ID: 1142338651

View in Genome Browser
Species Human (GRCh38)
Location 16:89506979-89507001
Sequence CAGTGTCAGCCCTGGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142338651 Original CRISPR CAGTGTCAGCCCTGGGTGTA GGG Intronic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
901510389 1:9715494-9715516 CAGTGGCTGCCTTGGGTGGAGGG + Intronic
904605375 1:31695202-31695224 CAGTGTCCGCCCTGTGTCCATGG - Exonic
905263550 1:36735633-36735655 CAGGGCCTGCCCTGGGGGTAAGG + Intergenic
905923812 1:41736081-41736103 CAGTGCCCGCCCAGGGTGTCTGG + Intronic
906086860 1:43143684-43143706 CAGTCTCAGCCCTACGTTTATGG + Intergenic
908685289 1:66711649-66711671 CATTGTCATCCCTGGGCATAAGG + Intronic
909979998 1:82087593-82087615 CAATGTCAGCCATGAGTATATGG + Intergenic
910363432 1:86438158-86438180 CAGTGTCATCCCTGAGTGGGTGG + Intronic
911316228 1:96359663-96359685 CTGTGTCAAGCTTGGGTGTAGGG - Intergenic
914850681 1:151311693-151311715 CATTGACAGCCCTGGGGGAAGGG + Intronic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
916880880 1:169018599-169018621 CTGGGACAGCCCTGGGAGTAGGG - Intergenic
919502843 1:198359521-198359543 CAGAGTCATCCCAGGGTGTTTGG - Intergenic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
1066047529 10:31606347-31606369 CAGTGACAGCCATGGGAGAAAGG - Intergenic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1067479031 10:46583686-46583708 CAGAGTCAGGCGTGGGGGTAGGG - Intronic
1067615707 10:47758115-47758137 CAGAGTCAGGCGTGGGGGTAGGG + Intergenic
1069616660 10:69810829-69810851 CAGCCACAGCCCTGGGTGTGGGG + Intronic
1071273897 10:84035069-84035091 CAGTGTCAGCACTTGGTGCTTGG + Intergenic
1072189912 10:93070650-93070672 CAGTGTCAGCCCAGGTTGGAAGG - Intergenic
1073119769 10:101114417-101114439 AAATGTCAGCCCTGGGGGGAGGG - Intronic
1074776488 10:116771413-116771435 CAGTGACAGGCCTGGGTGAAGGG + Intergenic
1075068366 10:119304718-119304740 CAGAGCCAGCCCTTGGTGGATGG - Intronic
1075068929 10:119308122-119308144 CAGGGTCAGAGCTGGGTCTAAGG + Intronic
1075188481 10:120284650-120284672 CCATGTCAGCCCTGGGTGTGGGG - Intergenic
1076401518 10:130188598-130188620 CAGGGACAGCACTGGGTGCAGGG + Intergenic
1077413588 11:2414468-2414490 CAGTGTATGCCCGGGGTGTGAGG + Intronic
1078396865 11:10989089-10989111 CAGTGTGTTTCCTGGGTGTAAGG - Intergenic
1079518642 11:21298647-21298669 CAGTTTCTGCCCAGGGTCTATGG + Intronic
1080139421 11:28898246-28898268 CTGTGTCACCCCTAGGTTTAGGG + Intergenic
1082931600 11:58613268-58613290 CTGTGTCAGCCCATGGTGGAAGG + Intronic
1083445900 11:62707877-62707899 CAGTAGCAGCCCTGGGTGTAGGG - Exonic
1083899287 11:65635957-65635979 CACTGTCAGCTCTGGGGGTAAGG - Intronic
1084757318 11:71248079-71248101 CAGAGCCTGCCCTGGGTTTAGGG - Intronic
1089582599 11:119490764-119490786 GGGTCTCAGCCCTGGGTGTTGGG - Intergenic
