ID: 1142336155

View in Genome Browser
Species Human (GRCh38)
Location 16:89490557-89490579
Sequence CCGCTGGGTCCTGGAGCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142336155_1142336164 -4 Left 1142336155 16:89490557-89490579 CCTCTGGCTCCAGGACCCAGCGG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1142336164 16:89490576-89490598 GCGGCGGCTGCGGCGGGAGCCGG 0: 1
1: 9
2: 94
3: 578
4: 1753
1142336155_1142336167 22 Left 1142336155 16:89490557-89490579 CCTCTGGCTCCAGGACCCAGCGG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1142336167 16:89490602-89490624 CATGAGACGCTCCCGCCCATTGG 0: 1
1: 0
2: 0
3: 1
4: 31
1142336155_1142336161 -10 Left 1142336155 16:89490557-89490579 CCTCTGGCTCCAGGACCCAGCGG 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1142336161 16:89490570-89490592 GACCCAGCGGCGGCTGCGGCGGG 0: 1
1: 1
2: 3
3: 36
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142336155 Original CRISPR CCGCTGGGTCCTGGAGCCAG AGG (reversed) Exonic
900164293 1:1238573-1238595 CCGCTGGGAGCTGGAGCTGGGGG - Intergenic
900473008 1:2863766-2863788 CCGTGGTGTCCTGGTGCCAGTGG + Intergenic
900630195 1:3631019-3631041 CCTCTGCTTCCTGGAGACAGAGG - Exonic
900792948 1:4691665-4691687 CCCCTGACTCCTGGAGTCAGCGG - Intronic
900792949 1:4691665-4691687 CCGCTGACTCCAGGAGTCAGGGG + Intronic
901125239 1:6924404-6924426 CTGCAGGGTCCTGGAGTCAGTGG + Intronic
901678581 1:10900653-10900675 CAGCTGGGCCCTGCACCCAGTGG + Intergenic
901740766 1:11340183-11340205 TCGCTGGGGCGTGGAGCCTGTGG + Intergenic
901923789 1:12553438-12553460 CCTCTGGGAGCTGGAGCCAGTGG - Intergenic
902610152 1:17592438-17592460 TCATTGGGGCCTGGAGCCAGGGG + Intronic
903012678 1:20342618-20342640 CAGTTGGGTCCTGGACCCTGTGG - Intronic
903128593 1:21263828-21263850 CCGTGGGCTCCTGGAACCAGGGG - Intronic
903828163 1:26159743-26159765 CCCCTGAGTCCTGGAGGCTGAGG - Intronic
904007431 1:27370811-27370833 CAGCAGGGTCCTGGAGTCTGGGG - Intronic
906168823 1:43707231-43707253 CCTCTGGGCCGTGAAGCCAGGGG + Intronic
911262456 1:95702131-95702153 CCACTGAATCCTGGGGCCAGTGG - Intergenic
912093690 1:106113875-106113897 GAGCAGGCTCCTGGAGCCAGGGG - Intergenic
913054590 1:115145826-115145848 GTGCTGGGAGCTGGAGCCAGTGG + Intergenic
913164049 1:116168944-116168966 CTGCTGAGTACAGGAGCCAGCGG + Intergenic
913327133 1:117637034-117637056 CCCTTGGTTCCTAGAGCCAGCGG + Intergenic
913959024 1:143324854-143324876 CTGCTGGGTCCTAGAGCCTGTGG - Intergenic
914053341 1:144150234-144150256 CTGCTGGGTCCTAGAGCCTGTGG - Intergenic
914125856 1:144816307-144816329 CTGCTGGGTCCTAGAGCCTGTGG + Intergenic
914804378 1:150981929-150981951 CCCCAGGGAGCTGGAGCCAGAGG + Intergenic
914833764 1:151190333-151190355 TCGCTGGGTACTAGAGCAAGCGG - Intronic
915898609 1:159830099-159830121 CCGCTGGAGTCTGGAGACAGCGG + Exonic
916210532 1:162356455-162356477 GAGCTGGGTCCTGGAGGAAGGGG - Intronic
917501813 1:175592494-175592516 CCTCCGGCTCCTCGAGCCAGGGG - Intronic
918048329 1:180954343-180954365 CCGCGGGGGCCTGCAGCCTGAGG + Intergenic
