ID: 1142337878

View in Genome Browser
Species Human (GRCh38)
Location 16:89502027-89502049
Sequence CTCCATGTCCACACTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142337871_1142337878 18 Left 1142337871 16:89501986-89502008 CCAGCCCTTTAAGTTACAACAAA 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 211
1142337873_1142337878 13 Left 1142337873 16:89501991-89502013 CCTTTAAGTTACAACAAAAAGAA 0: 1
1: 0
2: 4
3: 53
4: 720
Right 1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 211
1142337870_1142337878 28 Left 1142337870 16:89501976-89501998 CCTTGTCAAACCAGCCCTTTAAG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 211
1142337872_1142337878 14 Left 1142337872 16:89501990-89502012 CCCTTTAAGTTACAACAAAAAGA 0: 1
1: 0
2: 2
3: 75
4: 2111
Right 1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142337878 Original CRISPR CTCCATGTCCACACTGAGCC TGG Intronic
900421682 1:2558539-2558561 CTCCATGGCCACAGTGCCCCAGG + Intronic
900585250 1:3429514-3429536 CTCCCTGTCCACTCTGAGGACGG - Intronic
901720550 1:11193752-11193774 CTCCATCTCTACACGCAGCCGGG - Exonic
902173616 1:14632796-14632818 CTCTTCTTCCACACTGAGCCAGG + Intronic
902669523 1:17963165-17963187 CTGAATGTCCACTCTGTGCCAGG - Intergenic
903029840 1:20455989-20456011 CTCCATGCCCACCCTGGCCCAGG + Intergenic
903358263 1:22761498-22761520 AGCCATGTCCACACAGACCCGGG + Intronic
904272368 1:29358561-29358583 CTTAATGTCCACTCTGTGCCAGG + Intergenic
905238680 1:36568014-36568036 TTGCATGGCCACTCTGAGCCAGG + Intergenic
905696901 1:39981121-39981143 TTCCTTGTCCTCTCTGAGCCTGG - Intergenic
907462898 1:54615852-54615874 CGCCTAGTCCTCACTGAGCCTGG + Intronic
909282200 1:73770355-73770377 CTCCAGGTCCTCGCTGGGCCTGG - Intergenic
909583545 1:77264157-77264179 ATGCATGTCTACTCTGAGCCAGG - Intergenic
913111776 1:115663734-115663756 CTCCATGTCCTTGCTGATCCTGG - Exonic
914322413 1:146577927-146577949 TCCCATGTCCACACTTGGCCTGG - Intergenic
915238047 1:154500377-154500399 CAGCATGCCCACCCTGAGCCAGG - Intronic
915639352 1:157211135-157211157 CTGCATGTCCACACGTACCCTGG - Intergenic
917211855 1:172639774-172639796 CTCCATGAGCAGACTAAGCCAGG + Intergenic
917978440 1:180254711-180254733 CCCCAAGTTCACGCTGAGCCTGG - Intronic
920442201 1:205988844-205988866 CTCCATGTCCACACCCGGCCAGG + Intronic
923664980 1:235991765-235991787 CTCCCTGCCCACAGGGAGCCAGG + Intronic
924179317 1:241424633-241424655 CTCCAGGTCCTCACTGCACCCGG - Intergenic
1065154059 10:22851743-22851765 ATCCATCTCCACACTAACCCAGG - Intergenic
1067746523 10:48940525-48940547 GGCCTTGTCCAGACTGAGCCCGG + Intronic
1071362301 10:84860987-84861009 CTGACTGTCCACACTGAGCTGGG - Intergenic
1073834575 10:107426336-107426358 CTCCATGTCAAGACTGTGCATGG + Intergenic
1074461059 10:113637093-113637115 CTCCATGTCTTCCCTGAGTCTGG + Intronic
1075481171 10:122783091-122783113 CCCCTTGCCCACACTGTGCCAGG - Intergenic
1075599278 10:123755416-123755438 TTCCAAATCCACACAGAGCCAGG - Intronic
