ID: 1142331330

View in Genome Browser
Species Human (GRCh38)
Location 16:89455884-89455906
Sequence TTTCCATTTGAACACTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 566}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142331330_1142331335 28 Left 1142331330 16:89455884-89455906 CCCAAAAAGTGTTCAAATGGAAA 0: 1
1: 0
2: 5
3: 41
4: 566
Right 1142331335 16:89455935-89455957 GAAAACAGAAAGGTGGAAACAGG 0: 1
1: 0
2: 4
3: 53
4: 694
1142331330_1142331334 21 Left 1142331330 16:89455884-89455906 CCCAAAAAGTGTTCAAATGGAAA 0: 1
1: 0
2: 5
3: 41
4: 566
Right 1142331334 16:89455928-89455950 CACTATTGAAAACAGAAAGGTGG 0: 1
1: 0
2: 12
3: 219
4: 1426
1142331330_1142331333 18 Left 1142331330 16:89455884-89455906 CCCAAAAAGTGTTCAAATGGAAA 0: 1
1: 0
2: 5
3: 41
4: 566
Right 1142331333 16:89455925-89455947 CAGCACTATTGAAAACAGAAAGG 0: 1
1: 0
2: 2
3: 88
4: 1051

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142331330 Original CRISPR TTTCCATTTGAACACTTTTT GGG (reversed) Intronic
903209127 1:21806170-21806192 TTTACATTTCAAAACTTGTTGGG - Intergenic
903249373 1:22041420-22041442 TTAAGATTTGTACACTTTTTAGG - Intergenic
903519860 1:23938750-23938772 TTACTATTTTAACCCTTTTTAGG - Intergenic
904905188 1:33892326-33892348 TTTTCATTTCAATAGTTTTTGGG + Intronic
906812520 1:48843143-48843165 TTACCATTTTAACCATTTTTAGG - Intronic
906824134 1:48960634-48960656 TTTCAAATTGCACTCTTTTTTGG - Intronic
906881062 1:49591606-49591628 TGGCTATTTGAACTCTTTTTTGG - Intronic
907479338 1:54733839-54733861 TTACCATTTTAACCATTTTTAGG + Intronic
907590742 1:55668392-55668414 TTTTTATTTCAACACTTTTTGGG - Intergenic
907904254 1:58769851-58769873 TGTCCCTTTGAAGACTTCTTCGG - Intergenic
907983994 1:59512465-59512487 ATTCCATTTGAATACGGTTTTGG - Intronic
908016894 1:59850476-59850498 TTTTCATTTAAACAGTTTTATGG + Intronic
908842570 1:68294376-68294398 TTACTATTTGTACACTTTTAGGG + Intergenic
909195922 1:72623094-72623116 TTTCTTTTTGAAAACATTTTAGG + Intergenic
909411747 1:75361181-75361203 TTACCAGTTTAACAGTTTTTTGG + Intronic
910212727 1:84810144-84810166 TTTCCAATTTAACACATTTCTGG + Intergenic
910442913 1:87271201-87271223 TATTCTTTTGAACACTTCTTTGG - Intergenic
911389475 1:97220940-97220962 AATCCATTTGATCACATTTTTGG - Intronic
912116645 1:106415839-106415861 TTTCTACTTGGACACTTTATAGG - Intergenic
913016125 1:114737213-114737235 GTTCCTTTTAATCACTTTTTTGG - Intronic
913153462 1:116069026-116069048 GTTCCATTTGAAGACTAATTGGG + Exonic
915871774 1:159568549-159568571 TTGCCATGTGAATACTTCTTTGG - Intergenic
917654848 1:177115923-177115945 TTTTCCATTGAACACTTTATTGG + Intronic
917728697 1:177852643-177852665 TGTCAAATTAAACACTTTTTTGG + Intergenic
918060688 1:181058779-181058801 TATCCATCTGATCACTTTGTGGG - Exonic
918944641 1:191047824-191047846 TTTTCATTTCAATAGTTTTTGGG + Intergenic
918950539 1:191130783-191130805 TGGCTATTTGAGCACTTTTTTGG - Intergenic
919429804 1:197478413-197478435 TTGCCATTGGGTCACTTTTTTGG - Exonic
919563420 1:199153363-199153385 TTTTCATTCGAATAATTTTTTGG + Intergenic
920961484 1:210667843-210667865 TTACCATTTTAACCATTTTTAGG + Intronic
921381390 1:214528330-214528352 TTTCCATTTGTTGACTATTTGGG - Intronic
921565138 1:216708428-216708450 TCTACATTTGGACACATTTTTGG + Intronic
922167231 1:223126454-223126476 TGTCCATTTTAATAATTTTTAGG - Intronic
922194001 1:223344061-223344083 ATTCCATTTTAACTGTTTTTGGG - Intronic
923232279 1:231998065-231998087 TTTCCATTTGACTCCTTTTTAGG - Intronic
923239493 1:232068663-232068685 TTTTTATTTCAACAGTTTTTGGG + Intergenic
924762774 1:247004695-247004717 TTTCAGTTTGAATAGTTTTTTGG - Intronic
1062843431 10:688392-688414 TTTCCTTTTTAACACTTTCAGGG - Intronic
1063123059 10:3118171-3118193 TTTCCATTTAAACAATTATTGGG + Intronic
1063195948 10:3743691-3743713 ATTGCATTTGAACACTTGATTGG - Intergenic
1063642014 10:7839355-7839377 TCTCCATTTCACCATTTTTTTGG + Intronic
1064522758 10:16220658-16220680 TTTCTATTTGATTACTTTTGGGG + Intergenic
1064620813 10:17215288-17215310 TTGGCATCTGAACAATTTTTTGG - Intergenic
1064691758 10:17925899-17925921 TATTCATTTGCACATTTTTTAGG - Intergenic
1065166968 10:22990004-22990026 TTTCTAATTGAACATTTTATGGG - Intronic
1067708773 10:48631978-48632000 TTTCTATTTCAATACTTTTGGGG + Intronic
1068418190 10:56753221-56753243 TTTCTATTTAAAAATTTTTTAGG - Intergenic
1068432467 10:56950348-56950370 TTTCCATTCTATCAATTTTTTGG + Intergenic
1069603627 10:69725819-69725841 TTACCATTTTAATAATTTTTAGG + Intergenic
1070426175 10:76289843-76289865 TTTAGGTTTGGACACTTTTTGGG + Intronic
1070796026 10:79216768-79216790 TTTCATTTTAAACAATTTTTGGG - Intronic
1071195033 10:83148859-83148881 TGTCTATTTGCACTCTTTTTTGG - Intergenic
1072250229 10:93576095-93576117 TTTCGATTTGCACACTGATTTGG + Exonic
1072904154 10:99435514-99435536 TTTCCATTTGAAAAATATTTCGG - Intergenic
1073364139 10:102923688-102923710 TTGCCATTAAAACAGTTTTTTGG + Intronic
1073496009 10:103891560-103891582 TCTCAATCTGAACACTATTTGGG - Intronic
1074248447 10:111718092-111718114 TTGCCATTTGGGCTCTTTTTTGG - Intergenic
1074353362 10:112759293-112759315 TTTCCATCTGAAGACCTTTGGGG - Intronic
1074939936 10:118225000-118225022 GTTTCACTTGAACATTTTTTTGG - Intergenic
1075168742 10:120093400-120093422 TTACCATTTTAACTATTTTTAGG + Intergenic
1075647577 10:124106657-124106679 TTTCCATTTTCACCCTATTTTGG + Intergenic
1075955450 10:126519417-126519439 TTGCCATTTGCACATTTCTTGGG - Intronic
1076006816 10:126954445-126954467 TTCCCATTTGAACCATTTTTAGG + Intronic
1077571768 11:3345653-3345675 TTTCCATTTGGACAATTATAAGG + Intronic