918075913 1:181171374-181171396 CCTCTGGGTCGGGGAGCCACAGG + Intergenic
919678473 1:200409913-200409935 CCGGTGGGTCCAGGAGGGAGAGG - Intronic
920051905 1:203169280-203169302 CAACTGGGTGCTGTAGCCAGGGG + Exonic
920271134 1:204764553-204764575 CAGCTGGCTCCTGGAACCACAGG - Intergenic
922476002 1:225907381-225907403 GCTCTGGGTCCTGTGGCCAGGGG + Intronic
922894176 1:229088023-229088045 AGGCTAGGTCCTGGAGTCAGGGG - Intergenic
1063616469 10:7604401-7604423 TCGCTGGGTCCTCGGGCCTGAGG - Intronic
1064436200 10:15313230-15313252 CTGCTGGGTCCTGGAACAGGAGG - Intronic
1065993259 10:31032501-31032523 CCGCGGGAGCCGGGAGCCAGGGG - Intergenic
1066758676 10:38735766-38735788 CTGCTGGGTGCTAGAGCCTGTGG + Intergenic
1066962971 10:42237002-42237024 CTGCTGGGTGCTAGAGCCTGTGG - Intergenic
1067725772 10:48769699-48769721 GCGCTGGGTCCTGGAGCAATAGG - Intronic
1067800317 10:49353986-49354008 TGGCAGGGTCCTTGAGCCAGTGG - Intergenic
1069942273 10:71964128-71964150 CAGAGGGGTCCTGGAGACAGCGG + Intergenic
1070786245 10:79163775-79163797 CCGCTGCTCTCTGGAGCCAGAGG + Intronic
1071571568 10:86700163-86700185 GCGCTGTGTCCTGGGGCCGGTGG - Intronic
1071680249 10:87697547-87697569 CAGCTGGAGACTGGAGCCAGAGG + Intronic
1072717748 10:97762843-97762865 TGGCTAGCTCCTGGAGCCAGTGG - Intergenic
1075090868 10:119443680-119443702 CCGCCGGGTCCTGGAGACGGAGG + Exonic
1076902739 10:133347843-133347865 CCGCTGGACCCTGGAATCAGAGG + Intronic
1077021116 11:417535-417557 CCGCACGGGCCTGGGGCCAGTGG + Intergenic
1077137342 11:1007507-1007529 AAGCTGGGTCCAGGAGGCAGCGG - Intronic
1077153569 11:1081879-1081901 CCGCTGGGTGGTGGGGGCAGCGG + Intergenic
1077497231 11:2892196-2892218 CCACTGGAGCCTGGAGCCTGAGG + Intronic
1077523255 11:3048833-3048855 AGGCTGGGGCCTGGGGCCAGGGG - Intronic
1077561352 11:3263657-3263679 AGACTGGGTCCTGGAGCCACTGG + Intergenic
1077567248 11:3309486-3309508 AGACTGGGTCCTGGAGCCACTGG + Intergenic
1078000095 11:7486912-7486934 AGGCTGGGGCCTGGAGGCAGTGG + Intronic
1080695603 11:34600692-34600714 CCACTGGGTCATGGGCCCAGTGG - Intergenic
1080809194 11:35686046-35686068 CAGCTGGCTCCTGGAAGCAGTGG - Intronic
1083456465 11:62782235-62782257 CTACTGTGTCCTGGAGCCACTGG + Exonic
1083990635 11:66243882-66243904 CAACAGGGTCCTGGAGGCAGGGG - Exonic
1084176978 11:67428046-67428068 TTGCAGGGTCCTCGAGCCAGAGG + Intergenic
1084193139 11:67508023-67508045 CCCAGGGGTGCTGGAGCCAGGGG + Exonic
1084344209 11:68533619-68533641 CACCTGAGTCCTGGAGGCAGAGG + Intronic
1084433424 11:69123888-69123910 CCGCTGTCTACTGGAACCAGGGG - Intergenic
1084728870 11:71060427-71060449 CGGCTGGGGCCAGGGGCCAGTGG - Intronic
1084782924 11:71422972-71422994 CTGCAAAGTCCTGGAGCCAGGGG - Intergenic
1085219858 11:74864784-74864806 CCTCTGGGTCCTTGTGCAAGAGG - Intronic
1086120452 11:83300045-83300067 ACGATGGGCTCTGGAGCCAGAGG + Intergenic
1088690040 11:112318543-112318565 GGGCTGGGTGCTGGAGACAGTGG - Intergenic
1088810175 11:113387028-113387050 CCCCTGGGTCCTGGGTCCATGGG - Intergenic
1089129062 11:116198391-116198413 CCCCTGTGTACTGGAGTCAGAGG + Intergenic