1090085258 11:123644916-123644938 CAGTGTCAGTTCTGGGTGGTTGG - Intronic
1091665469 12:2415674-2415696 CAGTTACAGCCCTGTGTGTTCGG + Intronic
1095142587 12:38684559-38684581 TGGGGTCAGCCCTGGGTGCAAGG + Intronic
1095983046 12:47983539-47983561 CAGTGACAGCCAGGGGTGCAGGG + Intronic
1096606313 12:52768919-52768941 CAGTGGCAGCACTGGGGGCAGGG - Exonic
1099748351 12:86736584-86736606 GAGAGTCAGTCCTGGGTGTTTGG - Intronic
1099810120 12:87569749-87569771 CACTGTCATCCCTGGGGCTAGGG - Intergenic
1103905859 12:124326916-124326938 CTGTCTCAGCCCTGGGAGTCAGG - Intronic
1104020261 12:124987516-124987538 AAGTGTCAGCCCAGTGTCTACGG + Intronic
1104587755 12:130061268-130061290 CACTGTGAGCCCTGAGTGGATGG + Intergenic
1104652415 12:130545583-130545605 CAATGTCAGCCTTGAGTGTGAGG - Intronic
1105812117 13:24004682-24004704 AATTTTCAGCCCTGTGTGTATGG - Intronic
1105874633 13:24541197-24541219 GAGGGTGAGCCCTGGGTGTGGGG - Intergenic
1106813877 13:33386488-33386510 CTTTCTCAGCCCTGGGTGTGTGG + Intergenic
1113507641 13:110828143-110828165 CAGTGTCTGCTGAGGGTGTATGG + Intergenic
1113779010 13:112965407-112965429 CAGAGCCAGCCCTGGTTGTCCGG + Intronic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1118753344 14:68821792-68821814 CAGTGTCAGAACAGGGTGTGTGG - Intergenic
1122164236 14:99809566-99809588 CCATCCCAGCCCTGGGTGTATGG + Intronic
1122626497 14:103087879-103087901 CAGTCCCAACCCTGGGGGTAGGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1132456146 16:24194-24216 CAGCGGCATCCCTGGGTGTGAGG + Intergenic
1132568397 16:633557-633579 CAGTGCCATCCCTTCGTGTACGG + Exonic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1134278070 16:12794209-12794231 CAGTTTCAGCACGGGGTGCAGGG + Intronic
1136188521 16:28601767-28601789 CACTGTCAGCCCTGCTTGTCAGG - Intergenic
1136190990 16:28614761-28614783 CACTGTCAGCCCTGCTTGTCAGG - Intronic
1136252473 16:29014927-29014949 CTGTGTCAGCCCATGGTGGAAGG - Intergenic
1137282740 16:46992330-46992352 CAGCGGCAGGCCTGGGTGGAAGG - Intergenic
1137572673 16:49577093-49577115 CATTGTCTGCCCTGGGTGGTTGG - Intronic
1138809039 16:60127442-60127464 CAGAGTCAGCCCTAGGGGGAAGG - Intergenic
1141195314 16:81856217-81856239 CAGTCTCTGCCATGGGTGTACGG + Intronic
1141355018 16:83337304-83337326 CAGTTTCAGCCTTGAGTTTAGGG - Intronic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1145126053 17:20300866-20300888 CTGAGTCAGCCCTGGATGTCTGG + Intronic
1146266140 17:31454094-31454116 CAGTCTCTGCCCTGGGAGAATGG - Intronic
1147186347 17:38715407-38715429 CTGTGGCACTCCTGGGTGTAAGG - Intronic
1148496052 17:48054245-48054267 CAGTGAGAGCCCTGGGGGAAGGG - Intronic
1148771526 17:50070095-50070117 CAGCAGCAGCCCTGGGTGCAGGG + Intronic
1148864606 17:50622071-50622093 CCGTGTCACTCCTGGGTGTCTGG - Intronic
1152305729 17:79519254-79519276 GAGTGTGAGCCCTGGGGGTGGGG - Intergenic
