ID: 1142328497

View in Genome Browser
Species Human (GRCh38)
Location 16:89434207-89434229
Sequence GAATCCATAGTGTCTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142328497_1142328501 -10 Left 1142328497 16:89434207-89434229 CCTCCTCAAGACACTATGGATTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1142328501 16:89434220-89434242 CTATGGATTCTGTGTGTCTGGGG 0: 1
1: 0
2: 6
3: 29
4: 304
1142328497_1142328502 -9 Left 1142328497 16:89434207-89434229 CCTCCTCAAGACACTATGGATTC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1142328502 16:89434221-89434243 TATGGATTCTGTGTGTCTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142328497 Original CRISPR GAATCCATAGTGTCTTGAGG AGG (reversed) Intronic
903545342 1:24120465-24120487 GAATCCATGGTGTTAGGAGGTGG + Exonic
905121873 1:35688703-35688725 GAATAGATAGAGGCTTGAGGAGG + Intergenic
909099298 1:71331299-71331321 AAATGCATAGTGTCAAGAGGTGG - Intergenic
1062849017 10:728979-729001 GAAGGCATGGTGTCTTGGGGAGG - Intergenic
1072247930 10:93559559-93559581 GAAGCCCCAGTGCCTTGAGGAGG - Intergenic
1078354241 11:10622425-10622447 GTAACCATAGTGCCATGAGGTGG - Intronic
1079209833 11:18450997-18451019 GTATCCCTTGTGTCTTGGGGCGG + Exonic
1085801299 11:79592437-79592459 AGATGCATAGTGTCTTGTGGAGG + Intergenic
1087729400 11:101761048-101761070 AAATCCATGGTATCTAGAGGTGG - Intronic
1094023485 12:25939278-25939300 GAATACACACAGTCTTGAGGGGG + Intergenic
1101252336 12:102948593-102948615 GATGCCCTAGTGACTTGAGGGGG - Intronic
1104097385 12:125569935-125569957 CAATCCATGGTGACTTGAAGTGG + Intronic
1106721882 13:32443164-32443186 GAATCCATAGTTTCAGGTGGAGG + Exonic
1106959406 13:34980268-34980290 GAATACATAGTTTAATGAGGGGG + Intronic
1107911490 13:45109361-45109383 CACTCCAGAGTGTCTTAAGGTGG - Intergenic
1116581814 14:46651854-46651876 GGAACCATAGAGTCCTGAGGAGG + Intergenic
1120119529 14:80661861-80661883 GAATGCAAAGTGTCTTGTGGAGG + Intronic
1123129817 14:105975880-105975902 AATTCCATAGTGTCCAGAGGTGG + Intergenic
1127407562 15:58667649-58667671 GTATCCAGAGTATCATGAGGTGG + Intronic
1131886173 15:96915590-96915612 GAATACATTGTTTCTTGGGGAGG - Intergenic
1137023298 16:35451362-35451384 GAATCCAAAGTGGCTGGTGGCGG + Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1147922517 17:43926819-43926841 GAATCCTTACTGTCTAGAGGTGG + Intergenic
1151264399 17:72943105-72943127 GAAGAGAGAGTGTCTTGAGGTGG + Intronic
1155649747 18:28127038-28127060 GGGTCCACAGTGCCTTGAGGAGG - Intronic
1164151690 19:22559118-22559140 GATTCCATAGTGTCTTGCAATGG + Intergenic
1168163862 19:54533315-54533337 GAATCCAGCGTGTCTGGGGGTGG + Intronic
926783225 2:16494869-16494891 GAAGCCATATTGTCTTTAGTGGG - Intergenic
927356726 2:22182023-22182045 GACTCCTCAGAGTCTTGAGGTGG + Intergenic
928124408 2:28605812-28605834 GAACCAATAGGATCTTGAGGGGG + Intronic
930634312 2:53787403-53787425 GAACCCTTAGTGTCAGGAGGAGG - Intronic
935050655 2:99522325-99522347 GAAGCCATATTGTCATGATGAGG + Intergenic
936409375 2:112241443-112241465 CAATCCATAGGCCCTTGAGGGGG - Intronic