1089317242 11:117600501-117600523 CCCCTGGGACCTGGAGCCCCAGG - Intronic
1089446611 11:118557850-118557872 CCTCTGTGGCCTGGAGCCTGTGG + Exonic
1089603358 11:119628042-119628064 CTGCTGGCTCCTGGACCCATGGG + Intronic
1090644050 11:128753114-128753136 CCACTGAGTCCTAGATCCAGAGG - Intronic
1090910251 11:131111949-131111971 CTGCACGTTCCTGGAGCCAGTGG - Intergenic
1091220385 11:133927026-133927048 CAGCTGGGTCCTGGCGGCACTGG + Exonic
1092097984 12:5860071-5860093 GGGCTGGGTGCTGGAGCCTGGGG - Intronic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103467021 12:121149920-121149942 CCGCTGGTACCTGGAGCTAACGG - Intronic
1104019228 12:124980608-124980630 CTGCTGGGTGCTGGAGCTGGCGG + Exonic
1104602347 12:130162307-130162329 CCGCGGGGCCCGGGAGCCCGCGG + Intergenic
1104987186 12:132603778-132603800 CTGCTGAGCCCTGGGGCCAGGGG - Intronic
1105211879 13:18261786-18261808 GCGCAGGGTCCTGAAGGCAGAGG + Intergenic
1112237729 13:97651269-97651291 GCCCTGGCTCCTGGAGCCAGTGG - Intergenic
1113279028 13:108768200-108768222 CCGAGGAGTGCTGGAGCCAGGGG - Intronic
1113778787 13:112963910-112963932 TCTCTGGGGCCTGGAGCAAGTGG - Intronic
1113814304 13:113161074-113161096 ACCGTGGGTCCTGGAGCCAGAGG - Intronic
1113942387 13:114025009-114025031 CCACTGTCTCCTGGAGCCTGTGG - Intronic
1117220014 14:53594206-53594228 CAGCTGGAACCTGGAGTCAGTGG - Intergenic
1117424479 14:55580422-55580444 CCGCGGGGTCCTGGGGCAGGCGG + Intronic
1121600790 14:95201428-95201450 CCGTTGGGTATTGCAGCCAGGGG - Intronic
1122062869 14:99148392-99148414 CCACTGGGACCTGGAGAGAGCGG - Intergenic
1122430006 14:101634670-101634692 CCGATGGTTCCTGGATACAGAGG + Intergenic
1122798518 14:104218272-104218294 CCCCTGGGTCCTGGGGGCTGTGG + Intergenic
1123033076 14:105460270-105460292 CCGCTGGTCCCTGGCGCCTGGGG + Intronic
1123774197 15:23562120-23562142 CGGCGGGGTCCAGGACCCAGCGG - Intergenic
1126969929 15:54099326-54099348 CAGCAGAGTCTTGGAGCCAGAGG - Intronic
1128509941 15:68307236-68307258 CTGCTGGGACATGCAGCCAGGGG + Intronic
1128862330 15:71084249-71084271 CCTCTGGGTCTGGGAACCAGGGG + Intergenic
1129719797 15:77871866-77871888 CCCCTGAGTCCTGGGGTCAGGGG - Intergenic
1130409988 15:83639333-83639355 CCTCTGGGTCCAGTGGCCAGGGG + Intergenic
1132285836 15:100661658-100661680 ACTGTGGGTCCTGGAGCCACTGG + Intergenic
1132523443 16:401899-401921 GCGCCGGGTCCTGGAGGCCGAGG + Exonic
1132709231 16:1259090-1259112 CTGCGGGGTCCTGGACCCCGAGG + Intergenic
1132740126 16:1408019-1408041 CAGCTGAGTCCAGGAGGCAGAGG + Intronic
1133282683 16:4676162-4676184 CTGCTGGGGCCTGGAGGGAGAGG + Intronic
1134279541 16:12805350-12805372 CCTATGAGTCCTGGAGTCAGTGG + Intergenic
1135288508 16:21214509-21214531 ACACTGGGTCCTGGTGACAGGGG + Exonic
1135293993 16:21263698-21263720 CTCCTGTGTCCTGGTGCCAGGGG - Intronic
1135500495 16:22991775-22991797 CTGCTGATTCCTGGAGCAAGAGG - Intergenic
1136141568 16:28292297-28292319 GCGCTGGGTCCTAGCGCCGGTGG - Intergenic
1136861840 16:33709454-33709476 CTGCTGGGTGCTAGAGCCTGCGG + Intergenic
1137557838 16:49483937-49483959 CGGCTGGGTCCTGAAGCATGTGG - Intergenic