1075699066 10:124456861-124456883 ATCCACTCCCACACTGAGCCTGG + Intergenic
1075876760 10:125813926-125813948 CTCCATGCCCACTCTGCTCCAGG + Intronic
1076236527 10:128867957-128867979 CATCAACTCCACACTGAGCCTGG + Intergenic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1076460701 10:130643938-130643960 TGGCATGTCCACACTGAGCATGG + Intergenic
1077886482 11:6391280-6391302 CTCCATTTCCAAACTGGGGCTGG - Intronic
1078903380 11:15662108-15662130 CTCCATCCCCACACTGATCTAGG + Intergenic
1079351477 11:19695371-19695393 CTCAAAGTCCACTCTGTGCCAGG - Intronic
1080041622 11:27765220-27765242 CTCCATGCCCTCACCCAGCCAGG - Intergenic
1080593993 11:33752067-33752089 GTAGATGTCCAGACTGAGCCTGG - Intronic
1080670410 11:34371780-34371802 CTCCTTGTTCAGACTTAGCCTGG + Intergenic
1081583179 11:44366249-44366271 CTCAATGTGCACACCAAGCCTGG - Intergenic
1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG + Intronic
1083429976 11:62609258-62609280 CTCCTTGTCCCCACAGACCCAGG + Intronic
1083750494 11:64758314-64758336 CTCCATGGCAACACTGGGCCTGG - Exonic
1084860711 11:72016062-72016084 CTCCATCTCCAACCTCAGCCAGG - Exonic
1084935706 11:72585510-72585532 CCCCATGCCCACACACAGCCAGG + Intronic
1085467117 11:76731568-76731590 CTCCATGCCACCACTGAGACAGG + Intergenic
1086961586 11:92984081-92984103 CTGCATGTCCACAATGTGCCTGG + Intronic
1086980866 11:93196737-93196759 CTCCATATCCTCACTAAGACAGG + Intronic
1089115804 11:116094080-116094102 CTACAGTTACACACTGAGCCTGG + Intergenic
1089681500 11:120121446-120121468 CCCCAACTCCACCCTGAGCCTGG + Intronic
1090807824 11:130213377-130213399 TTCCATGCTCACCCTGAGCCAGG - Intergenic
1091093078 11:132791626-132791648 CTCCATGTTCACTTTGAGGCAGG - Intronic
1094321748 12:29191270-29191292 CCCCATCTCTACCCTGAGCCAGG + Intronic
1101345351 12:103880999-103881021 ATCCATGTCCAGACAGATCCTGG + Intergenic
1101931793 12:109020863-109020885 CTCCATGTCCGCGCTGCGCCAGG + Exonic
1102191788 12:110994304-110994326 CTCCATGTCCTCACACAGCCTGG - Intergenic
1103057754 12:117835105-117835127 CCACATGGCCTCACTGAGCCTGG - Intronic
1104424151 12:128660770-128660792 CTCCACGGCCACCGTGAGCCAGG + Intronic
1104897552 12:132171758-132171780 CTCCTTCTCCACACACAGCCTGG + Intergenic
1106047532 13:26157702-26157724 CTTCATGTCCTCACTGATGCTGG - Intronic
1107853260 13:44591401-44591423 CTCCAGGTCCTCACTGGGTCTGG - Intergenic
1111528726 13:89509012-89509034 CCCCAACTCCCCACTGAGCCAGG + Intergenic
1112955071 13:105047518-105047540 CACCTCTTCCACACTGAGCCAGG + Intergenic
1113069574 13:106407409-106407431 CCCCGTGTCCACAGTCAGCCGGG - Intergenic
1113075796 13:106466901-106466923 CTTCCTGTCCACACCCAGCCTGG + Intergenic
1115760290 14:36574064-36574086 CTCCCTCTCCTCACTGAGCTTGG - Intergenic
1115968584 14:38919749-38919771 CTCCATGTCCTCACTGCCCCTGG - Intergenic
1117952961 14:61100981-61101003 CTCCCTGTGCTCACTGAACCTGG + Intergenic
1118025371 14:61762843-61762865 TCCCATCTCCACCCTGAGCCAGG + Intronic
1118947143 14:70398791-70398813 CTCCAGGTCCTCATTGGGCCGGG + Intronic