1077596918 11:3540975-3540997 TATCCATTTTAAGAGTTTTTTGG - Intergenic
1078647594 11:13156000-13156022 TGGCTATTTGGACACTTTTTTGG + Intergenic
1078798467 11:14618052-14618074 TTCCCATTTGACCGCTTTTATGG + Intronic
1078905353 11:15682441-15682463 TTTCCTTTTAAAAGCTTTTTTGG - Intergenic
1079044352 11:17086403-17086425 TCTCTATTTGAACATTTTTAGGG + Intronic
1079325399 11:19486871-19486893 TATCCATTGGAACACCTTCTGGG + Intronic
1079555238 11:21752323-21752345 TTTCCATTTTCACCCTTCTTGGG - Intergenic
1079928674 11:26529908-26529930 ATACCATTTGGACACTGTTTGGG - Intronic
1080339604 11:31245816-31245838 TTAACATTTGAACTCATTTTTGG - Intronic
1080480501 11:32644501-32644523 TTACCATTTTAACCATTTTTAGG + Intronic
1081275730 11:41147036-41147058 TTTCCATTAGGACAATTATTAGG - Intronic
1081329083 11:41782272-41782294 TTTCTATGTGAACACATCTTTGG - Intergenic
1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG + Intergenic
1082706607 11:56500348-56500370 TTTTCTTTTGAACAGTTCTTTGG + Intergenic
1082732096 11:56811517-56811539 TGGCCATTTGAGCTCTTTTTTGG + Intergenic
1083512369 11:63222499-63222521 TATCAATTTGAATAGTTTTTTGG + Intronic
1084252840 11:67914929-67914951 TATCCATTTAAAGAGTTTTTTGG - Intergenic
1084820025 11:71681095-71681117 TATCCATTTAAAGAGTTTTTTGG + Intergenic
1085578669 11:77630620-77630642 TTTGCATTTGACCACATTTGAGG - Intronic
1086126535 11:83354616-83354638 TGTTCATTATAACACTTTTTGGG - Intergenic
1086285904 11:85250816-85250838 TGACCATTTGAAGACATTTTAGG - Intronic
1086622948 11:88909939-88909961 TTTCCATCTGAACCATTTTAAGG + Intronic
1086956729 11:92941468-92941490 TTTCCATTTGGGCAGGTTTTGGG + Intergenic
1087040151 11:93791264-93791286 TTTCTATTTCAAAACCTTTTAGG + Intronic
1087406532 11:97738095-97738117 TTTCCATTTCAATAGGTTTTTGG + Intergenic
1088142416 11:106633464-106633486 TTTCCATGTCAAGACTTTCTGGG + Intergenic
1088431281 11:109761589-109761611 TTGCCATTTGGGCTCTTTTTTGG + Intergenic
1088437628 11:109832842-109832864 TTTCCATCTGAGTACATTTTGGG - Intergenic
1088540641 11:110910273-110910295 TTTCAAATTAACCACTTTTTAGG + Intergenic
1089029424 11:115309275-115309297 TTTCCTTTTCTAAACTTTTTTGG - Intronic
1090166748 11:124557184-124557206 TTTCTCTTTAAACACTTGTTTGG - Intergenic
1090218770 11:124996561-124996583 TTCCCATTTTAATCCTTTTTAGG + Intronic
1090440264 11:126719535-126719557 TTTCCATTTGAACATCTCTTAGG + Intronic
1091252963 11:134159299-134159321 TCTCCATTTTAACACTTTATTGG + Intronic
1091416669 12:293431-293453 TTACCATTTTAACCCTTTTTAGG - Intronic
1091430755 12:432135-432157 TTTCTATTTGAACATTCTTAAGG + Intronic
1091611068 12:2010114-2010136 TTTTGATTTGAACACTAATTGGG - Intronic
1092423086 12:8349734-8349756 TATCCATTTTAAGAGTTTTTTGG - Intergenic
1092505336 12:9092708-9092730 TTTCCATTTTAAAATTTTTGAGG - Intronic
1092611066 12:10173887-10173909 TTACCATTTCAACCATTTTTAGG + Intronic
1093155343 12:15677412-15677434 TTTTCATGAGAACACTTTTCAGG - Intronic
1093265319 12:16996752-16996774 CTTCCATTTGAACTTCTTTTGGG - Intergenic
1093783527 12:23165718-23165740 TTTCTATTTTAATAATTTTTTGG + Intergenic
1093854817 12:24088751-24088773 TTTCCAATTCAACACATTTGAGG + Intergenic
1094690100 12:32760366-32760388 TTTACATTTTAATACATTTTAGG - Intergenic
1095805620 12:46316715-46316737 TTACCATTTTAACAATTTTTAGG - Intergenic
1096164371 12:49409051-49409073 TTGACATTTGAATACATTTTTGG + Intronic
1096925559 12:55140881-55140903 TTGCTATTTGAGCTCTTTTTTGG - Intergenic
1097405174 12:59180346-59180368 TTTCCATTTCAATAGTTTTTGGG - Intergenic
1097603518 12:61724393-61724415 CTTCCATTTCAATACTTTTGGGG + Intronic
1098435395 12:70463517-70463539 TTTCAGTTTGGACACTTTTGGGG - Intergenic
1098523187 12:71456944-71456966 TTTCCATCTGAACAAATTTTAGG - Intronic
1098687491 12:73442391-73442413 TTTTCATTTGAGCTCTGTTTTGG + Intergenic
1098964802 12:76776095-76776117 TTTCCACCTGTACCCTTTTTTGG - Intronic
1099027905 12:77489074-77489096 TTTCCATTAGAAATCATTTTGGG - Intergenic
1099612642 12:84894049-84894071 TTTCCATATCAAAACTTTGTTGG - Intronic
1099648001 12:85384383-85384405 TTTATATTTGAACACTTACTTGG - Intergenic
1099804237 12:87497753-87497775 ATTCCAATAGAATACTTTTTAGG - Intergenic
1100790953 12:98129178-98129200 TTTCCAATTGAAGATGTTTTTGG - Intergenic
1100882993 12:99039138-99039160 TTCCCAGTTGGACACTTTCTAGG + Intronic
1102601124 12:114031388-114031410 TTTCAATTGGAAAACTTCTTTGG + Intergenic
1102778764 12:115544730-115544752 TTTCCATTTTAACATTTCATGGG - Intergenic
1103072130 12:117953423-117953445 TATCAAGTTGAACATTTTTTAGG - Intronic
1103832566 12:123791545-123791567 TTTTCAGTTGAACCTTTTTTTGG + Intronic
1104298846 12:127544165-127544187 TTCCCATTAGAACAGTTTTAAGG + Intergenic
1104362552 12:128147748-128147770 TCTCCATTTTAACACTTCTCTGG - Intergenic
1104392063 12:128399538-128399560 TTTCCATTTCCAAACTGTTTTGG + Intronic
1105249215 13:18681954-18681976 TTTTCATTGGAACAGGTTTTGGG - Intergenic
1105463381 13:20612675-20612697 TTTCTTTTTCAACACTGTTTGGG - Intronic
1105521278 13:21133187-21133209 TTATCATTTTAACAATTTTTTGG + Intergenic
1105629432 13:22147333-22147355 TTTCCATTTCAGCAGTCTTTGGG - Intergenic
1105654166 13:22417140-22417162 TTTCTATTTTAACACTGTATTGG - Intergenic
1106480447 13:30133463-30133485 TTTTCATTTAATCACTTTATTGG + Intergenic
1106535148 13:30633892-30633914 TTTCCATCTTAACACTTATCAGG + Intronic
1108496042 13:51026310-51026332 TCTCCATTTGGACACATTTCTGG - Intergenic
1108616260 13:52135631-52135653 TTTACATTTGAACCATTTTAAGG - Intronic
1108863053 13:54885998-54886020 TTTCCATTTGATCACTATCATGG + Intergenic
1109040187 13:57324464-57324486 TTACTATTTGAGCTCTTTTTTGG - Intergenic