1155991733 18:32285369-32285391 CATGGACAGCCCTGGGTGTCAGG - Intronic
1157447410 18:47755809-47755831 GAGTGTCAGGCCTTGGTGTTTGG - Intergenic
1157486301 18:48089898-48089920 CAGTGTCAACCCTGCGTGATCGG - Intronic
1157607091 18:48932734-48932756 AGGTGTCAGCCCTGTGTGTGAGG - Intronic
1159892340 18:73964499-73964521 CAGTTTCAGCCATGGCTGAAAGG - Intergenic
1160968549 19:1757361-1757383 CAGTCTCAGCTCTGGGAGTCTGG + Intronic
1161238186 19:3208204-3208226 CAGTGCCAGCCCTGGGGTTCTGG + Exonic
1161373756 19:3928369-3928391 CAGTGTCCCCACTGGGTGGATGG - Intergenic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162439124 19:10681902-10681924 CAGAGGCAGCCCTGGGGGTTAGG + Intronic
1162457451 19:10794303-10794325 AAATGTCAGCCCTGGGTGCTAGG + Intronic
1163149095 19:15400683-15400705 CTGTGTCAGCTCTGCGTGCATGG - Intronic
1163568059 19:18063514-18063536 CAGTGTCAGACCAGGGAGAAGGG + Intronic
1163592623 19:18203019-18203041 CGGGCTCAGCCCTGGGTTTAGGG - Intronic
1164614724 19:29660182-29660204 CAGTGTCAGCCTTTGGGGTCTGG - Intergenic
1164745795 19:30611927-30611949 CAGTGGCAGCCCTGGGAGTTAGG + Intronic
1165978093 19:39694560-39694582 CATTGACAGCCATGTGTGTAGGG + Intergenic
1166381207 19:42356267-42356289 AAGTGCCAGGCCTGGGTGTAGGG - Intronic
1166689657 19:44814759-44814781 CTGTGAGAGCCCTGGGTGAACGG + Exonic
1167304127 19:48696992-48697014 CAGGGCCGGCGCTGGGTGTAGGG + Intronic
1168129135 19:54306250-54306272 CAGGGTCATCCCTGGGTTGAGGG - Intergenic
925807738 2:7667908-7667930 CAGAGTCAGCACTGGAGGTATGG + Intergenic
926415084 2:12642039-12642061 CAGTGTCGGCCCTGGGTGCTTGG - Intergenic
926433789 2:12817663-12817685 CTGCCTCAGCCCTGTGTGTAAGG - Intergenic
927702634 2:25277506-25277528 CTGTGTCAGCCCTGCGGCTAGGG + Intronic
935634140 2:105237100-105237122 CAGTTTCAGCGCTGGGAGGAAGG + Intergenic
937354205 2:121187864-121187886 AAATGCCAGCCCTGGGTGTGGGG - Intergenic
937879068 2:126851500-126851522 GAGTGTCAGCTCTGAGTGTGTGG - Intergenic
938618485 2:133023948-133023970 GAGAGCCAGTCCTGGGTGTAAGG - Intronic
938924002 2:136022575-136022597 CAGCTTCTGCCCTGGGTGCAAGG - Intergenic
940042585 2:149376131-149376153 CAGTGTCAGCCCGGGATGTGTGG + Intronic
944609710 2:201390149-201390171 CACTGTCAACACTGGGTTTATGG - Intronic
945165136 2:206935335-206935357 AGGTGTCAGATCTGGGTGTAAGG - Intergenic
946187808 2:217991074-217991096 CAGAGTCAGCCCTGGGTAGAAGG + Intronic
948290098 2:236818234-236818256 CAGGGCCAGGCCTGGGTGTGTGG + Intergenic
1168827443 20:823254-823276 CTGTGCCAGCCCTGGGTAGAGGG + Intergenic
1169037159 20:2462903-2462925 CATTGGGAGCCCTGGGTGTTAGG - Intronic
1171230105 20:23477365-23477387 CAGTGTGAGCCCTCTGTGTGTGG + Intergenic
1173515552 20:43663204-43663226 CAGGGTCAGGCCTGGGGGTTGGG + Intergenic
1175524058 20:59621443-59621465 CAGTGTCAGGGCTGGGAGCATGG + Intronic