1119195755 14:72715651-72715673 CTCCATGTACACACTCACCGGGG + Intronic
1119473282 14:74912299-74912321 CTCCCTGCCCACGCTGGGCCAGG + Intronic
1119733218 14:76964344-76964366 CACCATGTACACACGGAGGCAGG + Intergenic
1121470939 14:94153867-94153889 CTCCATGTCCACCCTGCGAAAGG + Intronic
1125087649 15:35748949-35748971 CTCAATGGTCACTCTGAGCCAGG - Intergenic
1125555579 15:40582126-40582148 CTCCAAGTCCCCACTGACCCAGG + Intergenic
1127808900 15:62546129-62546151 CTCCCTCTCCACACTGTGCCAGG - Intronic
1128173153 15:65530615-65530637 CTCCATGGCCACACTGCCCAGGG - Exonic
1128471767 15:67959903-67959925 ATGAATGTCCTCACTGAGCCTGG - Intergenic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1129009119 15:72398787-72398809 CGCCATGTCCCCACTGAACTGGG + Exonic
1129162870 15:73756740-73756762 TTCCATGTTCACAGTGACCCTGG - Intergenic
1129316710 15:74749686-74749708 CTCCATCTCAACCCTCAGCCTGG + Intronic
1130062355 15:80579026-80579048 CTGCCTGTCCACACTAAGGCAGG + Intronic
1132040481 15:98521302-98521324 CTACATGTCCACACACAGACGGG + Intergenic
1132223696 15:100124477-100124499 CCCCATGTCCTCACTGACACCGG - Intronic
1132406631 15:101545425-101545447 ATGCCTGTCCACTCTGAGCCTGG + Intergenic
1132709674 16:1260799-1260821 ACGCATGTCCACACAGAGCCCGG + Intergenic
1133253548 16:4501722-4501744 CTACATGTCCAGACTTAGTCTGG - Intronic
1135046925 16:19163534-19163556 CTCCATGTCCAAAGACAGCCAGG + Intronic
1135982012 16:27155155-27155177 CTCCTTGTTCCCACTCAGCCTGG + Intergenic
1137835405 16:51587714-51587736 ATCCATGTCCATCCTGAACCTGG + Intergenic
1138241207 16:55428524-55428546 CCCTGTGTCCACACTTAGCCAGG - Intronic
1140011210 16:71133242-71133264 TCCCATGTCCACACTTGGCCTGG + Intronic
1141385260 16:83616738-83616760 GTCCAGGTCCACACTGCACCTGG + Intronic
1141397363 16:83716956-83716978 CACCATGTCCAGCCTGAGTCTGG - Intronic
1141424904 16:83938561-83938583 CTGCATGCCAGCACTGAGCCAGG + Intronic
1141471638 16:84242660-84242682 CTGTGAGTCCACACTGAGCCTGG - Intergenic
1142024378 16:87804648-87804670 CTCCCTGTCCTCCCTGAGCTCGG + Intergenic
1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG + Intronic
1144734365 17:17546673-17546695 CTCCCTGTCCACCCTGGGGCTGG + Intronic
1146929886 17:36769375-36769397 CTCCATGTCCAGACAGGGCCAGG - Intergenic
1148382659 17:47210858-47210880 CTCCATTTACAAGCTGAGCCTGG + Intronic
1148888105 17:50788180-50788202 CTCCATGTGCAGACAGAACCTGG + Intergenic
1150137084 17:62702002-62702024 CTCCACGTCCCCACATAGCCTGG + Intronic
1151197297 17:72440759-72440781 CTCCATGTGCACACTGAGGCTGG + Intergenic
1151395511 17:73820119-73820141 CTCCAGGTCCTCACTGGGTCTGG + Intergenic
1151772964 17:76177143-76177165 CTCCAGGTCCTCACTGGGCCGGG - Intronic
1152383604 17:79955273-79955295 CTCCATGACCACACAGGGCCTGG - Intronic
1152807235 17:82361944-82361966 CTGCAGGTCCCCACTGAGCTGGG + Exonic
1153103847 18:1505418-1505440 CTCCTTGGCCACACTGATTCAGG - Intergenic
1157483795 18:48073071-48073093 TTCCATGGCCAAACTGGGCCTGG - Intronic
1157702088 18:49767854-49767876 CTCCATGTCCTCACTTGCCCTGG + Intergenic