1139442096 16:66973496-66973518 CGGGTGGGACCTGGAGCTAGGGG + Exonic
1140221533 16:73047895-73047917 CCTCCGAGTCCTGGGGCCAGCGG - Exonic
1141688831 16:85585279-85585301 CCTCTGGTTCCTGGAGCCCTTGG - Intergenic
1141791912 16:86242859-86242881 CCGCAGGGGCCTGGAGACTGGGG - Intergenic
1142278971 16:89137912-89137934 CAGCTGGGCCCTGGAAGCAGCGG - Intronic
1142336155 16:89490557-89490579 CCGCTGGGTCCTGGAGCCAGAGG - Exonic
1142336156 16:89490557-89490579 CCTCTGGCTCCAGGACCCAGCGG + Exonic
1203123335 16_KI270728v1_random:1557637-1557659 CTGCTGGGTGCTAGAGCCTGTGG + Intergenic
1203147671 16_KI270728v1_random:1811628-1811650 CTGCTGGGTGCTAGAGCCTGTGG - Intergenic
1142982347 17:3679538-3679560 CAGCTGGGTCCTGCAGAGAGGGG - Intronic
1143105913 17:4530526-4530548 CTGCAGGGCCCAGGAGCCAGGGG - Intronic
1143363215 17:6388093-6388115 TCCCTGGGTCCCTGAGCCAGAGG + Intergenic
1143571117 17:7759286-7759308 ACGCTGAGTCCTGGAGGAAGAGG - Intronic
1144046746 17:11460824-11460846 CAGCTAGGCCCTGGGGCCAGTGG - Intronic
1144787833 17:17841666-17841688 CCTTTGGGTCCTGGGGGCAGCGG - Intergenic
1144961969 17:19049483-19049505 ACGCTGGGGCCTGGAACGAGGGG + Intergenic
1144973192 17:19125039-19125061 ACGCTGGGGCCTGGAACGAGGGG - Intergenic
1146058305 17:29591924-29591946 CCGCTGGGGCCTGGCACCACAGG + Intronic
1146781143 17:35673533-35673555 CCCCTTGGTCCTGGAACCTGTGG - Intronic
1146809421 17:35891284-35891306 CTCCTGGGGCCTGGAGGCAGTGG - Intergenic
1146940331 17:36839752-36839774 CCCCTGAGGCCTGAAGCCAGTGG - Intergenic
1147459244 17:40557921-40557943 CCCCAGAGTCCTGGAGACAGGGG + Intronic
1147559689 17:41501214-41501236 CCTCTGGGTGCTGAAGACAGAGG + Exonic
1147992867 17:44345651-44345673 CCGCGGCGGCCTGGAGCCGGAGG + Intronic
1148330757 17:46812526-46812548 TTGCTGGGACCTAGAGCCAGGGG - Intronic
1148744988 17:49913077-49913099 CAGCTGGGGCCTGGGGCCTGGGG - Intergenic
1148783789 17:50135470-50135492 CCTGTGGGTCCTGGAGGGAGGGG - Intronic
1149042485 17:52206418-52206440 CAGCTGGGAACTGGAGTCAGAGG + Intergenic
1152403703 17:80084575-80084597 TTGCTGGGTCCTGGAGACAGTGG + Intronic
1152468494 17:80478176-80478198 CCGCCGCTTCCTGGCGCCAGAGG + Intergenic
1154081704 18:11263761-11263783 TAGATGGGTCTTGGAGCCAGAGG + Intergenic
1154941325 18:21115327-21115349 ACACTGGGTCCAGGAACCAGTGG + Intergenic
1157452130 18:47796646-47796668 CCTTTGCGTCCTGGAGGCAGAGG + Intergenic
1157579457 18:48764942-48764964 CCTCTGGGCCTTGGAGTCAGGGG - Intronic
1158505727 18:58044567-58044589 CCGGGGGGACCTGGAGGCAGAGG + Exonic
1158536388 18:58311893-58311915 CCACTGGGACCTGAAGCCCGGGG - Intronic
1160715193 19:573171-573193 CCCCTTTGGCCTGGAGCCAGGGG + Intronic
1160716806 19:580459-580481 ACGGTGAGTCCTGCAGCCAGGGG + Exonic
1160833420 19:1113648-1113670 CCCCGGGGTCCTGGAGCGGGTGG - Exonic
1160836332 19:1126486-1126508 CTGCTGGGCCCTTGTGCCAGAGG + Intronic
1160901844 19:1432719-1432741 GCCCAGGGTCCTGGGGCCAGCGG - Intronic
1161333740 19:3700168-3700190 CCGCCGGTTCCAGGAGCCTGGGG - Intronic
1161628573 19:5340206-5340228 CGGGCGGGTCCTGGAGGCAGGGG - Intronic