1109042806 13:57361679-57361701 TTTTCATTTCAACAGTTTTGGGG - Intergenic
1109121051 13:58458027-58458049 TGGCTATTTGAGCACTTTTTTGG - Intergenic
1109211756 13:59543545-59543567 TTTTCATTTGAGCACTATTAAGG + Intergenic
1109533926 13:63691165-63691187 TTCCATTATGAACACTTTTTTGG + Intergenic
1109621000 13:64905102-64905124 TTGCTATTTGAGCTCTTTTTTGG - Intergenic
1109988332 13:70019225-70019247 TTTCCATTTGTTCTCTTCTTTGG - Intronic
1111231151 13:85345667-85345689 TTTCCATTTCAAAACCTTCTTGG - Intergenic
1111430417 13:88142742-88142764 TTTCAATTTCAACTCTTATTTGG + Intergenic
1111793933 13:92893591-92893613 TTGCCATTTGAATACATTGTTGG - Intergenic
1111880486 13:93950135-93950157 TTGCCATTTGAACTATTCTTAGG - Intronic
1112472948 13:99705871-99705893 TTAGCATTTGAACCATTTTTAGG - Intronic
1112547449 13:100385236-100385258 TTTCCATTTGAAAAATTATTAGG + Intronic
1112747936 13:102548882-102548904 TTTCCTTTTAAACACTTCTAGGG - Intergenic
1113535942 13:111066403-111066425 TTACCATTTTAACCATTTTTAGG - Intergenic
1114822619 14:26039920-26039942 TCCCCATTTCAACACTTTCTGGG + Intergenic
1114897619 14:27010935-27010957 TTTCCATTTTTAACCTTTTTAGG + Intergenic
1115658961 14:35472372-35472394 TTTTCTTTTGCCCACTTTTTTGG - Intergenic
1116211789 14:41955718-41955740 TTTGAATTGGAACAATTTTTGGG - Intergenic
1116427928 14:44812750-44812772 TTTCCATTTGAATTGTTGTTAGG - Intergenic
1116784793 14:49275806-49275828 TGTCCATGTGGACACTGTTTTGG - Intergenic
1117112250 14:52470350-52470372 TGTACATTTCAACACTTTTCGGG - Intronic
1117259835 14:54020557-54020579 TTTCAATTTCAATAGTTTTTGGG - Intergenic
1117559886 14:56926522-56926544 TTACCATTTTAACTGTTTTTAGG + Intergenic
1117747910 14:58890384-58890406 GCTCCATTTTAACACTTTGTTGG - Intergenic
1118284421 14:64458489-64458511 TTTATATTTCAACACATTTTTGG + Intronic
1118885425 14:69861723-69861745 TTACCATTTTAACCATTTTTAGG + Intronic
1119070157 14:71574738-71574760 TTTATCTTTGAACACTTTATTGG + Intronic
1119104405 14:71910627-71910649 TTCTCATTTGAACACTTGCTGGG - Intergenic
1120050847 14:79864224-79864246 TTTCTATTTGGACAATTTTATGG + Intronic
1120327670 14:83051043-83051065 TTTCTATTGCAACACTGTTTGGG + Intergenic
1120572394 14:86137304-86137326 TATCAGTTTGAAGACTTTTTTGG - Intergenic
1121330507 14:93046637-93046659 TTTCCAGTTGACCACTCATTTGG - Intronic
1125102819 15:35934484-35934506 TTTAAATTTCAACAGTTTTTTGG - Intergenic
1125132555 15:36300744-36300766 TTTCCATTTGCATACTTTTTTGG + Intergenic
1125378319 15:39058252-39058274 TTTTTATTTCAACAGTTTTTGGG - Intergenic
1125885065 15:43222988-43223010 TTTCCATTTAAAAATTTTTAAGG - Intergenic
1126006916 15:44266672-44266694 TTACCATTTTAACCATTTTTAGG - Intergenic
1126528393 15:49684632-49684654 TTTCCAAAGCAACACTTTTTTGG - Intergenic
1126746936 15:51835668-51835690 TTTGCCTTGGAACAATTTTTAGG + Intronic
1127014986 15:54674476-54674498 TTTTCATTTTAACAGGTTTTTGG - Intergenic
1127220595 15:56876408-56876430 TTACCATTTTAACCATTTTTTGG - Intronic
1127954430 15:63840883-63840905 TTGACATTTAAACACTTTTTTGG - Intergenic
1129818406 15:78576863-78576885 ATTCAAAATGAACACTTTTTTGG - Intronic
1130793649 15:87184724-87184746 TTTCCTTTTTTACACTTATTTGG - Intergenic
1131142693 15:89990456-89990478 TTTCTAAATTAACACTTTTTTGG + Intergenic
1131282224 15:91031334-91031356 TTTTGATTTGGACACATTTTTGG - Intergenic
1131330744 15:91497094-91497116 TCTCCAGTTGAAATCTTTTTGGG + Intergenic
1131452427 15:92555087-92555109 TTTCTTTTTCAACACTGTTTTGG - Intergenic
1132001352 15:98183586-98183608 TTTGTATTTGAACACTTTCATGG - Intergenic
1132410358 15:101573297-101573319 TTCCCCTCTGGACACTTTTTAGG - Intergenic
1133331090 16:4974575-4974597 TTTTTATTTAAACAGTTTTTGGG + Intronic
1133900311 16:9967872-9967894 TTTCTATTTCAATAGTTTTTGGG - Intronic
1135028724 16:19019190-19019212 TTTCCATTTTAGCAGTTTTGGGG - Intronic
1135273083 16:21085614-21085636 TCTCCAGTTCAAGACTTTTTGGG + Intronic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1137315387 16:47314937-47314959 TTTCCTTTTGAATACATTATTGG - Intronic
1137328477 16:47465568-47465590 TTTCAATGTTGACACTTTTTTGG + Intronic
1137938013 16:52653764-52653786 TGTCCATTTTTATACTTTTTTGG + Intergenic
1138119626 16:54388982-54389004 TTTGCATTTGACCACTATATGGG + Intergenic
1139840914 16:69879232-69879254 TTACCATTTAAACCATTTTTAGG + Intronic
1140340385 16:74153270-74153292 TTTCTATTTCAATATTTTTTGGG - Intergenic
1142331330 16:89455884-89455906 TTTCCATTTGAACACTTTTTGGG - Intronic
1144312888 17:14029744-14029766 TTTCCCTTTTAACAAATTTTTGG - Intergenic
1144331866 17:14231583-14231605 TTTCCCTTTTAACAAATTTTTGG + Intergenic
1145414077 17:22699144-22699166 TTTGCTTTTGAGCTCTTTTTGGG + Intergenic
1147409829 17:40242115-40242137 CTTCCATTGAAACAGTTTTTTGG + Intronic
1147592510 17:41693653-41693675 TTGCCAATTGAACAGTTATTGGG - Intergenic
1148010477 17:44476089-44476111 TTACAATTTCAACACTTGTTAGG - Intronic
1148508972 17:48152593-48152615 TTTCCATTTGAATATATTATGGG - Intronic
1148998166 17:51730403-51730425 ATTCCTTTTCTACACTTTTTGGG + Intronic
1150287256 17:63961361-63961383 GTTCCATATGAGCACTTTGTGGG + Exonic
1150895481 17:69205340-69205362 TTTCCATTTGAACTTTATTCAGG - Intronic
1151396847 17:73828444-73828466 TTACCATTTGAGCCCTTTTAAGG + Intergenic
1152484033 17:80577872-80577894 TGTCAGTTTGAACACTTCTTAGG + Intronic
1152679976 17:81662307-81662329 TTTTTATTTCAATACTTTTTGGG - Intronic
1153169125 18:2294449-2294471 TGGCTATTTGAACTCTTTTTTGG + Intergenic
1153873833 18:9347104-9347126 TTGCCATTTGTATACCTTTTTGG + Intronic
1154439672 18:14377276-14377298 TTTTCATTGGAACAGGTTTTGGG + Intergenic
