ID: 1142340447

View in Genome Browser
Species Human (GRCh38)
Location 16:89518765-89518787
Sequence TAGGGGTTAAGGATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 1, 2: 7, 3: 87, 4: 662}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142340447 Original CRISPR TAGGGGTTAAGGATGGGGGA AGG Intronic
900000109 1:10313-10335 TAGGGGTTAGGGTTGGGGTTGGG - Intergenic
900141629 1:1141356-1141378 ATGGGGGTAAGGATGGGGGCAGG - Intergenic
900607110 1:3528707-3528729 TAGGCTTTGAGGATGGAGGAGGG + Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
901838537 1:11939346-11939368 TGGGGATGAAGGATGGGGGAGGG + Intronic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
902693578 1:18125824-18125846 TGGGGGTTCAGGATTGGGCAGGG + Intronic
903397052 1:23009615-23009637 TAGGTGCTACGGGTGGGGGAGGG + Intergenic
903525131 1:23987359-23987381 CATGGATCAAGGATGGGGGATGG + Intergenic
903642577 1:24870143-24870165 CAGAGGTTAAGAATTGGGGAGGG - Intergenic
903706907 1:25292635-25292657 TTAGGGTTAAGGTTGGGGGAGGG + Intronic
903827620 1:26156952-26156974 AAGGGGTTAAGCATGGGAGGTGG - Intergenic
904526272 1:31136204-31136226 TATGGGTACAGGATGGGGGGTGG - Intergenic
904809955 1:33157014-33157036 AGGGGGTGAAGGATGGGGGCTGG - Intronic
906001512 1:42430351-42430373 GAGGGGTAAAGGAGGGGGTAGGG - Exonic
906307144 1:44726630-44726652 TATGGGCTCAGAATGGGGGAAGG - Intergenic
906715501 1:47965560-47965582 TTGGGGTTGGGGCTGGGGGAGGG - Intronic
907487354 1:54787077-54787099 TGGGGGTGAAGGGTGGGAGAGGG + Intronic
908129024 1:61056289-61056311 GAGGGAATAATGATGGGGGAGGG - Intronic
908416312 1:63916362-63916384 TAGGGGTTAAGGGAGTGGTAGGG + Intronic
909432244 1:75602436-75602458 GAGTGGTTAAGGATTGTGGAGGG + Intronic
910144920 1:84068584-84068606 TAGGGGGAAAGGGTGGGAGAGGG - Intergenic
910288449 1:85578457-85578479 TGGAGGTTGGGGATGGGGGACGG - Intergenic
910572288 1:88718975-88718997 TGGGGGTTTAGGAATGGGGAGGG - Intronic
910680531 1:89859506-89859528 TCGGGGTTAAGGATTGTGAATGG + Intronic
912413240 1:109491909-109491931 AAAGGGTTAGGGATAGGGGAAGG - Intronic
913303710 1:117400512-117400534 CAGGAGTTATGGATGAGGGATGG - Intronic
913544367 1:119852999-119853021 TTGGGGTGAGGGCTGGGGGAGGG + Intergenic
913972587 1:143425469-143425491 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
914066971 1:144251082-144251104 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
914112182 1:144715272-144715294 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
915107220 1:153542087-153542109 TAGAGGTTGTGGATTGGGGAGGG + Intergenic
915938410 1:160102777-160102799 TAGGGTTCAAGAATGGGGGCAGG - Intergenic
916177140 1:162051790-162051812 CACGGGTTAGAGATGGGGGATGG + Intergenic
916686137 1:167148677-167148699 AGGGGGCTAGGGATGGGGGATGG + Intergenic