1162375116 19:10300208-10300230 GTGCTCGGTGCTGGAGCCAGGGG + Intergenic
1162494083 19:11013553-11013575 CCTCTGGGTCCCGGATCAAGTGG + Intronic
1163008368 19:14410161-14410183 CCCCAGGGGCCTGGAGCCTGGGG - Intronic
1163551337 19:17967676-17967698 CCACTGGCCCCTGGATCCAGGGG + Intronic
1163551336 19:17967676-17967698 CCCCTGGATCCAGGGGCCAGTGG - Intronic
1165323844 19:35102573-35102595 CAGCTGAGTCCAGGAGGCAGAGG + Intergenic
1165749827 19:38253052-38253074 CAGCTGGGCCCTGGGGCCGGTGG - Intronic
1165778372 19:38418036-38418058 CCGCTGGGGCCTGGGGACTGGGG + Intronic
1165795465 19:38516817-38516839 CCCCTGAGTCCTGGGTCCAGAGG + Intronic
1165871411 19:38975803-38975825 CCGCTGGGCCCCGCAGCCGGAGG - Exonic
1166373802 19:42316145-42316167 CCCCTGGGTCCTGGAGGAGGAGG + Intronic
1167906392 19:52664521-52664543 CCACTGGGTCCTGGGTCTAGGGG + Intronic
1168069448 19:53941752-53941774 CCCCTGGGTCCTGGAGGAAGAGG + Intronic
1168240492 19:55086650-55086672 GCGAGGGGTCCTGGGGCCAGAGG - Intronic
1202692739 1_KI270712v1_random:102657-102679 CTGCTGGGTCCTAGAGCCTGTGG - Intergenic
925298222 2:2792377-2792399 TCGCAGGGTCCAGGACCCAGAGG + Intergenic
927553235 2:24016671-24016693 CCGATGGGTCATGGAGGCAGTGG - Intronic
927846653 2:26475801-26475823 CCTGTGGGGCCTGGAGCCACAGG - Intronic
928205276 2:29279386-29279408 CCTCTGGGGGCTGGAGCCATGGG - Intronic
930068356 2:47345122-47345144 CCCCTGGGGCCTGGAGACAAAGG + Intergenic
932194282 2:69769745-69769767 TCGCTGGAACCTGGAGGCAGAGG - Intronic
932563723 2:72892822-72892844 AGGCTGAGTCCTGGAGTCAGCGG - Intergenic
932731859 2:74227177-74227199 CCGCTGGGTCCTGGGACTAGGGG + Intronic
933953663 2:87351308-87351330 CTGCTGGGTCCTAGAGCCTGTGG + Intergenic
934237868 2:90247561-90247583 CTGCTGGGTCCTAGAGCCTGTGG + Intergenic
934275334 2:91569175-91569197 CTGCTGGGTCCTAGAGCCTGTGG - Intergenic
934301747 2:91780687-91780709 GCGCAGGGTCCTGAAGGCAGAGG - Intergenic
934321998 2:91980111-91980133 CTGCTGGGTGCTAGAGCCTGTGG + Intergenic
934561005 2:95313291-95313313 ACCCAGGGTCCTGGAGACAGTGG + Intronic
936007978 2:108906993-108907015 CGGCTGGGGCCTGCAGCCAGGGG + Intronic
936016257 2:108961317-108961339 CTGGTGGGTCCTGGGGGCAGAGG - Intronic
936081992 2:109438597-109438619 TCCCAGGGCCCTGGAGCCAGGGG - Intronic
936259594 2:110947622-110947644 CTAATGGGTCCTGGAGGCAGAGG - Intronic
937976134 2:127583166-127583188 GCTCTGCTTCCTGGAGCCAGTGG - Intronic
941130927 2:161650431-161650453 GTGCTTGGTCATGGAGCCAGCGG + Intronic
942302003 2:174571825-174571847 CCGCTGGAACTTGGAGGCAGAGG + Exonic
945057355 2:205880591-205880613 CCGCTGGGTGCTGGGGACATAGG + Intergenic
945990507 2:216392048-216392070 CAGCTGGGTGCTGGGGTCAGCGG + Intergenic
948201994 2:236136118-236136140 CTGATGGGGCCAGGAGCCAGGGG - Intergenic
948671368 2:239570810-239570832 CAGTGGGGTCCTGGAGCCAGAGG + Intergenic
1170718793 20:18856923-18856945 CTGGTGGGTCTTGGAGCCAATGG - Intergenic
1172160251 20:32863051-32863073 CTGAAGGGTCCTGGAGGCAGAGG - Intronic
1172269276 20:33644503-33644525 CCGCTGCTTCCTGTAGGCAGGGG + Exonic