1155061193 18:22230419-22230441 TTACCATTTTAACCATTTTTAGG + Intergenic
1155812058 18:30249366-30249388 TTTCCATTTTCACAATTTTATGG - Intergenic
1156329405 18:36105369-36105391 TTACCATTTTAGCAATTTTTAGG - Intergenic
1156476302 18:37407863-37407885 TTTCCATTAGCTCAATTTTTGGG + Intronic
1156542384 18:37927366-37927388 TCTACATTTAAATACTTTTTGGG + Intergenic
1156786048 18:40916709-40916731 TTTACATTTTAAGACTTCTTGGG + Intergenic
1156842338 18:41624073-41624095 CTTCCAGTTGAATATTTTTTTGG - Intergenic
1157261883 18:46182702-46182724 TTTGCATTTGATAACTTCTTTGG + Intronic
1158013077 18:52751128-52751150 TTTCATTTTGAACAATCTTTGGG - Intronic
1158283903 18:55857438-55857460 TATCCCTTTGAGCACTTTTGTGG + Intergenic
1158338042 18:56434741-56434763 TTTCTATTTCAATACCTTTTGGG + Intergenic
1159484139 18:69031625-69031647 TTTCTTTTTCAAAACTTTTTTGG + Intronic
1163071906 19:14850150-14850172 TCTGCATATGAACACTTTGTTGG + Intergenic
1164055402 19:21617940-21617962 TTTCCCTTTGAAAACTTGATGGG + Intergenic
1164095801 19:22009038-22009060 TTTCCCTTTGGAAACTTTATAGG - Intronic
1164199030 19:23001606-23001628 TTTCCCTTTGGAAACTTTATAGG - Intronic
1164272492 19:23685502-23685524 TTTCCCTTTGGAAACTTTATGGG - Intronic
1164545818 19:29161800-29161822 TTTTCATTTCAATAGTTTTTGGG - Intergenic
1164784243 19:30917147-30917169 CTTCCAGTGGAACACTGTTTTGG - Intergenic
1164879833 19:31722896-31722918 TTTTCATTTCAATAGTTTTTGGG - Intergenic
1166186818 19:41145137-41145159 TTTTCATTTCAATATTTTTTGGG + Intergenic
1166804313 19:45476138-45476160 TTTCCATATGACCACTATTGGGG + Intronic
925530315 2:4852479-4852501 TTTCCATCTGAATATTTTCTTGG - Intergenic
925540001 2:4956614-4956636 TTACCATTTTAACCATTTTTAGG - Intergenic
925698508 2:6609052-6609074 TATCGATTTTAACAGTTTTTTGG + Intergenic
926628523 2:15116205-15116227 TTTCCTTTTGAACTCTTGCTGGG - Intergenic
926665431 2:15516812-15516834 TTTCCTTTTGAACTGGTTTTGGG - Intronic
926997891 2:18758153-18758175 ATATCATTTGAACACATTTTTGG + Intergenic
927237029 2:20883873-20883895 TTACCATTTTAACCATTTTTAGG + Intergenic
928119640 2:28574198-28574220 TTTTTATTTCAACACTTTTTGGG + Intronic
929058429 2:37899408-37899430 TTTCCATTTTAACAAGTTTGGGG - Intergenic
930287697 2:49452755-49452777 TTTATATTTGATCACTTTCTGGG - Intergenic
930772595 2:55142926-55142948 TTTCCATTTGATCATCTGTTAGG - Intergenic
932263778 2:70348587-70348609 TTGTCATCTGAAGACTTTTTTGG - Intergenic
932484054 2:72070486-72070508 TTTGCATCTGAATATTTTTTTGG - Intergenic
932638840 2:73420694-73420716 TTTACATTAGAAAACATTTTAGG - Intronic
932707716 2:74039477-74039499 TTTTCATCTTAAAACTTTTTGGG + Intronic
933706747 2:85296997-85297019 TTGCAATTTGAACTGTTTTTAGG - Intronic
933858781 2:86443319-86443341 TGTTCATTTGAACACTTTCAGGG + Intronic
935154155 2:100467381-100467403 TATACATTTGACCAATTTTTTGG - Intergenic
935470194 2:103450195-103450217 ATAACATCTGAACACTTTTTTGG + Intergenic
935548763 2:104429801-104429823 TCTCCATTTTAACACTTTTCAGG - Intergenic
935851761 2:107229372-107229394 TTTTTATTTCAACAGTTTTTGGG + Intergenic
936481756 2:112891235-112891257 TTTACATTTTAACATTTCTTAGG + Intergenic
936725860 2:115314458-115314480 ATTCCTTTAGTACACTTTTTAGG + Intronic
936737961 2:115469268-115469290 TTTCAGTTTGAATACTTCTTTGG - Intronic
937171109 2:119869898-119869920 TTTCCTCTTCAACACCTTTTTGG - Intronic
937424643 2:121788591-121788613 TTTACATTTGTATGCTTTTTTGG + Intergenic
937611100 2:123862596-123862618 TGCCCATTTAAATACTTTTTTGG - Intergenic
938681099 2:133690826-133690848 ATGCCATTCCAACACTTTTTAGG - Intergenic
938998520 2:136706577-136706599 TTTCCTTTTTACCACTTCTTAGG + Intergenic
939537944 2:143455801-143455823 TTTCCTTTTAAACACTTTGGTGG - Intronic
939631769 2:144534294-144534316 TTTTCATTTCAATAGTTTTTGGG + Intergenic
939764292 2:146226978-146227000 TTTCCATTTTATCAGTCTTTGGG - Intergenic
940431539 2:153596509-153596531 TTTCCATTTAAAGACTTTTTTGG - Intergenic
941191323 2:162386607-162386629 TTTTCATTTCTACACTTTTGTGG + Intronic
941293438 2:163704816-163704838 ATTCCATTTGAACACTTAGTTGG - Intronic
942607250 2:177705594-177705616 TTTACATTTGCACACATTTTTGG - Intronic
942660709 2:178261814-178261836 TCTCACTTTGAACACTTTCTTGG + Intronic
943095728 2:183427057-183427079 TTTACACTAGAACACTTTTATGG + Intergenic
943530117 2:189068883-189068905 TTTCCCTTTGCACCCTTTTAGGG - Exonic
943923760 2:193744264-193744286 TTTCCTTTTTAACACTTCCTTGG - Intergenic
944229883 2:197381899-197381921 TTTCCCTTTGAACAGGGTTTTGG + Intergenic
944665856 2:201958699-201958721 TTACCAATTTATCACTTTTTGGG + Intergenic
944748960 2:202688148-202688170 TTTGTATTTGAAGCCTTTTTTGG + Intronic
945138741 2:206660624-206660646 TTTCCATCTAAACATTTTTGGGG - Intronic
946803013 2:223441539-223441561 ATTCTATTTTAACACTTTTATGG - Intergenic
947072037 2:226299451-226299473 TTTCAATTTGAACTCTTAGTTGG - Intergenic
947284719 2:228501058-228501080 ATTCCATTTGAATTATTTTTAGG + Intergenic
947660852 2:231866414-231866436 TTTCCGTTTTAACAATATTTAGG - Intergenic
948399865 2:237675992-237676014 TTACCATTTTAACCATTTTTAGG + Intronic
948959137 2:241317921-241317943 TTTTCATTTGACTACATTTTTGG + Intronic
1169243999 20:4010759-4010781 TTTCCTTGTGACCACTGTTTAGG - Intronic
1169704841 20:8491451-8491473 TTTACATTAGACCACTTTTCTGG + Intronic
1169952876 20:11066017-11066039 TTTTCATATGAAGACTTATTTGG + Intergenic
1170810223 20:19668523-19668545 TTTCCTTTTGAAGATTTTTTGGG - Intronic
1170912603 20:20589145-20589167 TTTCCATTTAGACAGTTTATAGG - Intronic
1171127678 20:22617974-22617996 TTTGCATTTGAACAGTGGTTTGG - Intergenic
