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129
1142328219_1142328233 29 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG 0: 1
1: 0
2: 2
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328233 Original CRISPR CGTGGCATGCACTGTGTTGA GGG Intronic
908784376 1:67720597-67720619 TGTGCCAGGCACTGTGTTAAGGG + Intronic
909818174 1:80024197-80024219 CATGGCATGTACTGTGTTCCAGG + Intergenic
910371486 1:86520969-86520991 CATGGCAGGCACTGTGCTGGAGG + Intergenic
911168747 1:94747955-94747977 GGTGGCGTGCACTGGGTTAAGGG - Intergenic
912429036 1:109619595-109619617 CGTGCCAGGCACTGTGTAAAGGG + Intronic
913280756 1:117182712-117182734 CGAGGCAGGCCCTGTGTTGAAGG - Intronic
915643633 1:157250597-157250619 GGTGGGATGCAGCGTGTTGATGG - Intergenic
918144747 1:181745629-181745651 GCTGGCATGATCTGTGTTGATGG - Intronic
921290476 1:213652234-213652256 CGTGCCTGGCACTGTGTTAAGGG + Intergenic
922184922 1:223265744-223265766 TGTGGCATCCACTGTGATCAGGG + Intronic
922569599 1:226626161-226626183 CATGGCATGCAGTGTGAAGAGGG - Intergenic
924772361 1:247088842-247088864 CGTGGCATGCACTGTGGTGGAGG - Intergenic
1064405112 10:15054729-15054751 CTTTGCATCCACTGTGTTGTGGG + Intronic
1065863888 10:29896448-29896470 TGTGCTAGGCACTGTGTTGAGGG + Intergenic
1068960836 10:62864734-62864756 TCCGGCATGCAGTGTGTTGATGG + Intronic
1069708899 10:70476749-70476771 CGTGCCAGGCACTGTGCTGTGGG + Intergenic
1070672431 10:78387510-78387532 CTTGGCATTCACTGTCTTAAAGG + Intergenic
1072296965 10:94018233-94018255 TGTGTCATGCAATGTGTTCAAGG + Intronic
1074214396 10:111370153-111370175 CATGGCATGCGCTGTTCTGATGG + Intergenic
1074904192 10:117846718-117846740 TGTGGCAGGCACTGTTTTGCTGG + Intergenic
1075917537 10:126182067-126182089 CCTGGGATGCACTGCGTTGCCGG - Intronic
1076307507 10:129475378-129475400 CCTCTCATGCACTGTGCTGAGGG - Intronic
1076919057 10:133441911-133441933 CGTGGCAGGCGGTGTGTTGGGGG + Intergenic
1078937487 11:15964616-15964638 TGTGCCAAGCACTGTGTTGGGGG + Intergenic
1083494088 11:63035238-63035260 GGTGGCATGCACTGTAATCACGG - Intergenic
1084405169 11:68967915-68967937 CGTGGCCTGCACTGGGTGAAAGG - Intergenic
1091845103 12:3649711-3649733 CATGCCAGGCACTGTGTTGAGGG - Intronic
1093914074 12:24780907-24780929 CGGGGCATTCAGTGTTTTGAAGG + Intergenic
1094598926 12:31891356-31891378 CGTGCAATGCACTGTGGAGAGGG + Intergenic
1094813997 12:34166391-34166413 CGTGCCCCGCACTGTGTTCATGG - Intergenic
1105849714 13:24323181-24323203 CTTGGCAGGCACTGTGGTGGGGG - Intergenic
1106257166 13:28032201-28032223 CCTTGCATACACTGTGTTAAAGG + Intronic
1109595839 13:64552514-64552536 GGTGGCATGAAATGTGGTGACGG + Intergenic
1113692674 13:112322770-112322792 CATGGCATGCCCTGTGCTGGGGG + Intergenic
1117210851 14:53497670-53497692 TGAGGCATCCACTTTGTTGAAGG + Intergenic
1118701692 14:68439634-68439656 CCTGGCCTGGACTGTCTTGAAGG + Intronic
1119386773 14:74262173-74262195 CCTGGCATGCACTGGCATGAAGG - Exonic
1120676794 14:87429967-87429989 TGTGTCAGGCACTGTGTTCAAGG - Intergenic
1120925899 14:89796824-89796846 CGTGGCCTGCAGTGTGGAGAGGG + Exonic
1121169907 14:91844904-91844926 CGTGCCAAACACTGTGTTAATGG + Intronic
1121309276 14:92926395-92926417 CATGGTAAGCACTGTGTTAAGGG + Intronic
1127689866 15:61384886-61384908 TGTGGCAGGCACTGTGAAGAAGG - Intergenic
1135508323 16:23058820-23058842 TGTGCCAGGCACTGTGCTGAAGG + Intergenic