917162482 1:172073546-172073568 TAGGGGATAAGGATCATGGATGG + Intronic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917589233 1:176459841-176459863 TATGGGTAGAGGATGGGGGGGGG + Intergenic
918113948 1:181481888-181481910 TGGGAGTAAAGGATGGGGGGCGG + Intronic
918206858 1:182317208-182317230 AAGGGGTTAGGGATGGAGAAGGG - Intergenic
918216316 1:182394485-182394507 TGGGGGTGAAGAATGGGGGCGGG - Intergenic
918461368 1:184780262-184780284 TAGTAGCTAGGGATGGGGGAGGG - Intergenic
918486482 1:185034309-185034331 TAGTGGTTAAGGGTGGGGTCAGG + Intergenic
919240814 1:194914172-194914194 TATGGGTACAGGATGGGGGGCGG - Intergenic
919708518 1:200702945-200702967 CAGGGGTTAAGGACAGGGGTAGG + Intergenic
919847860 1:201652683-201652705 TAGGGGGTAAGGATGAGCCATGG - Intronic
919910171 1:202106376-202106398 GGGGAGTGAAGGATGGGGGAAGG - Intergenic
920116662 1:203626563-203626585 TAGGGGTGGAGGAGGGGTGAGGG - Exonic
920200255 1:204255834-204255856 GAGGGGTTGAGGATGTGGGCAGG + Intronic
920278966 1:204829049-204829071 AAAGGGTTGAGGATGCGGGAAGG - Intronic
920307646 1:205029429-205029451 TAGGGGTTAGGGATGAGGAGGGG + Intergenic
920370627 1:205477351-205477373 TAGGGGTGGGGGATGGGGGCAGG - Intergenic
920719050 1:208369914-208369936 TAGGGGTTGGGGATGGGGCAGGG + Intergenic
920740457 1:208576970-208576992 TGGGGGTTGAGGATGGGTGGTGG - Intergenic
920890837 1:209984259-209984281 GGGGGCTGAAGGATGGGGGATGG + Intronic
922275320 1:224072191-224072213 TAGGGGTTGGGGTTGGGGCATGG + Intergenic
922447846 1:225712592-225712614 TAGGGGATGGGGATGGGGTAGGG - Intergenic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
924876525 1:248111082-248111104 TACGGGTTAAAGATTGGGAATGG - Intergenic
924957985 1:248946146-248946168 TAGGGGTTAGGGTTGGGGTTGGG + Intergenic
1062765844 10:64361-64383 TAAGGGTTAAGGGTTGGGGTTGG - Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063131848 10:3185269-3185291 TATGGGTACAGGATGGGGGCAGG - Intergenic
1063700436 10:8379214-8379236 TAGGGATTAAGGTTGGGGGTGGG + Intergenic
1065251412 10:23818739-23818761 CAGGGCTTAAGGAAGTGGGAAGG + Intronic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1066253312 10:33654847-33654869 GAGGGATTAAGGATGGAGGCAGG - Intergenic
1067802086 10:49366052-49366074 TAGGGGCTGAGGCTGGGAGAAGG + Exonic
1067955111 10:50782599-50782621 TTGGGGTGGGGGATGGGGGAGGG - Intronic
1068521666 10:58083913-58083935 TAGGGGTGAGGGATAGGAGAGGG - Intergenic
1068659041 10:59604444-59604466 TAGGGGTGAAGGAAAGAGGAGGG + Intergenic
1070475040 10:76821444-76821466 TGTGGGTTAAGGTGGGGGGATGG - Intergenic
1070555082 10:77521327-77521349 TAGGGGTGGAGGATGGAAGATGG - Intronic
1071070965 10:81693461-81693483 TCGGGGTAAAGGATGAGAGATGG + Intergenic
1071438395 10:85667942-85667964 TAGGGCTTAGGGATGGGGAATGG - Intronic
1071788629 10:88931414-88931436 AAGGGGTTAAGGTTTGGGAAGGG - Intronic
1071998157 10:91166970-91166992 TAGGTGGTCAGGATGGGGGAGGG + Intronic
1072199108 10:93142906-93142928 TAAGGGTTTAGGAAGGGGGTAGG + Intergenic