947454661 2:230242992-230243014 TAATCCTTAGTGTATTAAGGAGG - Intronic
1171228361 20:23460288-23460310 GAATCCAGAGGGTCATGGGGTGG + Intergenic
1172823373 20:37758680-37758702 CAATCCACAGAGCCTTGAGGAGG - Intronic
1174970200 20:55266722-55266744 AAATCTATATTGTCTTGTGGAGG - Intergenic
1181672679 22:24433024-24433046 GAAACTATAGGGTCTTCAGGGGG + Intronic
1183192835 22:36332637-36332659 TTATCCAGAGTGTCTGGAGGGGG - Intronic
1185036633 22:48481606-48481628 GAATCCATAGTTTCCTGGGATGG + Intergenic
951071621 3:18335714-18335736 GAATCCATAGAGGTTTGAAGTGG + Intronic
954449676 3:50564951-50564973 GAATACATGGTGTCTTGAGCTGG - Intronic
957136899 3:76299784-76299806 GAGTCCATAGGATTTTGAGGTGG + Intronic
959194207 3:103157439-103157461 AAATCCATAGAGTGTAGAGGTGG + Intergenic
965944914 3:174228939-174228961 GAATCCATACTGTCTTCAGTGGG - Intronic
968189839 3:196659844-196659866 GATTCCACAGGGTCTTGAGAGGG - Exonic
975230530 4:71927517-71927539 AAATCCATAGTGTCTTGGCTGGG + Intergenic
978734378 4:112068392-112068414 GGATCCTTAGTTTCTTTAGGAGG - Intergenic
981857172 4:149308401-149308423 CAAACCATAGTGTTTTGAGAGGG + Intergenic
982818581 4:159918110-159918132 GAATCCCTAGTGTCTAGAACAGG - Intergenic
986278904 5:6306505-6306527 TAAACCATAGGGTCTTGTGGAGG - Intergenic
988482642 5:31642556-31642578 TAATCCACAGTATTTTGAGGAGG + Intronic
988551468 5:32204542-32204564 GAATCCAAAGGGTCTTGTGCAGG - Intergenic
990938733 5:61178358-61178380 GATTACATTGTGTCATGAGGTGG + Intergenic
992175771 5:74147356-74147378 GAAACCAGACTATCTTGAGGGGG - Intergenic
992758319 5:79929979-79930001 GAAGCCAATGTGTCTTGAGGGGG + Intergenic
1003180406 6:3786155-3786177 GAAAACATAGTGTCCTGAGCAGG + Intergenic
1004246052 6:13977132-13977154 GACTCCGCAGTGTCTTCAGGAGG - Exonic
1010320626 6:74504719-74504741 GATTCCCTACTGGCTTGAGGTGG - Intergenic
1011132504 6:84065864-84065886 GAATCCCTTTTGGCTTGAGGAGG - Intronic
1022831496 7:34072020-34072042 GAAGCCACAGTGTCTTGGGTTGG + Intronic
1023531551 7:41161795-41161817 GAATTCTTAATGTCTTTAGGAGG + Intergenic
1024566103 7:50682146-50682168 GAATCCAGAGACTCTTGAGAAGG + Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1037866675 8:22449530-22449552 GATTCCATAGTGTCTTAATGGGG + Intronic
1038587729 8:28805401-28805423 GAATCTAGAGGGTCTTGAAGTGG - Intronic
1040895247 8:52361344-52361366 GAATCACTAGAGTCTTGAGGGGG + Intronic
1041480542 8:58315311-58315333 GAGTCCATCCTGTCTTGAGTCGG - Intergenic
1049527530 8:143135664-143135686 CAGTCCCTGGTGTCTTGAGGGGG - Intergenic
1052017990 9:23491636-23491658 GAATCAATGGTGGCTTGATGAGG + Intergenic
1059871489 9:118583078-118583100 GAATCCATTGTGTCAATAGGTGG - Intergenic
1193844824 X:86455604-86455626 GAATCCAAATGGTCTGGAGGAGG - Intronic
1195608650 X:106838242-106838264 CAATAGAAAGTGTCTTGAGGGGG - Intronic
1198329830 X:135611979-135612001 GCATGCATAGTGTCATGAAGGGG + Intergenic
1198337163 X:135677788-135677810 GCATGCATAGTGTCATGAAGGGG - Intergenic
1199841223 X:151651407-151651429 AAATCCATTGTGTCAGGAGGTGG + Intronic