1137022274 16:35440550-35440572 CTTGGCCTTCAGTGTGTTGATGG - Intergenic
1140311020 16:73848419-73848441 TGTGGGAAGCACTGTTTTGAAGG - Intergenic
1140591003 16:76352626-76352648 TGTGTCAGGCACTTTGTTGAAGG - Intronic
1141075825 16:81006364-81006386 CGTGTCAAACCCTGTGTTGAGGG + Intronic
1142328233 16:89432411-89432433 CGTGGCATGCACTGTGTTGAGGG + Intronic
1143010733 17:3864985-3865007 CCTGGCCTGCTCTGTGTGGAAGG - Intronic
1145889980 17:28407479-28407501 CGTGCCAGGCACTGTGCTGGGGG + Intergenic
1147046964 17:37759933-37759955 GGAGGCATGCAATTTGTTGAAGG + Intergenic
1148750103 17:49940691-49940713 TGTGCCAGGCACTGTGCTGAGGG + Intergenic
1151769019 17:76147596-76147618 CTTGGTATGCTCTGTGGTGAGGG + Intronic
1152663889 17:81556168-81556190 AGTGAACTGCACTGTGTTGAAGG + Intergenic
1155458799 18:26052707-26052729 ACTGGCATGCTCTGTGATGATGG + Exonic
1157116841 18:44870077-44870099 TGAGGCAGGCACTGAGTTGAAGG - Intronic
1157208310 18:45719307-45719329 CTTGCCATGCTCTTTGTTGAGGG - Intergenic
1157214101 18:45767986-45768008 AGTGCCATGCACAGTGTCGAAGG + Intergenic
1158274143 18:55748259-55748281 GGTGGGAGGCACTGTGTGGAAGG - Intergenic
1161609635 19:5234681-5234703 CGTGCCAGGCACTGTGCTAAGGG + Intronic
1161609645 19:5234749-5234771 TGTGCCAGGCACTGTGTTAAAGG + Intronic
1163299654 19:16436027-16436049 AGTGGCAATCACTGTGGTGAAGG - Intronic
1163758257 19:19119785-19119807 CGGGTCAGGCACTGTGGTGAAGG + Exonic
928171836 2:29009418-29009440 AGTGGCATGGACCGTGTAGATGG + Intronic
928436391 2:31257267-31257289 CTTGCCATGCGCTGTGCTGAAGG + Intronic
930123426 2:47778297-47778319 CGTGCCAAGCACTGGGCTGAGGG + Intronic
933223122 2:79714177-79714199 AGTTGCATGGACTGTCTTGAAGG - Intronic
938212332 2:129479043-129479065 CCTGGCATTCAGTGTCTTGAGGG + Intergenic
944024742 2:195150273-195150295 GGTAGCATGCTCTGTGCTGAAGG - Intergenic
948993659 2:241567425-241567447 CGTGGAATGCACTGTTCTGATGG + Intronic
1170780820 20:19423862-19423884 CGTATCATGCACTCTGTTGTGGG - Intronic
1175208188 20:57328049-57328071 TGTACCAAGCACTGTGTTGATGG - Intergenic
1175654092 20:60753577-60753599 CGTGGCATGTGCTGTCTTCATGG + Intergenic
1175714916 20:61248710-61248732 TGTGGCAGGTACTGTGTCGAAGG - Intergenic
1175793120 20:61754685-61754707 TGTGGCATGCACTGTGTGTGTGG - Intronic
1175793126 20:61754750-61754772 TGTGGCATGCACTGTGTGTGTGG - Intronic
1176376581 21:6089684-6089706 CATGGCAGGCACAGGGTTGAGGG - Intergenic
1177087621 21:16726922-16726944 CGTGGCTGGTACTTTGTTGATGG - Intergenic
1179746894 21:43448560-43448582 CATGGCAGGCACAGGGTTGAGGG + Intergenic
1182183378 22:28375263-28375285 CGTGACAGGCACTGTGCTGAAGG + Intronic
1184294977 22:43517388-43517410 CGTGGCACACAATGTGTTTAGGG + Intergenic
1184472579 22:44704130-44704152 TGTGCTAAGCACTGTGTTGAGGG - Intronic
951742544 3:25940335-25940357 CTTGGCAGCAACTGTGTTGATGG + Intergenic
953155164 3:40363852-40363874 CTTGGCATCCACTGTGATGCTGG - Intergenic
955563589 3:60220646-60220668 AGTAGCAGACACTGTGTTGATGG + Intronic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
963294433 3:143530069-143530091 TGTAGCATGCACTGTACTGAGGG + Intronic
968523497 4:1045121-1045143 CCTGGCCTGCACTGTGGGGAGGG - Intergenic
969055184 4:4397270-4397292 CCAGGCATGCACTGGGTCGATGG - Intronic
969443164 4:7229023-7229045 CGTGGCCTGGTCTGTGTTGAGGG + Intronic
969543339 4:7807811-7807833 TATGGCGTGCACTGTCTTGAAGG - Intronic