1173187609 20:40853023-40853045 TTTCCATTTAAACAAGTTTGTGG - Intergenic
1173566369 20:44041261-44041283 TTCCCATTTGGCCACTTTTCTGG + Intronic
1174834827 20:53847017-53847039 TTTTCAGTTCATCACTTTTTAGG - Intergenic
1174849685 20:53980546-53980568 TTTCCATTTGAATACTAGCTTGG - Intronic
1175194769 20:57235436-57235458 TTTCCATGTCAACAATTTTGGGG + Intronic
1175690675 20:61063820-61063842 TTTTTATTTAAACAGTTTTTAGG + Intergenic
1176456069 21:6912465-6912487 TTTTCATTGGAACAGGTTTTGGG - Intergenic
1176834242 21:13777513-13777535 TTTTCATTGGAACAGGTTTTGGG - Intergenic
1177377263 21:20289080-20289102 TTACCATTTAAACATTTTGTGGG + Intergenic
1177873665 21:26604535-26604557 TTTTTATTTCAACACTTTTAAGG + Intergenic
1177882582 21:26711633-26711655 TTTACATTTCAATACCTTTTTGG + Intergenic
1178432491 21:32528906-32528928 TTTTTATTTCAACAGTTTTTGGG - Intergenic
1181278325 22:21701263-21701285 TTTCAATTTCATCACTCTTTTGG + Intronic
1182864607 22:33592734-33592756 ATTCATTTTGATCACTTTTTTGG + Intronic
1184542848 22:45140983-45141005 TCACCATTTTAACACATTTTTGG - Intergenic
1184631268 22:45781995-45782017 TATTCTTTTGAATACTTTTTCGG - Intronic
1185263125 22:49881943-49881965 TTAACCTTGGAACACTTTTTAGG + Intronic
949601946 3:5609467-5609489 TTTCTAATTTAATACTTTTTTGG - Intergenic
949795462 3:7845425-7845447 TTTCCTTTTGAAAACATTTGTGG - Intergenic
950823474 3:15789127-15789149 TTGCTATTTCAACAGTTTTTAGG + Intronic
950841497 3:15972722-15972744 TTTCCATTTCAATAGGTTTTTGG - Intergenic
951430431 3:22600651-22600673 TTTCTATTTCAACATTGTTTTGG - Intergenic
951678564 3:25270450-25270472 TTACCATTTTAACAATTTTTAGG - Intronic
953493931 3:43370670-43370692 TCTCCATTTTGATACTTTTTTGG - Intronic
953757254 3:45657345-45657367 TTTTCATTCAAACACTTTCTAGG - Intronic
953802509 3:46035988-46036010 TTTCAATTTGGACACTCTTGGGG + Intergenic
955417366 3:58705025-58705047 TTTTCATTGCAACACGTTTTTGG - Intergenic
955546775 3:60039683-60039705 TCACCATGTGAACACTTTATAGG - Intronic
957465698 3:80587928-80587950 TTTCTCTTTGGAAACTTTTTGGG + Intergenic
957506795 3:81131767-81131789 TTTCTATTTGCACACATTTATGG - Intergenic
957636968 3:82798876-82798898 ATTAGATTTGAACATTTTTTTGG - Intergenic
958050981 3:88345799-88345821 CTTTCATTTGAACACTTTAGAGG - Intergenic
958196333 3:90246049-90246071 TTTTCATTTCAACAGGTTTTTGG + Intergenic
958521804 3:95199481-95199503 CTTCAATTTGGTCACTTTTTAGG - Intergenic
958784748 3:98585678-98585700 TTTCCATTTGATCCCTGGTTTGG - Intronic
959360177 3:105379312-105379334 GTTCCATCTGAATACATTTTGGG + Intronic
959446872 3:106451347-106451369 TTTCCTTTTGTATATTTTTTTGG + Intergenic
959527914 3:107398244-107398266 TTTTAATTTAGACACTTTTTGGG - Intergenic
959814062 3:110654427-110654449 TTTTGATTTGATGACTTTTTTGG - Intergenic
960310659 3:116112629-116112651 TTTCCAATTGCACACTTCCTAGG - Intronic
960857066 3:122112847-122112869 TTTTTATTTGAATAGTTTTTTGG + Intronic
961900513 3:130206291-130206313 TATCCATTTTAAGAGTTTTTTGG - Intergenic
962657141 3:137558681-137558703 TTGCTATTTGACCTCTTTTTTGG - Intergenic
962861089 3:139402481-139402503 TTTCTATTTCAAAAGTTTTTGGG + Intergenic
963243937 3:143042457-143042479 TTTTCATTTTAAAAGTTTTTGGG + Intronic
963317369 3:143773987-143774009 TTTGCATTTGAAAAACTTTTAGG - Intronic
963466078 3:145684860-145684882 TGTACCTTTGAACACTTTTGGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963963078 3:151332183-151332205 TTTCCATTTGTAGTCTTATTTGG + Intronic
964022850 3:152035050-152035072 TTTCCTTTTTAAAAATTTTTTGG + Intergenic
964188577 3:153976677-153976699 TTTCCATTTGGAAAATATTTTGG + Intergenic
965907530 3:173727557-173727579 TTTCCAAATGAACATTCTTTTGG + Intronic
967569968 3:191016891-191016913 TTACCATTTAAATACATTTTGGG - Intergenic
967570079 3:191018138-191018160 TTTCTATTTCAATAGTTTTTGGG + Intergenic
967628975 3:191720830-191720852 TTTCCATTTTAAAACTATCTAGG - Intergenic
967642365 3:191880793-191880815 TTTACATTTGAGCAGGTTTTAGG + Intergenic
967649700 3:191971786-191971808 TTTTCATTTGAATAGTTTTAAGG - Intergenic
967927244 3:194660694-194660716 TTGCCATTTAAACACATTGTTGG - Intronic
968019403 3:195371035-195371057 TGGCTATTCGAACACTTTTTTGG + Intronic
968256802 3:197281558-197281580 TTTCCATTTCCATACTCTTTGGG - Intronic
969489207 4:7489588-7489610 TTTGCATTAGAACACTGTCTGGG - Intronic
969889275 4:10244561-10244583 ATTCGATTTGGAGACTTTTTTGG - Intergenic
969918279 4:10511375-10511397 TTACCATTTTAACCATTTTTAGG + Intronic
970959843 4:21858771-21858793 TTTCCTTTTTAACAGTATTTAGG + Intronic
971212567 4:24633438-24633460 TTTCAATTAAAACAATTTTTTGG + Intergenic
971445516 4:26742425-26742447 TTTCCATTTGAATAATTTGTTGG + Intronic
971977850 4:33713831-33713853 TTTTCATATGAACACTTCATAGG + Intergenic
973108900 4:46376545-46376567 TTTTCATCTGAAAACATTTTTGG - Intronic
974133278 4:57783338-57783360 TTTCTATTTCAAGAGTTTTTGGG + Intergenic
974149214 4:57984168-57984190 TTTCCATTTAAAGATTTTTTTGG - Intergenic
974163325 4:58168338-58168360 TTTGACTTTTAACACTTTTTGGG - Intergenic
974745402 4:66067792-66067814 TTTTCATTTCAGCACTTATTAGG + Intergenic
975264336 4:72343894-72343916 TTTCTTTTTTAAAACTTTTTAGG + Intronic
975875587 4:78832723-78832745 TGTGCTTTTGAACATTTTTTAGG + Intronic
976252227 4:83064371-83064393 TTACCATTTTAACCATTTTTGGG + Intronic
976443389 4:85102957-85102979 TTTACATTAAAACATTTTTTGGG + Intergenic
976540046 4:86263670-86263692 TTTCAATTTGACCACTTTACTGG + Intronic
976676396 4:87708305-87708327 CTCCAATTTGAACACTTGTTAGG - Intergenic
976687642 4:87832664-87832686 TTTCCATTTCTAAACTTGTTAGG + Intronic
976889402 4:90028235-90028257 TTTTCATTTGACCATTGTTTAGG - Intergenic