1072400007 10:95087855-95087877 TAGGGGCAAGAGATGGGGGAGGG + Intergenic
1072465047 10:95655977-95655999 CAGGGGATAATGATGGGGGAAGG + Intronic
1072545206 10:96431989-96432011 TAGGGATGAAGGATGGGAGAAGG + Intronic
1073153951 10:101331674-101331696 TTGGGGTGAGGGAGGGGGGAAGG + Intergenic
1073283738 10:102374378-102374400 TAAGGATTAGGGATGGGGGCAGG + Intronic
1073387828 10:103142139-103142161 CAGGGGGCAAGGATGGGGGAAGG + Intronic
1074100799 10:110353721-110353743 TTGGGGGTGAGGTTGGGGGAGGG - Intergenic
1074408400 10:113201336-113201358 CTGGGGTTCAGGATGGGGTAGGG - Intergenic
1074859768 10:117501554-117501576 CAGGGGTTGAGGATGGGGGCAGG + Intergenic
1074882089 10:117667321-117667343 TAGGGGTGCAGGATGGGGGCAGG + Intergenic
1074916323 10:117959391-117959413 CAGGGGTTAGGGCTGGGGAAAGG + Intergenic
1075797012 10:125127883-125127905 TAGGGGTTGAGATTGGGGGAGGG - Intronic
1076033389 10:127178023-127178045 TAAGGGCTAAGGATGTGGGGAGG - Intronic
1076281643 10:129251414-129251436 TGTGGGTTAAGGCTGTGGGACGG - Intergenic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076963646 10:133787128-133787150 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
1077108689 11:852831-852853 CAGGGGTTAAGGTGGTGGGAGGG + Intronic
1077383636 11:2258975-2258997 GAGGGGTGAAGGGTGAGGGAGGG + Intergenic
1077538305 11:3134830-3134852 GAGGGGCTGAGGGTGGGGGAGGG + Intronic
1077751455 11:4974952-4974974 CAGGGGTTGAGGTGGGGGGAGGG + Intronic
1078258631 11:9683289-9683311 TGGGGGTGAGGGGTGGGGGATGG + Intronic
1078427452 11:11263493-11263515 TGGGGGATGAGGATGGGGAAAGG - Intergenic
1079490445 11:20983337-20983359 GATGGGTTGGGGATGGGGGATGG - Intronic
1080159623 11:29157858-29157880 CAGGGATTATGGATGGGGGAGGG + Intergenic
1080194475 11:29592712-29592734 TTGGGGTGGTGGATGGGGGAAGG + Intergenic
1080845651 11:36024626-36024648 TGAGGGTGCAGGATGGGGGAAGG - Intronic
1081217214 11:40416357-40416379 TAGGGGATCAAGATGGGGGTTGG + Intronic
1081337754 11:41887716-41887738 TGGGGTTTGGGGATGGGGGAGGG + Intergenic
1081647199 11:44798474-44798496 CAGTGGTTAAGCTTGGGGGAAGG - Intronic
1082099181 11:48157713-48157735 TAGGGGCTGAGGATGGAGGAGGG + Intronic
1082795589 11:57376268-57376290 TAGGGGTGGGAGATGGGGGATGG - Intergenic
1082900082 11:58238926-58238948 TTTGGGTTAAGGATGGAGTAGGG + Intergenic
1083310051 11:61779425-61779447 TAGGGGTGCGGGGTGGGGGAAGG + Intronic
1083984027 11:66198581-66198603 CAGGGGTTAGGGGTGGGGGTGGG + Intronic
1084288069 11:68144699-68144721 TGGGGGTGAAGGATGTGGGAGGG + Intergenic
1084525789 11:69697287-69697309 CAGGGATTAGGGATGGTGGAGGG - Intergenic
1084991613 11:72930808-72930830 TAGGGGTTGAGGAGGAGGTAGGG + Intronic
1085344156 11:75756133-75756155 TAGGGGTTGGGGATGAGGGGAGG + Intergenic
1085641385 11:78195217-78195239 TAGGAATTAAGGGTGGGGGATGG + Intronic
1085741923 11:79084695-79084717 AGGGGGTTAGGGATGGGGTAGGG + Intronic