1172890480 20:38260595-38260617 CCGCCTAGCCCTGGAGCCAGGGG + Exonic
1173790124 20:45823053-45823075 GAGCTGGGCCCTGGAGCCCGAGG - Intergenic
1174446237 20:50593170-50593192 CCGCAGGCTCCTGGAGCAGGTGG - Exonic
1176132779 20:63503261-63503283 CCTCTGGGCCCTGGAGGAAGAGG + Intergenic
1176238432 20:64064931-64064953 AAGATGGGTCATGGAGCCAGGGG + Intronic
1176265368 20:64206450-64206472 CCCCTGGGTCCCGGAGGGAGGGG + Intronic
1176591408 21:8653935-8653957 CTGCTGGGTGCTAGAGCCTGCGG + Intergenic
1178695693 21:34791853-34791875 CCCCTGGGTGCTGGGGCCGGCGG + Exonic
1179567234 21:42256823-42256845 TGACTGGGTCCTGGAGCCTGGGG - Intronic
1179605858 21:42514559-42514581 CAGCTGGTTCCCGGAGCCCGTGG + Exonic
1179710715 21:43211552-43211574 CCGGTGGGTGCTGGAGCCTGCGG + Intergenic
1179902976 21:44403271-44403293 CTGCTGGGTCCTGGGGCCTGGGG + Intronic
1179959078 21:44758299-44758321 CAGCATGGTCCTGCAGCCAGAGG + Intergenic
1180087079 21:45512479-45512501 CAGCCAGGTCCTGGGGCCAGGGG - Exonic
1180198410 21:46210798-46210820 CCATTGGATCCTGGAGGCAGTGG - Intronic
1180274256 22:10631046-10631068 CTGCTGGGTGCTAGAGCCTGCGG + Intergenic
1180548744 22:16526027-16526049 CTGCTGGGTGCTAGAGCCTGTGG + Intergenic
1181339172 22:22164904-22164926 GAGCTGGGTCCTGAAGCCACAGG + Intergenic
1181471279 22:23141772-23141794 ACGGTGGGTGCTGGAGACAGGGG + Intronic
1181602387 22:23960214-23960236 CCACTGGGGCCCGGGGCCAGTGG + Intronic
1181631637 22:24154826-24154848 GGGCTGGTTCCTGGAGCCAGCGG - Intronic
1181960551 22:26619031-26619053 CAGCTAGGTGCTGGGGCCAGTGG - Intergenic
1182534048 22:30986823-30986845 ATGCTCAGTCCTGGAGCCAGGGG - Intergenic
1183425922 22:37739384-37739406 CCGTTGCCTCCTGAAGCCAGGGG + Intronic
1184652845 22:45926983-45927005 CCACCAGCTCCTGGAGCCAGGGG - Intronic
950116196 3:10451533-10451555 TCACTGGGTGCTGGAGCCACAGG + Intronic
952931193 3:38362089-38362111 TCCCTGTGTCCAGGAGCCAGAGG - Intronic
953381183 3:42473991-42474013 CTGCTGGCTGCTGAAGCCAGGGG - Intergenic
953406315 3:42661644-42661666 CCACTGGGGGATGGAGCCAGAGG + Intronic
954301106 3:49701284-49701306 CTGCTGGGTACTGGAGCTGGTGG + Intronic
954416767 3:50397090-50397112 CTGCTAGGCTCTGGAGCCAGAGG - Intronic
954630307 3:52044441-52044463 CTGCAGGGGCCTGGTGCCAGTGG + Intergenic
954802021 3:53192838-53192860 GCCCAGGGTCCTGGGGCCAGAGG - Intergenic
955468295 3:59258942-59258964 CTGCTGGGGGCTGGAGACAGAGG - Intergenic
958102109 3:89025452-89025474 GCGCTGGATCCTGAAGCCAGTGG - Intergenic
960875591 3:122292088-122292110 CCCTTGGGTCCAGGAGGCAGAGG + Intergenic
961796230 3:129411058-129411080 CCCCAGGGTTCTGCAGCCAGCGG + Intronic
968505381 4:968826-968848 CCGCAAGGTCCTGGAGGCACCGG - Exonic
968509615 4:989697-989719 CAGCTGTGTCCGGCAGCCAGTGG + Exonic
968661462 4:1800472-1800494 GCGCTGGGTCCCTGGGCCAGTGG + Intronic
969714331 4:8861086-8861108 CCGCGGGGTCCCGGACACAGCGG + Intronic
969714330 4:8861086-8861108 CCGCTGTGTCCGGGACCCCGCGG - Intronic
970565048 4:17323768-17323790 CCTCTGGGTCCTGGAGCTAGAGG + Intergenic
971238301 4:24863886-24863908 CCGCTGTGTCCTGCATCCATTGG - Intronic