976973921 4:91142951-91142973 TGGCTATTTGAACTCTTTTTTGG + Intronic
977689056 4:99883196-99883218 CTTCCATTTCAAAACATTTTAGG - Intronic
977933175 4:102770535-102770557 TTTTTATTTCAATACTTTTTGGG - Intergenic
978118763 4:105052783-105052805 TTTCCCTCTTAACACTGTTTTGG - Intergenic
978629001 4:110721154-110721176 TTTCAATTTCAATAGTTTTTGGG + Intergenic
978694392 4:111559368-111559390 TTTCCCTCTAAACACTGTTTTGG + Intergenic
978703642 4:111678776-111678798 TTTCTATTACAACACTTTTGGGG + Intergenic
979172351 4:117617240-117617262 TTTCAGTTTCAACAGTTTTTTGG - Intergenic
979736267 4:124089652-124089674 TTTGGATTTGATCACTTTATTGG - Intergenic
979862334 4:125708840-125708862 TTTCAATTTAAACAAATTTTAGG - Intergenic
979984977 4:127302510-127302532 TTTTCATTTCAATAGTTTTTTGG - Intergenic
980476756 4:133328164-133328186 TTTCTATTTCAATAGTTTTTGGG - Intergenic
980700355 4:136419562-136419584 TTTACACTTGAAGACATTTTTGG + Intergenic
980725117 4:136749059-136749081 TTTCCATTAGGACACTCTTGAGG - Intergenic
981529802 4:145741341-145741363 TTTTTATTTTAAAACTTTTTTGG + Intronic
981672486 4:147302677-147302699 TTTCCACTTCATCACTTTGTTGG - Intergenic
982174360 4:152691607-152691629 TTTCCTTTCTTACACTTTTTAGG - Intronic
982743715 4:159084658-159084680 TTTAAATTTAGACACTTTTTTGG + Intergenic
983307589 4:166012461-166012483 TTTCAAATTGAACCTTTTTTTGG + Intronic
983309242 4:166036455-166036477 TTTTCATTTGATCATTCTTTGGG + Intronic
983385072 4:167051056-167051078 TTACCATTTTAACCATTTTTAGG - Intronic
983456122 4:167967510-167967532 TATCCATTCTAACAGTTTTTTGG + Intergenic
984079202 4:175222663-175222685 TTTCCATTGTTACAATTTTTTGG + Intergenic
984103497 4:175515807-175515829 TTGCCATTTTAACACTATTAAGG + Intergenic
984147828 4:176085812-176085834 TTTCCTTTTCTACATTTTTTGGG + Intronic
984729928 4:183058574-183058596 TTACCATTTGAACAATTTTTAGG + Intergenic
984829823 4:183962118-183962140 TTTCTAATTAAACAATTTTTAGG + Intronic
984870872 4:184323947-184323969 TTGCCATTTGAACCACTTTTAGG - Intergenic
985847592 5:2363694-2363716 TTTCTATTTGTTCCCTTTTTGGG + Intergenic
985863726 5:2495303-2495325 TTCCCATCTGCTCACTTTTTAGG + Intergenic
985872083 5:2564990-2565012 TTTCAATTTGAACAGTTTCTTGG - Intergenic
986399149 5:7362609-7362631 TTTGCATTTCAGCACTTATTGGG - Intergenic
987502049 5:18724582-18724604 TTACCATTTGAACAATTTTTAGG + Intergenic
987674336 5:21054990-21055012 TTTTCATTTTAACAATATTTTGG + Intergenic
987860059 5:23473495-23473517 TTTTAATTTTAACACTGTTTTGG - Intergenic
987867172 5:23559368-23559390 TTACCATTTTAACAATTGTTAGG + Intergenic
988069703 5:26272131-26272153 TTTTCATTTGAATTCTTCTTTGG + Intergenic
988984216 5:36601047-36601069 TTCGCATTTGGACATTTTTTTGG - Intergenic
989010096 5:36861283-36861305 TTTTCATTTTAATAATTTTTTGG + Intergenic
990347664 5:54885373-54885395 TTTCAATTTAAAGACTTTTGGGG + Intergenic
990530373 5:56667602-56667624 TTTTCATTTCAATAGTTTTTTGG + Intergenic
990745565 5:58956232-58956254 TTTCCCTTTAAACACTATTTTGG + Intergenic
990965878 5:61447373-61447395 TTTCAGTTTGGACACTTTTGGGG - Intronic
992019544 5:72608203-72608225 TTTCTATTTCAATAGTTTTTGGG - Intergenic
992042576 5:72849301-72849323 TCTCCATTTGAGCACGGTTTAGG - Intronic
992138426 5:73771151-73771173 TTCCCTTTTGATCATTTTTTTGG + Intronic
992344538 5:75863316-75863338 TTTCTATTTCAACAGTTTTTGGG - Intergenic
992512768 5:77455897-77455919 TTTCCATTTTAAGATTGTTTCGG + Intronic
992642268 5:78778449-78778471 TTTCCATTTCTATACTTTATGGG - Exonic
993157100 5:84239865-84239887 TTTCCATTAGAACAAATGTTTGG - Intronic
993380936 5:87207020-87207042 TTTTCATTTCAATAGTTTTTGGG + Intergenic
993382069 5:87219522-87219544 TTTCCATATGAAATCATTTTGGG - Intergenic
993404809 5:87498688-87498710 TTTTCTTTTAAACACTTTTAAGG + Intergenic
993469283 5:88287124-88287146 TCTCCATTTAAGCACTCTTTTGG - Intergenic
994238486 5:97392885-97392907 TTTCTATTGCAACACTTTTTGGG + Intergenic
994846620 5:104996457-104996479 TATCCATCAGTACACTTTTTGGG - Intergenic
994880099 5:105480132-105480154 TATCCATTCTAACAGTTTTTGGG - Intergenic
994929053 5:106156339-106156361 GTTCCTTTTGACCACCTTTTGGG + Intergenic
995220728 5:109644837-109644859 TTTCCCTCTGAACACTTCTTAGG - Intergenic
995293850 5:110494293-110494315 TTTTCATTTGCACATATTTTTGG - Intronic
996095281 5:119392053-119392075 TTTACATTTTTACACATTTTGGG - Intronic
996441561 5:123497005-123497027 TTTCCAATTGAAGGGTTTTTAGG - Intergenic
996464580 5:123784832-123784854 CTTCCATTTGAGGGCTTTTTAGG - Intergenic
996655640 5:125931957-125931979 TTTCCCTATGGACACTTATTTGG - Intergenic
996825916 5:127680717-127680739 TTTACTCTTGTACACTTTTTTGG + Intergenic
996850613 5:127947456-127947478 TATCTATTTGAGCTCTTTTTTGG + Intergenic
997708884 5:135986374-135986396 TTTCCATTTGATTCTTTTTTGGG + Intergenic
999116169 5:149165340-149165362 TTTTTATTGGAACACATTTTTGG + Intronic
999541598 5:152580581-152580603 TTGCTATTTGGACTCTTTTTTGG + Intergenic
999676980 5:154014481-154014503 TTTCCACTTCCACACTATTTGGG - Intronic
1000412997 5:160953612-160953634 TTTCCATCTGAAGCTTTTTTTGG - Intergenic
1000460057 5:161504544-161504566 TTTCCTTCTGAACAGTTTTTTGG - Intronic
1001886548 5:175296095-175296117 CTTCCATTTTAACACTGCTTTGG - Intergenic
1001975989 5:175999107-175999129 TTTCCATTTGCACATATATTAGG - Intronic
1001979338 5:176028157-176028179 TTTTTATTTCAACAGTTTTTGGG - Intronic
1002238078 5:177815604-177815626 TTTTTATTTCAACAGTTTTTGGG + Intergenic
1002439140 5:179255364-179255386 TTGCCATTTATACACATTTTTGG + Intronic
1003208208 6:4034631-4034653 TTTCGATTAAAACAATTTTTGGG - Intronic