1086040647 11:82473157-82473179 TAGGAGTTAAGTATTGGGGAGGG - Intergenic
1086048524 11:82561472-82561494 TAGGGTTTAAGGATGGGGACAGG - Intergenic
1086150057 11:83599270-83599292 GAGGGGTTAGGCATGAGGGAAGG - Intronic
1086512076 11:87569790-87569812 TAGGGGGAAGGGATGGGAGATGG + Intergenic
1086597020 11:88584998-88585020 CAGGGGTGAAGGGTGGGAGAAGG - Intronic
1086832479 11:91582940-91582962 TGGGGGTGGGGGATGGGGGAGGG + Intergenic
1087393949 11:97573152-97573174 CAGGGGTTAAAGATGAGTGAAGG + Intergenic
1087641113 11:100754727-100754749 TAGGAGTTTAGAATGGGGTATGG - Intronic
1087871544 11:103299561-103299583 TTGGCTTTAAGGATGGAGGAAGG - Intronic
1088370855 11:109087197-109087219 TGGGGGTTGGGGATTGGGGACGG - Intergenic
1088378060 11:109163264-109163286 CAGGGGGTGAGGTTGGGGGATGG - Intergenic
1088412214 11:109546965-109546987 TAGAGGTTCAGAATGGGGAAGGG + Intergenic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089519045 11:119051681-119051703 TCTGGGGTAAGGATGGGGGTGGG + Intronic
1090044328 11:123317453-123317475 TAGGGGTTGAGGATATGGGGAGG + Intergenic
1090206474 11:124887142-124887164 CAGGGGCTAAGGATGGGGATGGG + Exonic
1090943582 11:131410021-131410043 GAAGGGTGAAGGATGGGAGAGGG + Intronic
1092503535 12:9071585-9071607 TGAGGGTTAAGGATGGGAGGAGG - Intronic
1093207781 12:16271123-16271145 TAGGGCTTCAGGAAGGGGGATGG - Intronic
1093343753 12:18013568-18013590 GAAGGGTTAAGGATGGAGGAGGG - Intergenic
1093667615 12:21833116-21833138 TTGGGGTGAAGGATGGAAGAGGG + Intronic
1093893563 12:24552077-24552099 TAGGGGTTGGGGAGTGGGGAAGG - Intergenic
1095990245 12:48029599-48029621 CAGGGGTCTGGGATGGGGGAGGG - Intergenic
1096459767 12:51815621-51815643 TGGGGGGCAAGGATGGGGGCTGG - Intergenic
1096842936 12:54390423-54390445 GAGAGGGTAAGTATGGGGGATGG - Intronic
1097011723 12:55957899-55957921 TAAGGGTTTAGGAAGGGGCAAGG - Intronic
1097418121 12:59339464-59339486 TGGGGTTGAGGGATGGGGGAGGG - Intergenic
1098090178 12:66893067-66893089 TTGGGGTTTAGGGTTGGGGAAGG - Intergenic
1098556117 12:71820902-71820924 TAGGGGCTAGGGGTGGGGGGTGG - Intergenic
1099109999 12:78546850-78546872 TGGGGGTTAGGGTGGGGGGAGGG + Intergenic
1099252855 12:80279436-80279458 TAAGGGTGAAGGATGGGAGGAGG - Intronic
1099329827 12:81269914-81269936 GAGGGGGAAAGGGTGGGGGATGG + Intronic
1099945034 12:89234431-89234453 CAGATGTTAAGGATGAGGGAGGG + Intergenic
1100293028 12:93235570-93235592 TATGGGTACAGGATGGGGGGTGG - Intergenic
1100366051 12:93921869-93921891 TAGGTCTGAAGGATGGGGGCTGG - Intergenic
1101038338 12:100727813-100727835 AAAGGGGTAAGGATGGGGTAGGG - Intronic
1101421601 12:104555635-104555657 CAGGGGTCCAGGATGGGGGTTGG + Intronic
1101639506 12:106577789-106577811 TAGGGGTTAGGGTTGGGGCTGGG - Intronic
1102035069 12:109766300-109766322 GAGGGGCTATGGATGGGGGCAGG + Intronic
1102053897 12:109881913-109881935 TAGTGGTGGAGGGTGGGGGAGGG - Intergenic