971382387 4:26110815-26110837 CCGCTCAGCCCTGGAGTCAGTGG + Intergenic
971500483 4:27313170-27313192 CTGCTGGGTCCTCAAGGCAGGGG - Intergenic
972026425 4:34384059-34384081 CCAATGGGTCCTAGAGCCATGGG - Intergenic
972629847 4:40833482-40833504 AAGCAGGGTCCTGGGGCCAGAGG - Intronic
978194405 4:105954172-105954194 CTACTGGGCCCTGGAGTCAGGGG - Intronic
978586477 4:110280491-110280513 GCGCTGGTTCCTGGAGTGAGGGG + Intergenic
982678278 4:158400623-158400645 CTGCTGGGCCCTGTAGCCACAGG + Intronic
985615227 5:916087-916109 CCACAGGGTCCTGGGGCCGGAGG + Intronic
992105501 5:73447143-73447165 CCGCTGGATCCGGGAGCTGGCGG + Exonic
994416419 5:99477523-99477545 CCAGTGGGCCCTGGACCCAGGGG - Intergenic
994463548 5:100097650-100097672 CCAGTGGGCCCTGGACCCAGGGG + Intergenic
996313704 5:122137361-122137383 TCGCTTGAACCTGGAGCCAGAGG + Intronic
997103174 5:130990798-130990820 CCACTGGGTCCTGTTGCAAGGGG + Intergenic
997294757 5:132762443-132762465 CCTCAGGGCCCTGGGGCCAGAGG - Intronic
997392202 5:133526382-133526404 CAGCTGGGTCTTGGAGGAAGAGG + Intronic
998316276 5:141185492-141185514 CCGTTGGGCCCAGGAGGCAGAGG - Exonic
998415787 5:141945344-141945366 CCCCTGGTTCTTGGATCCAGAGG + Exonic
998767006 5:145499539-145499561 GGGGTGGGGCCTGGAGCCAGGGG + Intronic
999414216 5:151380834-151380856 TTGCTGTGTCCTGGAGGCAGTGG - Intergenic
1000345686 5:160312048-160312070 CCGCCGGGGCCCGGGGCCAGGGG - Intronic
1001429147 5:171645876-171645898 CCATTGTGTCCTGCAGCCAGGGG + Intergenic
1001684553 5:173583779-173583801 CCTCTGGGTCCTGGAAGCTGAGG - Intergenic
1001847850 5:174937575-174937597 GCACTGGGTCCTGCAGGCAGGGG - Intergenic
1001937336 5:175714732-175714754 AGGCTGGGTCCTGGGGCAAGAGG - Intergenic
1002576329 5:180176218-180176240 CAGGTGGGCCCTGGAGGCAGGGG + Intronic
1003590540 6:7433122-7433144 CGGGTGGGTGCTGGAGCCATTGG + Intergenic
1004301108 6:14458115-14458137 CAGCTGGGTCTTTGAGCCAGTGG + Intergenic
1004595202 6:17093148-17093170 CTGCAGGGTCCTGGAACCTGGGG - Intergenic
1004743356 6:18485398-18485420 CTTCTGGCTGCTGGAGCCAGAGG + Intergenic
1005231901 6:23711352-23711374 CAGCTGGGTCCTGGAGTCTTAGG - Intergenic
1005968358 6:30742799-30742821 CGGCTGGGCCCGAGAGCCAGCGG - Intergenic
1006370371 6:33640496-33640518 CCGCTGTGTGGTGGAGCCCGCGG + Exonic
1006372887 6:33656392-33656414 CCAGTGGCTCCTGGAGACAGTGG + Intronic
1007591183 6:43021738-43021760 CGGCGGGGGCCTGGAGCCCGCGG + Exonic
1011596510 6:89021712-89021734 CAGCTTGGTACTGGAGACAGTGG - Intergenic
1013214201 6:108012604-108012626 CACCTGAGTCCTGGAGGCAGAGG - Intergenic
1013911267 6:115278765-115278787 CCTCTGGGTCCTGCAGCTTGTGG + Intergenic
1019554998 7:1624914-1624936 GCGGTGGGACCTGGAGCCATTGG + Intergenic
1019558248 7:1643068-1643090 CAGGAGGGTCCTGGGGCCAGAGG - Intergenic
1019685403 7:2379288-2379310 CCCCTGGGCCCTGGTGCCCGCGG + Intronic
1020133909 7:5575228-5575250 CGACTGTGTCCTGGAGCCAGGGG - Intergenic
1020958302 7:14771108-14771130 CAGATGGGTCCAGGTGCCAGGGG - Intronic
1021043536 7:15892841-15892863 CTGCTGGGGCATGGAGCCATGGG + Intergenic