1004084909 6:12437316-12437338 ATTCCATTTCAACATTTGTTTGG + Intergenic
1004957674 6:20748135-20748157 TTTCCTTTTCAAGACTGTTTTGG - Intronic
1005123951 6:22424173-22424195 CTCCCATTTGCACACATTTTTGG - Intergenic
1006840221 6:37023645-37023667 ATTGCAGTTGAACACATTTTGGG - Intronic
1007863370 6:44938545-44938567 TGCCTATTTGAGCACTTTTTTGG + Intronic
1008271233 6:49492890-49492912 GTTCCTTTTTAATACTTTTTGGG - Exonic
1008642542 6:53479492-53479514 TTTCCATTTTAATTTTTTTTGGG + Intergenic
1009042594 6:58197599-58197621 TTTCCATTTTAGCAATTTTTAGG + Intergenic
1009218431 6:60951829-60951851 TTTCCATTTTAGCAATTTTTAGG + Intergenic
1009493622 6:64323906-64323928 TTTACATTTGAACATTCTTTGGG + Intronic
1009497622 6:64371163-64371185 TTTCCCTTGGAACACTGCTTTGG + Intronic
1009700424 6:67170749-67170771 TTGCTATTTGAGCTCTTTTTTGG - Intergenic
1010053792 6:71539874-71539896 TTTTCATTTCAATAGTTTTTGGG - Intergenic
1010261820 6:73825636-73825658 CTATCATTTGAATACTTTTTTGG + Exonic
1010457082 6:76068923-76068945 TTTCTATATGAGCTCTTTTTTGG - Intronic
1010701219 6:79049939-79049961 TTTTCATTAAAACACTTTTGTGG - Intronic
1011436259 6:87340828-87340850 TTTCCATTTTAGCTATTTTTGGG + Exonic
1012222230 6:96662632-96662654 TGTCTATTTGAGCTCTTTTTTGG - Intergenic
1012686230 6:102253426-102253448 TCTCCCTTTGAACAGTTTTCTGG + Intergenic
1012796831 6:103772571-103772593 TTTAAATGTGAACACTATTTAGG - Intergenic
1013037380 6:106399485-106399507 TATCCATTTGAACAACTTTCTGG + Intergenic
1013573499 6:111454411-111454433 TTACCATCTTAACCCTTTTTGGG + Intronic
1013684584 6:112564743-112564765 TTTGGATTTGAACACTTTCTGGG - Intergenic
1013808753 6:114020745-114020767 TTTGCATTTGTACATTTTTTTGG - Intergenic
1014096610 6:117468325-117468347 TTTTAATTTGAATAGTTTTTGGG + Intronic
1015048457 6:128809284-128809306 TTTTTATTTCAACAGTTTTTGGG + Intergenic
1015088448 6:129325472-129325494 TTTCAATTTAAATAATTTTTAGG - Intronic
1015143983 6:129965341-129965363 TTACCATTTTAACCATTTTTAGG - Intergenic
1015335598 6:132034300-132034322 GTTCCATTTCATCACTCTTTAGG + Intergenic
1015923629 6:138289448-138289470 CTTCCATTTGACCAATTTTTGGG + Intronic
1016410680 6:143779976-143779998 TTTCTATTTTATCAGTTTTTAGG - Intronic
1016473742 6:144403335-144403357 TTTCCGTTTAAACATATTTTAGG - Intronic
1017250420 6:152274499-152274521 TTTCAATTTGGTTACTTTTTTGG + Intronic
1017451171 6:154555661-154555683 GTTCCAGGAGAACACTTTTTGGG - Intergenic
1017673058 6:156785570-156785592 TTACCATTTGAACCATTTTTAGG + Intronic
1017963234 6:159240310-159240332 TATCCATTGGAACACACTTTGGG - Intronic
1018858924 6:167696835-167696857 TTTCCATTTCTCCACTGTTTAGG + Intergenic
1019103919 6:169653391-169653413 TTGCCATTTTAACCATTTTTAGG - Intronic
1019388140 7:770250-770272 TTTCCATATGAAAACCTATTTGG - Intronic
1019700089 7:2470643-2470665 ATTCCACTTGAACTCTTTTTAGG - Intergenic
1019833353 7:3356233-3356255 TTTAGATTTGACCTCTTTTTTGG + Intronic
1020685434 7:11287949-11287971 TTTCCAGTTGATCCATTTTTTGG - Intergenic
1020771163 7:12397089-12397111 TTGCTATTGGGACACTTTTTTGG - Intronic
1021300778 7:18970577-18970599 TTTGCATTTAAACAATGTTTTGG + Intronic
1021363019 7:19740442-19740464 TTTACATTTGAACCATTTTTAGG + Intronic
1021428135 7:20527045-20527067 TTTCCTTTTGATTTCTTTTTTGG - Intergenic
1021975058 7:26003886-26003908 TTACCATTTTAACCATTTTTAGG - Intergenic
1022144992 7:27528271-27528293 TTTTCATTTGAACACTTAAGAGG - Intronic
1022613463 7:31901946-31901968 TTTCCATTTGGAAAATATTTTGG - Intronic
1022891411 7:34703735-34703757 TTTCCATTCTAACAATTTTCTGG + Intronic
1022959566 7:35413595-35413617 TTTCCATCTGCACAATGTTTAGG - Intergenic
1023006931 7:35880407-35880429 TTTTATTTTGAAAACTTTTTTGG + Intronic
1023278279 7:38543771-38543793 TTTCCCATGGAACACATTTTGGG - Intronic
1024833279 7:53486663-53486685 TTTTTATTTCAACAGTTTTTTGG + Intergenic
1025775991 7:64561415-64561437 TTTCCCTTTGGAAACTTTATGGG - Intronic
1025865285 7:65375201-65375223 TTTCCCTTTGGAAACTTTATGGG + Intronic
1026357422 7:69571017-69571039 TTACAATTTAAACACTTTTCGGG - Intergenic
1026580296 7:71610614-71610636 TTTCCCTTTGGACATTATTTTGG - Intronic
1028096010 7:86761857-86761879 GTTTCATTTGAAGTCTTTTTTGG + Intronic
1028323189 7:89488005-89488027 TTTTCATTTTAACATTTTTAGGG - Intergenic
1028423704 7:90662477-90662499 TTTTCATTTGAATACTTCATTGG + Intronic
1029988025 7:104939595-104939617 TTTTCATTACAACACTTGTTAGG - Intergenic
1031297695 7:120024243-120024265 TTTCATTCTGAGCACTTTTTAGG + Intergenic
1031326957 7:120412834-120412856 CTTCCATTTTAAGATTTTTTAGG + Intronic
1031660788 7:124421623-124421645 TTCCCATTTGAAGGCTTTTCTGG - Intergenic
1031792168 7:126119574-126119596 TGTCTATGTGAACACTTCTTTGG + Intergenic
1032880212 7:136082266-136082288 TTTCCTGTTTAAAACTTTTTTGG + Intergenic
1033225869 7:139561691-139561713 TTTCTTTTTGATCATTTTTTCGG - Exonic
1036059423 8:5299074-5299096 TTTCTTCTTGAACATTTTTTTGG - Intergenic
1036247550 8:7131638-7131660 TTTTCATTTCAATAGTTTTTAGG - Intergenic
1036950070 8:13132376-13132398 TTTCCTTTTCAACCATTTTTGGG - Intronic
1037006862 8:13792331-13792353 TTCGTCTTTGAACACTTTTTAGG + Intergenic
1037465595 8:19156995-19157017 ATTCAATGTGAACAGTTTTTTGG + Intergenic
1038121035 8:24615642-24615664 TTTACATTGGACAACTTTTTTGG + Intergenic
1038650628 8:29399983-29400005 TTTCCTTTTTATCACTATTTGGG - Intergenic
1038884442 8:31647922-31647944 TTACCATTTTAACCATTTTTAGG + Intronic
1039113267 8:34063467-34063489 TTTCTATTTCAATAGTTTTTGGG - Intergenic
1039176858 8:34818211-34818233 TTTCTATTCTCACACTTTTTAGG - Intergenic
1039563802 8:38534841-38534863 TTTCCCTTTCCCCACTTTTTTGG + Intergenic
