ID: 1142328234

View in Genome Browser
Species Human (GRCh38)
Location 16:89432412-89432434
Sequence GTGGCATGCACTGTGTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328219_1142328234 30 Left 1142328219 16:89432359-89432381 CCGCTGTTTGTGACCTCAGGACC 0: 1
1: 0
2: 0
3: 9
4: 153
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328221_1142328234 17 Left 1142328221 16:89432372-89432394 CCTCAGGACCCATCGCCGTGGCA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328226_1142328234 -7 Left 1142328226 16:89432396-89432418 CCGCCTCCCAGAGCCCGTGGCAT 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328224_1142328234 2 Left 1142328224 16:89432387-89432409 CCGTGGCAGCCGCCTCCCAGAGC 0: 1
1: 0
2: 3
3: 44
4: 347
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328227_1142328234 -10 Left 1142328227 16:89432399-89432421 CCTCCCAGAGCCCGTGGCATGCA 0: 1
1: 0
2: 1
3: 16
4: 200
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328222_1142328234 9 Left 1142328222 16:89432380-89432402 CCCATCGCCGTGGCAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data
1142328223_1142328234 8 Left 1142328223 16:89432381-89432403 CCATCGCCGTGGCAGCCGCCTCC 0: 1
1: 0
2: 4
3: 30
4: 369
Right 1142328234 16:89432412-89432434 GTGGCATGCACTGTGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328234 Original CRISPR GTGGCATGCACTGTGTTGAG GGG Intronic
No off target data available for this crispr