1159951300 18:74486288-74486310 CTCCATGCCCACACTGCTCTAGG + Intergenic
1159952584 18:74496194-74496216 CCCCATTTCCGCCCTGAGCCAGG - Exonic
1160322066 18:77905564-77905586 CTCCATCTCCACCCTGCGCGTGG + Intergenic
1160518060 18:79489260-79489282 CTCCATGTCCACGCACAGTCAGG - Intronic
1164521610 19:28984057-28984079 GCCCATGCCCACACTGAGGCAGG + Intergenic
1164847943 19:31450253-31450275 CTCCAAGTCAAGGCTGAGCCTGG - Intergenic
1165038918 19:33055023-33055045 CTCCAAGGCCACAGTCAGCCTGG + Intronic
1165123583 19:33578955-33578977 CATTATGTCCACACTGGGCCTGG - Intergenic
1166182120 19:41116472-41116494 CTCCATGTACACAGTGCACCTGG + Exonic
1166662021 19:44653700-44653722 CTCCATGTCCCCACTGACCAAGG + Intronic
1166706057 19:44908655-44908677 CTCCATGTCCGCGCCCAGCCGGG - Exonic
1167035514 19:46993039-46993061 GTCCCTGTCCACACGGGGCCTGG - Intronic
1167513217 19:49907942-49907964 CTCCATCACCAGGCTGAGCCAGG + Intronic
925297470 2:2787424-2787446 CTCCGTGTTCATGCTGAGCCGGG - Intergenic
927206875 2:20616599-20616621 CCCGATGACCACACTGGGCCTGG + Intronic
928374375 2:30763092-30763114 CTCCATGCCTACACTGTGACTGG - Exonic
929588586 2:43131158-43131180 CACCCTGCCCACAGTGAGCCTGG - Intergenic
930632467 2:53768288-53768310 CCCCATCTCCGCACTCAGCCTGG - Intronic
933093155 2:78146183-78146205 CTCCAGGTCCTCACTGGGCCTGG - Intergenic
935573692 2:104687953-104687975 CTCCACCTTCACACTCAGCCAGG - Intergenic
936987720 2:118327421-118327443 CTGTATGTCCCCACTTAGCCAGG - Intergenic
937687595 2:124715462-124715484 CACCATGTTCCCACTGAGGCTGG + Intronic
937721148 2:125098434-125098456 GGCCATGTCGACACTGAGGCAGG - Intergenic
938106036 2:128530388-128530410 CCCCATGCCCACCCTGTGCCAGG - Intergenic
938580141 2:132638321-132638343 CTACAAGTGCCCACTGAGCCAGG + Intronic
941177956 2:162222643-162222665 TTCATTGTCCACACTTAGCCAGG + Intronic
942227722 2:173831719-173831741 GGCCATGTGCACACTGAGCAAGG + Intergenic
946086497 2:217178675-217178697 TTCCACTTCCACACTGAACCTGG - Intergenic
947523180 2:230864013-230864035 CTCCTGGTCCAGACTGGGCCAGG - Intergenic
1172188814 20:33049250-33049272 CCCCATCAGCACACTGAGCCTGG - Intergenic
1172777735 20:37417208-37417230 CTCCATGTGCACACTGGGAAGGG - Intergenic
1172956636 20:38764521-38764543 CTCTATGACCACAATGAACCTGG - Intronic
1173485882 20:43440725-43440747 CTCCTGGTCCACACCGTGCCAGG + Intergenic
1175150222 20:56928124-56928146 CTCCAAACCCCCACTGAGCCAGG + Intergenic
1177642092 21:23856855-23856877 CTCCAAGTCCCCACTCACCCAGG - Intergenic
1179056788 21:37943802-37943824 CTCCATCTCTCCCCTGAGCCTGG + Intergenic
1180128259 21:45806424-45806446 ATCCAGGGCCACATTGAGCCAGG - Intronic
1181558110 22:23683764-23683786 GTCAATGTCCACACTGATGCCGG + Intergenic
1183228205 22:36564497-36564519 CTCCATGTACACGCTCAGCAGGG - Exonic
1183722479 22:39570736-39570758 AGCCATGTCCACACTGAGCTGGG - Exonic
1185063254 22:48618054-48618076 CTCCGTGTCCACACAGAGCCTGG - Intronic
1185126905 22:49016469-49016491 CTCCCTGTGAACACTGCGCCCGG - Intergenic