1103022140 12:117542585-117542607 CAGGGGTTAAATATGGGGGGAGG - Intronic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1103883355 12:124183283-124183305 TCAGGGTTAGGGATGGGGTAGGG - Intronic
1104142927 12:126005782-126005804 TAAGGGTGCAGGATGGGGAAAGG - Intergenic
1104204789 12:126628245-126628267 GAGGGGTTAGGGGTGGGGAAGGG + Intergenic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1104970044 12:132527083-132527105 TGGGGGTTGGGGCTGGGGGATGG - Intronic
1105727419 13:23178155-23178177 TAGGTGTGTAGGATGGGGGCTGG + Intergenic
1106353345 13:28956055-28956077 TTGGGGGAAAGGATGGGGGGGGG - Intronic
1106421162 13:29587576-29587598 CAGAGGTTAAGGATGGGGCCTGG - Intronic
1107020717 13:35748048-35748070 TATGGGTTAAGGAAGTGGGGTGG + Intergenic
1107194177 13:37627928-37627950 CAGGGGTTAGGGATGGGTGTGGG + Intergenic
1107861418 13:44664686-44664708 TAGGTGTCAGGGATGGGGGCAGG + Intergenic
1108250308 13:48560307-48560329 CAGGGGTTAAGGATGGGGGAGGG + Intergenic
1108665707 13:52628336-52628358 TGGGGGCTAAGGCTGGAGGATGG + Intergenic
1108679119 13:52764139-52764161 TAGGGCTCAAGGGTTGGGGAGGG + Intergenic
1108750119 13:53439863-53439885 GAGGGGTGGGGGATGGGGGAAGG - Intergenic
1109146389 13:58785032-58785054 GAGGGGTTAAGGTCAGGGGAGGG - Intergenic
1109659668 13:65441364-65441386 ATGGGGTTAGGGATAGGGGAGGG + Intergenic
1109691367 13:65895028-65895050 GAGGGGTTAGGGAGGGGAGAGGG + Intergenic
1110569960 13:76992308-76992330 TCGGCGTTGACGATGGGGGATGG + Intronic
1111482061 13:88842523-88842545 TAGGGGTTCAGGGGGAGGGAGGG + Intergenic
1111520665 13:89399045-89399067 TGGGGGTTAGGGATGAGGAAGGG - Intergenic
1112116663 13:96363000-96363022 CATGGGTTAGGGATGGGAGAGGG + Intronic
1112217856 13:97453382-97453404 CAGGGACTAAGGATGGGGAAGGG - Intronic
1112886278 13:104176651-104176673 TATGTGTTAGGGGTGGGGGACGG - Intergenic
1113453744 13:110432373-110432395 TGGGGGGTGAGGATGAGGGAAGG + Intronic
1113627473 13:111857568-111857590 TGGTGGTTAGGGATGGGGAACGG + Intergenic
1114031125 14:18582350-18582372 TAGGGGTTAGGGCTGGGTTAGGG - Intergenic
1114547016 14:23510542-23510564 TAGGGGTAGGGGATGGGAGAAGG - Intergenic
1114638773 14:24205110-24205132 TAGGGATTGAGGAAGGAGGAAGG + Intronic
1114890428 14:26914895-26914917 TCTGGGGTGAGGATGGGGGATGG + Intergenic
1115638585 14:35315653-35315675 TAGGGGTGAGGGGTGGGGGCAGG + Intronic
1115856829 14:37638612-37638634 TGGGAGTTAAGGGTGGGGGCGGG + Intronic
1116163072 14:41294465-41294487 TGGGGGTAAAGGGTGGGAGAAGG + Intergenic
1117227499 14:53677897-53677919 TGGGGGATATGGATTGGGGAAGG - Intergenic
1117291264 14:54335910-54335932 CAGGGGTTAAGGAAAGGTGAGGG + Intergenic
1117693818 14:58338565-58338587 TAGGGATGAAGGAGAGGGGATGG + Intronic
1117799681 14:59430367-59430389 TAAGGGTTAAGAATGTGGGAGGG + Intronic
1117973364 14:61274089-61274111 TGAGGGTTAAGGATAGGGCATGG + Intronic