1175531622 20:59677000-59677022 CAGGATCAGCCCTGGGTTTCTGG + Intronic
1175731747 20:61358883-61358905 CAGTTTCAGCCCAGGGTGACGGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1184113362 22:42408415-42408437 CAGCAACAGCCCTGGGTGTGAGG - Intronic
1184665931 22:45989078-45989100 CAGCCTCAGCCCTGGGTGCTGGG - Intergenic
1185216835 22:49605612-49605634 CTGTGTCAGCCCATGGTGGAAGG - Intronic
949543362 3:5051519-5051541 CAGAGGCAGCTCTGGGTGTGAGG - Intergenic
949924765 3:9032422-9032444 AATTCTCAGCCCTGGGGGTAGGG - Intronic
950437894 3:12991725-12991747 CAGTTTCAGCCATTGGTATAAGG - Intronic
953777077 3:45828794-45828816 CATTGTCAGCCCTGGGTACGTGG + Intronic
956700115 3:71951459-71951481 AAGTATCAGCCCTGGCTGGAAGG + Intergenic
960388099 3:117045315-117045337 CAGTGTCAGCCTCGGCTGCAGGG - Intronic
961075703 3:123979915-123979937 AAGCGACAGCCCTGGGTGGATGG - Intronic
961307982 3:125972599-125972621 AAGCGACAGCCCTGGGTGGATGG + Intronic
961502893 3:127350218-127350240 CAGCGCCAGGCCTGGGTGCAGGG + Intergenic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
966853508 3:184178536-184178558 TAGGGCCAGCCCTGGGAGTAAGG + Intronic
968498441 4:931958-931980 CAGCGTCAGCCCGGAGTGGAAGG - Intronic
969351758 4:6602162-6602184 CAGTGCAAGGCCTGGGTGCAGGG - Intronic
974455959 4:62129720-62129742 CAGTGTCAAGCCTGGGTCTTAGG - Intergenic
975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG + Intronic
976134957 4:81925642-81925664 TAGTGTCAGTGCTGGGAGTAGGG - Intronic
976321652 4:83723832-83723854 CAGTTTTAGAACTGGGTGTATGG - Intergenic
978546140 4:109874523-109874545 CACTTTCAGCCCTGGTTGTAAGG - Intergenic
981533252 4:145773497-145773519 GATTGCCAGCCCTGGGTGTTGGG - Intronic
981748446 4:148072209-148072231 CACAGTCAGCCCTGGGGGTGGGG + Exonic
982284585 4:153722005-153722027 GAGAGTCAGCCCTGGGTGAAAGG - Intronic
982421663 4:155206343-155206365 CAGTGTCACAACTGGGTTTATGG + Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
983914373 4:173275821-173275843 CAGTGTTTGCCATGTGTGTAGGG - Intronic
984278729 4:177641069-177641091 CAGCCTCAGCCATGGTTGTAGGG - Intergenic
985581227 5:696175-696197 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
985595852 5:787507-787529 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
995177787 5:109198582-109198604 AAGTGTCAGCCCTGGGAGAAAGG - Intergenic
998953567 5:147415577-147415599 GAGTGTGAGCACTGGATGTAGGG - Intronic
999553911 5:152720522-152720544 CTGTGGCAGCCTTGGGGGTAAGG + Intergenic
1001878053 5:175217910-175217932 CTGTGGCTGCCCTGGCTGTACGG - Intergenic
1002443062 5:179274229-179274251 CAGTGTGAGACCTTGGTTTATGG - Intronic
1006109558 6:31736393-31736415 AAGGGACAGCCCTGGGTCTAGGG - Intronic
1010765446 6:79773438-79773460 AAGTCTCAGCCCTGGTTTTAAGG - Intergenic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1013186828 6:107766703-107766725 CTGTTCCAGCCCTGGGTGCATGG + Intronic