1185195470 22:49466657-49466679 CTCCATCCCCTCACTGCGCCAGG - Intronic
1185211568 22:49573502-49573524 CTCCATGTCCCAGGTGAGCCTGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950573555 3:13817017-13817039 CTCAGTGTCCACACTGAGCCTGG - Exonic
952365822 3:32674081-32674103 CTCCAAGTCCCCACTCAACCCGG + Intergenic
952881169 3:37987099-37987121 CTCCATGTCAATATTGACCCAGG - Intergenic
954336963 3:49924330-49924352 CTCCCTTTCCACACTGAGCAGGG + Intronic
955575721 3:60360783-60360805 CACCATGTCTCCACTGACCCAGG + Intronic
961240207 3:125404110-125404132 TTCCATGTGCACACTGACACAGG - Intergenic
961830254 3:129619576-129619598 CTCCATGACCACACAGAGCTGGG - Intergenic
962343320 3:134602700-134602722 CTCCAGGCCCTCACAGAGCCTGG - Intronic
963686600 3:148442806-148442828 CTCCACGTCCTCATTCAGCCAGG - Intergenic
967984886 3:195087211-195087233 CTCCAGGGCCACACGCAGCCTGG - Intronic
968503170 4:960522-960544 CTCCACGTCCACACAGTGGCCGG - Exonic
968625284 4:1624134-1624156 CTCCCTGGCCCCACTGAGCAAGG - Intronic
975854217 4:78606088-78606110 CTCCAAGGCCACACTGACCAGGG + Intronic
980122842 4:128745339-128745361 CACCATGTCCACCCTGGGGCAGG - Intergenic
981573768 4:146181421-146181443 GTACATGTACACACTGAGCAAGG - Intronic
981937588 4:150251948-150251970 CTCCCTCTCCAGACAGAGCCTGG + Intronic
983473989 4:168192808-168192830 CTCCAAGTCCCCACTGACCCAGG - Intergenic
983512010 4:168619056-168619078 CTGAGTGTCCACACTGGGCCAGG + Intronic
984560445 4:181262448-181262470 CTCCATCTCCTCCGTGAGCCTGG - Intergenic
985493926 5:193879-193901 CTCACTGTCCTCGCTGAGCCGGG - Intronic
989133017 5:38126178-38126200 CTCCAGGGCCACAGTCAGCCAGG - Intergenic
990946698 5:61256682-61256704 CTTCATGTCCCCACCCAGCCTGG + Intergenic
991090766 5:62691764-62691786 CTCCATCTCCACACTGGTACGGG - Intergenic
993647495 5:90478049-90478071 TTCCTTGTCCACACTGAGGCAGG - Intronic
993716398 5:91279472-91279494 CTCCATGCCCCCACCCAGCCAGG + Intergenic
994466622 5:100142531-100142553 TTCCTTGTCCACACTGAACTGGG - Intergenic
1000408713 5:160916058-160916080 CTCCATGTTCCCACTGAGGTAGG + Intergenic
1001034184 5:168285435-168285457 CACCATCTCCACCCTGATCCAGG - Intergenic
1001732970 5:173973720-173973742 CTCCATGTACATACCGAGCACGG + Intergenic
1002998572 6:2309868-2309890 CTCCATGACCATAGAGAGCCAGG - Intergenic
1005327855 6:24720184-24720206 CTCCCTGTCCCCGCGGAGCCCGG + Exonic
1006454983 6:34126527-34126549 CTCCAGGTCCCCACTGACTCAGG - Intronic
1007904895 6:45449684-45449706 CTGCATGCCCACTCTGTGCCAGG - Intronic
1011069462 6:83364590-83364612 TTCCATGTGCTCACTGATCCAGG + Intronic
1017692218 6:156978203-156978225 CTCCATTTCCAGACTCTGCCTGG + Intronic
1018359752 6:163055199-163055221 CTCCATTTCCACACTGTCCCCGG - Intronic
1018733902 6:166673212-166673234 CTCCACGTGCACACAGACCCAGG + Intronic
1018924265 6:168195402-168195424 CCCAAGGTCCACCCTGAGCCTGG - Intergenic
1019743052 7:2684652-2684674 CGCCCTGTCCACACTGCACCCGG - Intronic
1021110588 7:16689994-16690016 CTCCAAGTCAACACAGATCCAGG - Intronic