970638747 4:18039711-18039733 CTTGGCAAGCACTGTGGGGATGG + Intergenic
971581086 4:28341947-28341969 AATGGCATGCACTGTGGTCAGGG - Intergenic
983959455 4:173734629-173734651 CATGGCATGCACAGTGCTGCTGG + Intergenic
985902145 5:2805004-2805026 TGTGGAATCCATTGTGTTGAAGG + Intergenic
986148189 5:5100067-5100089 CGTGGCATAGATTGTGGTGATGG - Intergenic
990369920 5:55107261-55107283 CTTGGCATTGAGTGTGTTGAAGG - Intronic
996532758 5:124543797-124543819 CGTGGCATTCACTGCCTCGAGGG + Intergenic
997625231 5:135326850-135326872 TGTGGCATTCACTGGGTGGACGG + Intronic
997632226 5:135377535-135377557 CGTGGGCTGCACTGTGTTGGGGG + Intronic
997929948 5:138064293-138064315 CAGGCCAGGCACTGTGTTGAGGG + Intergenic
1000290387 5:159864584-159864606 CGAGGCAAGGGCTGTGTTGAGGG - Intergenic
1000577831 5:162996985-162997007 CTTTTCCTGCACTGTGTTGAGGG + Intergenic
1005861095 6:29901528-29901550 CATGGAATGCACTGTATTAATGG + Intergenic
1006033474 6:31194638-31194660 CGTGCCAGGCATTGTGTTTAAGG - Intergenic
1007652739 6:43433284-43433306 GGTGGCAATCACTTTGTTGACGG - Exonic
1013339854 6:109203133-109203155 CGTGGCAAGTACAGTGATGAAGG + Intergenic
1015310094 6:131757272-131757294 AGGGACATGCACTGTGTTCAAGG + Intergenic
1017517832 6:155173663-155173685 TGTGGGACGCACTGTGTTAATGG + Intronic
1018570678 6:165206242-165206264 CGTGACATGGAGTGTGATGATGG - Intergenic
1022954830 7:35371445-35371467 CAATGCATGCACTGTGTTGCAGG + Intergenic
1024691791 7:51810502-51810524 CGTGGGAAGAAATGTGTTGATGG + Intergenic
1026377829 7:69769895-69769917 CATGGCAGGCACTGTTCTGAAGG - Intronic
1028635737 7:92987227-92987249 TGTGGCATGCTCTGTGAAGATGG + Intergenic
1030213515 7:107019980-107020002 AGTGTCATGCACTGTGTGCAAGG + Intergenic
1033612953 7:142983881-142983903 CATGGCATGCAGTGTGCTGGTGG + Intergenic
1034005985 7:147472779-147472801 GGTGCCATGAACTGTGATGAGGG + Intronic
1035443825 7:158925897-158925919 TGTGGCATGCTCTGTTTGGATGG + Intronic
1039779618 8:40771107-40771129 CGTGGCATGCCCTGTGTTAAAGG + Intronic
1041100621 8:54393005-54393027 TGTGGGATGCACAGGGTTGAAGG - Intergenic
1041361731 8:57061827-57061849 TGTGCCAGGCACTGTGTTAAGGG - Intergenic
1041994886 8:64042566-64042588 AGTGGCATGCACTCTCTTAAAGG + Intergenic
1044025802 8:87170594-87170616 CGTGGCTTTCATTATGTTGAAGG + Intronic
1049245559 8:141560444-141560466 CGTGCCAGGCTCTGTGCTGAGGG + Intergenic
1049717570 8:144100152-144100174 CCTGGCATGGACTGAGGTGAGGG - Intronic
1052398794 9:27974526-27974548 CATTGCATGGACTGTGTTGCAGG - Intronic
1053613471 9:39739848-39739870 CGTGGCTTGAACTGGCTTGAAGG + Intergenic
1053871512 9:42497805-42497827 CGTGGCTTGAACTGGCTTGAAGG + Intergenic
1054240043 9:62602549-62602571 CGTGGCTTGAACTGGCTTGAAGG - Intergenic
1054554176 9:66637075-66637097 CGTGGCTTGAACTGGCTTGAAGG - Intergenic
1055407511 9:75989963-75989985 GGTGTCAGGCACTGTGTTAAAGG - Intronic
1056929279 9:90861235-90861257 CGTGGCATGCACTGCAGTGGGGG + Intronic
1056991742 9:91419672-91419694 TGTGCCAGGCACAGTGTTGAGGG - Intronic
1062366323 9:136211130-136211152 CGTGCCACCCACTGTGCTGACGG - Intronic
1062664998 9:137665682-137665704 TGTGGGATGAGCTGTGTTGATGG + Intronic
1189233902 X:39473196-39473218 TGTGTCAGGCACTGTGTTGGTGG - Intergenic
1189534110 X:41919121-41919143 CATTGCACGCACTGTGTTAATGG + Intronic
1189667032 X:43366714-43366736 CTTGGAATGCACAGTGTTAAGGG - Intergenic