1039636638 8:39174435-39174457 TGGCTATTTGAACTCTTTTTTGG + Intronic
1040695501 8:49992913-49992935 TTTGCATTTGTTCACTTTCTTGG + Intronic
1041845635 8:62324988-62325010 TTTTTATTTCAATACTTTTTGGG + Intronic
1041992486 8:64010821-64010843 TGTCAATTTGAACAATTTTGTGG + Intergenic
1042900903 8:73726413-73726435 TTTTTATTTCAACAGTTTTTGGG - Intronic
1042966787 8:74362204-74362226 TTTGCATTTCATAACTTTTTTGG - Intronic
1043141512 8:76595534-76595556 TTGCCATTTTAACAATTTTTAGG - Intergenic
1043290756 8:78597153-78597175 TGGCCATTTGGACTCTTTTTTGG + Intronic
1044246219 8:89949795-89949817 CTTTCATTTAAACATTTTTTTGG - Intronic
1045040235 8:98216730-98216752 GTTCCATTTGAATAATCTTTTGG + Intronic
1045720683 8:105106994-105107016 TTTCTATTGGAAAACTGTTTTGG + Intronic
1047573349 8:126126511-126126533 TTTCTTTTTTAACACTGTTTTGG - Intergenic
1048059430 8:130902653-130902675 TTTCCATTTAAAATTTTTTTAGG + Intronic
1049484321 8:142845435-142845457 TTTCCATTTAAAAAGTTTATTGG - Intronic
1049845994 8:144801717-144801739 TTTCTAATTTAACACTTTTTTGG - Intronic
1049920561 9:359769-359791 TTTCCACTTCATCAATTTTTTGG + Intronic
1050464473 9:5907124-5907146 TTGCCATTTTAACCATTTTTAGG - Intronic
1050626977 9:7515118-7515140 TTTACCTTTGATCACTTTATGGG + Intergenic
1051077375 9:13255820-13255842 TTACCATTTCAAAAATTTTTAGG - Intronic
1051717985 9:20005240-20005262 TTTTCATTTGAACAAATTGTTGG + Intergenic
1051882388 9:21852689-21852711 TTTTCATTTCAATAGTTTTTGGG - Intronic
1052070149 9:24071725-24071747 ATTCAATTTGAACTCTTTTTTGG + Intergenic
1052273480 9:26652132-26652154 CTTCCACCTGAGCACTTTTTAGG + Intergenic
1052417538 9:28196841-28196863 TCTCCATTTGAATATTTTTTTGG - Intronic
1053341541 9:37339280-37339302 CTTCCATTTGTACACTGTTCTGG - Intronic
1053525647 9:38827700-38827722 TCTTCATTTGTATACTTTTTTGG + Intergenic
1053728608 9:41029224-41029246 AATCCATTTTAAAACTTTTTTGG + Intergenic
1054197879 9:62052134-62052156 TCTTCATTTGTATACTTTTTTGG + Intergenic
1054640477 9:67536238-67536260 TCTTCATTTGTATACTTTTTTGG - Intergenic
1054699897 9:68402856-68402878 AATCCATTTTAAGACTTTTTTGG - Intronic
1055878211 9:80968431-80968453 TTTACATATACACACTTTTTAGG + Intergenic
1056855691 9:90127658-90127680 TTTCTAATTGATTACTTTTTAGG + Intergenic
1057088433 9:92233758-92233780 TTTACATCTGAATATTTTTTTGG + Intronic
1058051739 9:100413125-100413147 TTACCATTTTAACCATTTTTTGG - Intergenic
1058212665 9:102189822-102189844 TTTCCATTTGCATATTTTCTTGG + Intergenic
1058328020 9:103722518-103722540 TGGCCATTTTAAGACTTTTTTGG - Intergenic
1059012250 9:110474517-110474539 TTGCCATTTGGACCCTTATTAGG + Intronic
1059559935 9:115324399-115324421 TTTTTTTTTGAACACTTTATTGG - Intronic
1059978251 9:119741040-119741062 TGTCCATGTGAACTCTGTTTAGG + Intergenic
1060081276 9:120648849-120648871 TTTCCATTTGAAATTTATTTTGG + Intronic
1060257551 9:122046024-122046046 TTACCATTTTAACCATTTTTAGG - Intronic
1060272315 9:122153733-122153755 CTTCCTTTTCAAAACTTTTTTGG + Intronic
1061622689 9:131822007-131822029 TTACCATTTAAACCATTTTTAGG - Intergenic
1185978811 X:4751739-4751761 TTTCCATAAGATAACTTTTTTGG - Intergenic
1186172900 X:6896380-6896402 TTTCCATTTAAACAATGTTAAGG - Intergenic
1186530379 X:10289507-10289529 TTTCAATATGAACACATGTTGGG - Intergenic
1187021558 X:15387777-15387799 CTTCCATTTTGACACTTTCTGGG + Intronic
1187096302 X:16152100-16152122 TCTCCTATTGAACTCTTTTTCGG + Intronic
1187283864 X:17884068-17884090 TTTCCATGCTATCACTTTTTAGG - Intergenic
1187687520 X:21830369-21830391 TTTGCATTTTAACCATTTTTAGG - Intergenic
1188011512 X:25061176-25061198 TTACCATTTTAACCATTTTTAGG + Intergenic
1188155829 X:26741234-26741256 TTTACATTTAAATAATTTTTAGG - Intergenic
1188342590 X:29022542-29022564 TTTGCATTTCAAGACTATTTAGG - Intronic
1190682812 X:52843109-52843131 TTTCTATTTGAATTCTTTTGTGG - Intergenic
1190891938 X:54576917-54576939 TTACCATTTTAACCATTTTTAGG + Intergenic
1191760712 X:64645320-64645342 TTTCTATTTTAACATTTTTCAGG - Intergenic
1191919503 X:66239376-66239398 CTTCCATTTGAATACTTTTTAGG + Intronic
1192065006 X:67874278-67874300 TTTCCTTTTGGTCTCTTTTTTGG + Intergenic
1193361837 X:80588008-80588030 TTTTCTTTTTAACAATTTTTTGG - Intergenic
1193361976 X:80589684-80589706 TTTTAATTTCAACAGTTTTTGGG - Intergenic
1193548983 X:82866101-82866123 TTTCTATTTCAACAGCTTTTGGG + Intergenic
1193694934 X:84696904-84696926 TTTTTATTTCAATACTTTTTGGG + Intergenic
1194018969 X:88663382-88663404 TTACCATTTTAGCAATTTTTAGG + Intergenic
1195999024 X:110761349-110761371 TTACCATTTGAACATAATTTTGG - Intronic
1196487871 X:116234632-116234654 TTGGCTTTTGAACTCTTTTTTGG + Intergenic
1196700997 X:118668719-118668741 TTTCTATTTCACTACTTTTTTGG - Intronic
1197564966 X:128071920-128071942 TGGCTATTTGAACTCTTTTTTGG + Intergenic
1198225617 X:134642391-134642413 TTTCCATTTGAACTCCTATTGGG + Intronic
1199145362 X:144359801-144359823 TTTCCAATTCAACATCTTTTTGG + Intergenic
1199351941 X:146811796-146811818 ATTCCATGTGACCACTTGTTTGG + Intergenic
1199351966 X:146812697-146812719 ATTCCATGTGACCACTTGTTTGG - Intergenic
1199386316 X:147227214-147227236 TTTCCCCTTGAGAACTTTTTGGG - Intergenic
1200382260 X:155850832-155850854 TTTCCATCTTAACAATATTTAGG - Intergenic
1200463994 Y:3492925-3492947 TTTCCATTTAACAACTTATTTGG - Intergenic
1200851729 Y:7890255-7890277 TTTCCATAAGAACTCTTTATGGG - Intergenic
1201342035 Y:12944633-12944655 TTGACATTTGAAAACTTTCTAGG - Intergenic
1201593979 Y:15646740-15646762 TTTCCATTTTAAAGCTTGTTTGG + Intergenic
1201697746 Y:16844783-16844805 TTTTCATTTCAACATGTTTTTGG - Intergenic