1022258166 7:28679931-28679953 CTCCATCTCCCCAAAGAGCCAGG + Intronic
1023998985 7:45178651-45178673 CTCCTGGTCCTCAGTGAGCCTGG + Intronic
1029728715 7:102425552-102425574 GGCCATCTCCTCACTGAGCCTGG - Exonic
1030037445 7:105419990-105420012 CTCCATTTCCAACCTGAGCCGGG + Intergenic
1031467573 7:122132393-122132415 CTCCATGTAAAAACTGATCCAGG + Intronic
1032240209 7:130154060-130154082 CTCCGTGTCCTCAGTGAGGCAGG + Intergenic
1033592295 7:142819858-142819880 CTCAAAGTCCACACGGGGCCGGG + Intergenic
1034160829 7:148993273-148993295 CTCCCTGACCCCACTGTGCCCGG - Intergenic
1034557833 7:151861132-151861154 CTCCTTATTCACACTGAGACAGG - Intronic
1035220545 7:157403880-157403902 CTTCCTGTCCACCCTGACCCAGG + Intronic
1035418632 7:158709259-158709281 CTCCAGGGCCACACAGGGCCTGG + Intergenic
1038036142 8:23688473-23688495 CTCTATGTCCCAACTGACCCTGG - Intergenic
1039440969 8:37595111-37595133 CTGCATGTCCAGACAGATCCGGG + Intergenic
1039457345 8:37716251-37716273 CTCCATGCCCAGTCTGTGCCTGG + Intergenic
1040277727 8:46022494-46022516 CTCCATGACCACATGGGGCCTGG + Intergenic
1042821748 8:72937127-72937149 CTTCATGTCCACAATGACCTCGG - Exonic
1042862417 8:73327768-73327790 CTGCATGTCCACCTTGACCCAGG - Intergenic
1049468279 8:142763720-142763742 TTCCATGTCCACCCTGAGATGGG + Intergenic
1049574980 8:143385778-143385800 CCCCATGCCCACGCGGAGCCAGG + Intergenic
1050182195 9:2933866-2933888 CTTCATGTCCTCACTGGGCCCGG - Intergenic
1050364430 9:4861243-4861265 CTCCATGTCCACTGTGAGACAGG - Intronic
1050541228 9:6672036-6672058 CTACATGTCCATATTGAGTCTGG - Intergenic
1051259999 9:15253971-15253993 CTCAATGTTGACACTGAGCCAGG - Intronic
1052861600 9:33441073-33441095 CCGCATGCCCACACTGACCCAGG - Intergenic
1053412292 9:37923512-37923534 CGCCTTGTCCACACACAGCCAGG + Intronic
1054971753 9:71095892-71095914 CTCCATGTCCACTCTGTCTCTGG - Intronic
1058510555 9:105712968-105712990 CTCCAGGTCCTCACTGGGCCTGG - Intronic
1059453142 9:114383355-114383377 CTCTATGCCAGCACTGAGCCAGG + Intronic
1060901605 9:127262785-127262807 CTGCATGTCCACTATGTGCCAGG + Intronic
1061201235 9:129139663-129139685 CTCCAGGTCCCCAGTGAGCTAGG - Intronic
1061226565 9:129284065-129284087 CTGCCTGTCCACACTGAGTGCGG + Intergenic
1061970661 9:134043362-134043384 CTCCCTGTCTTCAGTGAGCCTGG - Intronic
1061999004 9:134206712-134206734 CTCAGTGCCCACCCTGAGCCAGG + Intergenic
1062179365 9:135182738-135182760 CTCCCTCTTCACACTCAGCCTGG + Intergenic
1203775991 EBV:73496-73518 GGCCACGTCCACACTGAGCCCGG + Intergenic
1186094581 X:6085777-6085799 CTCCATGCCCACACGGCACCTGG + Intronic
1191255429 X:58277603-58277625 CTCCATGACCCCACTGGGTCAGG + Intergenic
1196559486 X:117128084-117128106 CTTCAGTTCCACACTGAGCTTGG - Intergenic
1196943242 X:120798275-120798297 CTCAATGACCACACTCAGCATGG + Intergenic
1197786844 X:130207036-130207058 CTCCATTTCCAACCTGATCCTGG - Intronic
1198496585 X:137199404-137199426 CCCCATCTCTACCCTGAGCCAGG - Intergenic
1202018301 Y:20435074-20435096 ATCCATGTCCTCACTGGGCCTGG + Intergenic