1118693436 14:68361582-68361604 TGGGGGGTAAGGATGGAGAAAGG + Intronic
1118909504 14:70049481-70049503 CAGGGGTGAGGGATAGGGGAGGG + Intronic
1119071013 14:71584220-71584242 GAGAGGTTCAGGATGGAGGATGG + Intronic
1119162725 14:72466708-72466730 TAGTGGTTATGGATGGGGTAGGG + Intronic
1119219001 14:72891971-72891993 GTGGGGTTAAGGGTGGGGGAAGG - Intronic
1119522372 14:75295374-75295396 TAGGGGGCAGGGATGGGGGTGGG - Intergenic
1120012012 14:79426708-79426730 TAGGTGTTGAGGATGGGAGAAGG + Intronic
1120489950 14:85164804-85164826 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1120730637 14:87997179-87997201 TAAGGGTGGAGGATGGGGGATGG - Intergenic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121254048 14:92518626-92518648 CAGGGAGAAAGGATGGGGGAAGG + Intronic
1121366809 14:93320260-93320282 TGGGGGTTAGGGAGGGTGGAAGG - Intronic
1122437407 14:101709508-101709530 CAGGGGTGGGGGATGGGGGAGGG + Intergenic
1122641655 14:103163580-103163602 TATGGGTGCAGGATGGGGGTGGG - Intergenic
1123539159 15:21270548-21270570 ATTGGATTAAGGATGGGGGAAGG - Intergenic
1124011194 15:25840050-25840072 CAGGGGTTAGGGATGCAGGAGGG - Intronic
1124824460 15:33080302-33080324 TAGGAGTGAAGGAAGGTGGAAGG + Intronic
1124989990 15:34663247-34663269 CAGGGATTAGGGATGGGGTATGG + Intergenic
1125091476 15:35798136-35798158 TAGGGGTGATGGTTTGGGGAAGG + Intergenic
1125126049 15:36222022-36222044 TATGGGCTCAGAATGGGGGAGGG - Intergenic
1125408909 15:39384287-39384309 GAGGGGCTAAGAATTGGGGAGGG + Intergenic
1127469821 15:59280974-59280996 TTGGAGGTGAGGATGGGGGAGGG - Intronic
1127619212 15:60716862-60716884 TTAGGGTTAAGTATGGGGGAAGG - Intronic
1127955492 15:63849261-63849283 GAGGGGATTATGATGGGGGAAGG - Intergenic
1128699937 15:69796758-69796780 AAGGGGCTGAGAATGGGGGAGGG + Intergenic
1129021475 15:72523474-72523496 TAGGGGTTAGTGAAGAGGGAGGG + Intronic
1129250862 15:74308219-74308241 TAGTGGTGAGGGTTGGGGGAGGG - Intronic
1130121775 15:81056133-81056155 CAGGGGCTGAGGATTGGGGAAGG - Intronic
1130126626 15:81099312-81099334 TTGGGGTAAAGGATTGGGCAGGG - Intronic
1130469781 15:84216133-84216155 TAGGGGTATTGGACGGGGGAAGG - Intergenic
1130477269 15:84330696-84330718 TAGGGGTATTGGACGGGGGAAGG - Intergenic
1130494496 15:84457434-84457456 TAGGGGTATTGGACGGGGGAAGG + Intergenic
1130592070 15:85220757-85220779 TAGGGGTATTGGACGGGGGAAGG - Intergenic
1130893947 15:88156455-88156477 AGGGGCTGAAGGATGGGGGAAGG - Intronic
1131098229 15:89669411-89669433 AAGGGGTGATGGGTGGGGGATGG + Intronic
1131145418 15:90008228-90008250 TAGGCACTAGGGATGGGGGAAGG - Intronic
1131717680 15:95131227-95131249 TAGAGGTCAAGGGTGTGGGAGGG - Intergenic
1131858340 15:96624218-96624240 TGGGGGTTAAGGTTGGGAGGGGG - Intergenic
1132296633 15:100739915-100739937 CAAGGGTTAAGGAGGGGGCAGGG - Intergenic
1132435451 15:101797656-101797678 TTGGGGGAAAGGATGGGAGAGGG + Intergenic