1015200764 6:130577630-130577652 GAGAGTAAGCCCTGGGTGTCAGG - Intergenic
1016466789 6:144333673-144333695 CAGTTTCAGCCAGGGGTGGACGG + Intronic
1017539430 6:155385236-155385258 CAGTCACAGGCCTGGGTGTCGGG - Intergenic
1018031523 6:159845339-159845361 CACTCTCAGCCCTGGGCTTATGG + Intergenic
1018038198 6:159899366-159899388 CAGTGACAGCCTGGGGTGGAGGG - Intergenic
1019285831 7:222487-222509 CAGTGCCAGCCCTGGGCCTGGGG - Intronic
1019324822 7:432898-432920 CTGGGCCAGCCCTGGGTGGAGGG - Intergenic
1019354857 7:573134-573156 CAGTGTGACCCCGGGGTGCAGGG - Intronic
1019409170 7:899167-899189 CAGTGGTGGCCCTGGGTGGACGG + Exonic
1022951121 7:35339115-35339137 CAGTGTCAATCCTGAGAGTAAGG - Intergenic
1024238914 7:47418964-47418986 CAGAGTCAGCCATGGCTGCAGGG + Intronic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024374072 7:48618210-48618232 CAGAGTCAGGCATGGGTTTACGG - Intronic
1026953626 7:74363430-74363452 CAGGGGCAGCCCTGGGAGTGGGG + Intronic
1029735211 7:102461910-102461932 GAGTGGCAGCCCAGGGTGTGAGG - Intronic
1031771314 7:125847986-125848008 CAGCTTCAGCTCTGGGTATAAGG + Intergenic
1035023655 7:155813211-155813233 CAGTGTGTGCGCTGGGTGTGTGG + Intergenic
1036643434 8:10598060-10598082 CACTGTGACCCCTGGGTGCATGG + Intergenic
1038210795 8:25517589-25517611 CAGTGTCAGCACTCTGTCTAAGG + Intergenic
1038356011 8:26830141-26830163 CAGGGTCAGCTCTGGGTGGGAGG - Intronic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1042430480 8:68700615-68700637 CAGTATCAGACCTTGGTGTCTGG + Intronic
1042591574 8:70402984-70403006 CCGTGTCAGCCCCGGGGGTGGGG - Intronic
1042680309 8:71376312-71376334 CAGGGCCAGGGCTGGGTGTAGGG + Intergenic
1045171547 8:99676196-99676218 GTGTGGCAGGCCTGGGTGTAGGG - Intronic
1046284164 8:112073768-112073790 CTGTCTCAGCCCTGGTTGCAGGG - Intergenic
1049557931 8:143292709-143292731 CTGCGTCAGCCCTGGGTGGAGGG + Intronic
1050603018 9:7271875-7271897 CAGTGGCTGCCCTTGGTTTAGGG + Intergenic
1051352932 9:16215322-16215344 CAGAGACATCCCTGCGTGTACGG + Intronic
1056103842 9:83327464-83327486 CAGTGTCATCCCTGGCTCTCTGG + Intronic
1056385324 9:86092023-86092045 CAGTGTCAGACATGGCTGTGAGG - Intronic
1059779288 9:117508874-117508896 CTGTGCCAGTCCTGGGTGGATGG + Intergenic
1060978517 9:127779216-127779238 CGGGTTCAGCCATGGGTGTAGGG + Intergenic
1186429917 X:9496438-9496460 CTGTGTCAGCCCTGGGGGAGAGG - Intronic
1186913018 X:14189939-14189961 CAGCTTCATCCCTGGGTGCAAGG - Intergenic
1190370922 X:49739886-49739908 CAGTGTGAACCCTGGGTGAAGGG + Intergenic
1200046969 X:153408373-153408395 TAGTGTCAGGCCTGGGTGCCAGG - Intergenic
1200400218 X:156015530-156015552 CAGCGGCATCCCTGGGTGTGAGG - Intergenic
1201065429 Y:10091030-10091052 CACTGGCAGCTCTGGGTGTGTGG - Intergenic
1201147153 Y:11071367-11071389 CAAAGTCAGCCCTGGCTGTGAGG - Intergenic