1021683365 7:23157333-23157355 CTGCTGGGGCCTGCAGCTAGAGG - Intronic
1022092311 7:27115661-27115683 CGGCAGGGTCTTGGCGCCAGTGG - Intronic
1022811064 7:33869491-33869513 CCTCTGTGTCCAGGACCCAGTGG - Intergenic
1022811065 7:33869491-33869513 CCACTGGGTCCTGGACACAGAGG + Intergenic
1024509339 7:50190826-50190848 CAGCAGGGTACTGGAGCCAGTGG + Intergenic
1025263239 7:57436888-57436910 TCCCTGGGTGCTGGAGACAGGGG + Intergenic
1025295406 7:57772271-57772293 CTACTGGGTCCTGGATCCAGAGG + Intergenic
1033756559 7:144401555-144401577 TCCCCGGGTCCTGCAGCCAGGGG + Exonic
1034460796 7:151196903-151196925 GCCCTGGGTCCTGGAGAAAGTGG - Intronic
1034956717 7:155339592-155339614 CCTCTGGGGCCTGGAGAAAGCGG + Intergenic
1035245958 7:157562085-157562107 GCCCTGAGTCCTGGAGCCAAAGG + Intronic
1035448191 7:158957287-158957309 CAGCCGGGACCTGGAGCCTGAGG - Intergenic
1035815553 8:2536131-2536153 CAGCTGTGTCCTGGAGAGAGAGG + Intergenic
1036294975 8:7528343-7528365 AACCTGGGTCCTGGAGGCAGGGG + Intergenic
1036327589 8:7792648-7792670 AACCTGGGTCCTGGAGGCAGGGG - Intergenic
1038844176 8:31213542-31213564 TCCCTGGGTCCTGGAGCCCTTGG + Intergenic
1039224490 8:35372982-35373004 CTGTTGAGTCTTGGAGCCAGTGG + Intronic
1039365454 8:36923711-36923733 CTGCTGGGTCCTGCATCCATTGG + Intronic
1045108851 8:98920458-98920480 CGGCTGGGTCTGGGAGCCAGTGG + Intronic
1047628261 8:126678601-126678623 CAGGTTGGTTCTGGAGCCAGAGG - Intergenic
1049545483 8:143228760-143228782 CCTCCGGGGCCTGGAGCCTGGGG + Intergenic
1049623950 8:143611849-143611871 CATCTGGGTCCTGGATGCAGTGG + Intergenic
1049680772 8:143917020-143917042 CAGCTGGGTCCTGGAGACGGCGG + Exonic
1049696318 8:143985845-143985867 GCGCTGGGGCGTGGTGCCAGGGG + Exonic
1049697272 8:143990385-143990407 CCGCGGCGGCCTGGAGCCGGAGG + Intronic
1049710311 8:144060359-144060381 CCGCTGGACCCTGGAGCCCTCGG + Intronic
1057354584 9:94323048-94323070 CCTCAGGGTCCTGGAGCTTGAGG + Intronic
1057653173 9:96934587-96934609 CCTCAGGGTCCTGGAGCTTGAGG - Intronic
1060554490 9:124501261-124501283 CAGCTGGACCCTGGGGCCAGCGG - Intronic
1060661402 9:125407415-125407437 CCGCTGGGCCCGGTAGGCAGTGG + Intergenic
1060996395 9:127876817-127876839 TCGCTGGGGCCTTGACCCAGGGG - Intronic
1061218622 9:129236235-129236257 AGGCTGTGTCCTGGAGCCATCGG + Intergenic
1061952325 9:133943443-133943465 CCGCTTGCTCCTGCAGCCACAGG - Intronic
1062003280 9:134227338-134227360 GCGCTGGGTGGTGGAGCCTGTGG + Intergenic
1062175474 9:135159732-135159754 CCACTGGGACCTGGAGCCCAGGG + Intergenic
1062527683 9:136984923-136984945 CCGCTGGCTCCTGGTGTCTGTGG + Exonic
1203621436 Un_KI270749v1:132699-132721 CTGCTGGGTGCTAGAGCCTGCGG + Intergenic
1188133425 X:26466212-26466234 TCGCTGGAACCTGGAGGCAGAGG + Intergenic
1189474057 X:41335111-41335133 GCGCTGGGCCCTGGAGATAGAGG + Intronic
1196917373 X:120551280-120551302 CCACTGGAACCTGGAGGCAGAGG - Intronic
1199996698 X:153030582-153030604 CCGCAGCATCCTGGAGGCAGTGG + Intergenic
1200091015 X:153635974-153635996 CAGCTGGGCCCAGGAGCCTGGGG + Intergenic
1201189483 Y:11435290-11435312 CTGCTGGGTGCTAGAGCCTGTGG + Intergenic