1132453482 15:101981025-101981047 TAGGGGTTAGGGTTGGGGTTAGG + Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132647272 16:1004880-1004902 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647318 16:1005015-1005037 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647334 16:1005059-1005081 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132659993 16:1057063-1057085 TATGGGTACAGGATGGGGGTGGG + Intergenic
1132709092 16:1258667-1258689 GAGGGGCTCAGGATGGGGGAGGG - Exonic
1132709100 16:1258685-1258707 AAGGGGCTCAGGGTGGGGGAGGG - Exonic
1132734748 16:1379775-1379797 TCGGGGGGAAGGTTGGGGGAGGG - Intronic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1132989812 16:2786889-2786911 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989873 16:2787083-2787105 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989916 16:2787217-2787239 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989934 16:2787270-2787292 AGGGGGTGAAGGATGAGGGAGGG - Intronic
1132989948 16:2787320-2787342 GGGGGGTGAAGGATGGAGGAGGG - Intronic
1132989961 16:2787353-2787375 GAGGGGGTGAGGATGAGGGAGGG - Intronic
1132989989 16:2787441-2787463 GAGGGGTGAAGGATGGGGGAGGG - Intronic
1133001219 16:2852659-2852681 AGGGGGTTAAGGTTGGGGGTTGG - Intergenic
1134063265 16:11211549-11211571 TGGGGGTAAAGGAGGGGTGAGGG - Intergenic
1134345355 16:13385965-13385987 TAGGGATTAAGGATAGGGACAGG + Intergenic
1134390362 16:13814320-13814342 TAGTGGTCAAGGAAGGGGAAGGG + Intergenic
1134773254 16:16829256-16829278 GAGAGGTTAAGGCTTGGGGATGG - Intergenic
1134908144 16:17999720-17999742 TGGGGGTTAAGGTGGGGGGAGGG + Intergenic
1135191484 16:20358146-20358168 GAGGGGTTTGGGATGGGGGCTGG + Intergenic
1135221796 16:20620842-20620864 AAGGGGATAGGGATGGGGGTGGG + Intronic
1135221873 16:20621239-20621261 TGGGGGTTCAGGTGGGGGGAGGG - Intronic
1135236222 16:20759070-20759092 TAGGGGTTCAGGATGAGGGCTGG + Intronic
1135656562 16:24255772-24255794 GAAGGGTTAAGGAAAGGGGAAGG - Exonic
1135998736 16:27273471-27273493 TTGAGGTTAAGGTTGAGGGATGG + Intronic
1136240037 16:28937966-28937988 ATGGGGCTCAGGATGGGGGATGG - Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136385827 16:29925583-29925605 TGGGGGTAAAGGATTGGGGGAGG + Intronic
1137420132 16:48326325-48326347 TGTGGGTTAGGGATGGAGGAGGG - Intronic
1137780393 16:51093418-51093440 GAGGGGTGTAGGATGAGGGAGGG + Intergenic
1137788619 16:51155696-51155718 TTGGAGTTAGGGTTGGGGGAGGG + Intergenic
1137966419 16:52938270-52938292 CAGGGGTTAGGGAGGAGGGAGGG + Intergenic
1138213663 16:55184244-55184266 CTGGGGTGAAGGGTGGGGGAGGG - Intergenic
1138706710 16:58922323-58922345 CAGGGGCTGAGGATGGGGAAAGG + Intergenic
1139806015 16:69566055-69566077 GAGGGGTTCAGGACGGGGAAGGG - Exonic
1139946899 16:70647886-70647908 CAGGGGTGCAGCATGGGGGAGGG + Intronic
1140937665 16:79689891-79689913 CAGGGGTTAGGGATGGGTCAGGG + Intergenic
1141282764 16:82644040-82644062 AAGTGGTTTAGGATGGGGGGTGG + Intronic
1141344306 16:83231168-83231190 TAGGGGTGGAGGATGGAGAAAGG - Intronic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1143614266 17:8039990-8040012 AGGGGGTTACTGATGGGGGAGGG + Intronic
1143875275 17:9986505-9986527 GAGGGCTCAAGGATGGGGGATGG - Intronic
1144042982 17:11429384-11429406 CAGGTGTTAATGTTGGGGGAGGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144461567 17:15462814-15462836 AAGGGGTTATCGATGGGAGAAGG + Intronic
1145317054 17:21741231-21741253 TAGGGGTCCAGGGTGGGGGGAGG + Intergenic
1145936698 17:28718304-28718326 TCGGGGGTGAGGATGGTGGAGGG + Intronic
1146097426 17:29944991-29945013 TTTGGGTTAAGGATGGGGCTAGG - Intronic
1146153846 17:30502184-30502206 CAGGGGTTGAGGATGGGAAATGG + Intronic
1146514132 17:33475798-33475820 CAGGGGATGGGGATGGGGGAGGG - Intronic
1146593878 17:34153251-34153273 GAGAAGTTAAGTATGGGGGAAGG - Intronic
1147360009 17:39924528-39924550 TAGGGGGTGAGGCTGGGGGATGG - Intronic
1147382839 17:40065752-40065774 TAGGGGCTGGGAATGGGGGAAGG + Intronic
1147886887 17:43690468-43690490 CAGGGGTGAAGGATTGGGGTGGG - Intergenic
1149401799 17:56304161-56304183 CAGGAGTTAAGGAGGGGGTAGGG - Intronic
1149443472 17:56694980-56695002 CAGGGGTTAGGGGAGGGGGAAGG - Intergenic
1149691027 17:58576680-58576702 CAGGGGTTAAGGAAGGGGTGGGG - Intronic
1150873682 17:68944592-68944614 CAGGAGTAAAGGTTGGGGGAAGG - Intronic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151475369 17:74342022-74342044 GTGGGGCTAAGGGTGGGGGAGGG - Intronic
1151763597 17:76121401-76121423 TAGGGGCTAAGGCTGGGCTAGGG - Intronic
1152238409 17:79150015-79150037 TGGGGGTTGAGGGTGGGGGGTGG + Intronic
1152469373 17:80482315-80482337 CTGGGGTCAAGGATGGGGAATGG + Intergenic
1152935325 17:83133367-83133389 TGGGGGTGCAGGATGGGGGCTGG - Intergenic
1152952601 18:10213-10235 TAGGGGTTAGGGTTGGGGTTGGG - Intergenic
1152958712 18:63943-63965 TAGGGGTTAGGGTTAGGGTAAGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1153413760 18:4823126-4823148 TGGGGGTTAAGGAATGGGGTGGG + Intergenic
1153728936 18:7987574-7987596 CAGGGATAAAGGATGGGGAATGG + Intronic
1154031210 18:10755924-10755946 TGGGGGATAAGGATGAGGGATGG + Intronic
1154031275 18:10756196-10756218 AAGGGGATAAGGAGGAGGGATGG + Intronic
1155531364 18:26770328-26770350 CAGGGGCTAAGGTGGGGGGAGGG - Intergenic
1155936777 18:31762855-31762877 TAGGGGGTAAGGAAAGGAGAAGG + Intergenic
1156146469 18:34187188-34187210 ATGGGGTTAAGGAGGAGGGAGGG - Intronic
1156209899 18:34928359-34928381 CAGGCTTCAAGGATGGGGGAGGG + Intergenic
1156400680 18:36736717-36736739 TATGGGTACAGGATGGGGGTGGG + Intronic
1156490508 18:37493209-37493231 AAGGGGTGAGGCATGGGGGAAGG - Intronic
1156967586 18:43114027-43114049 TAGGATTTAAGGAAGGAGGAAGG - Intronic
1157137607 18:45072211-45072233 TAGGGGTTAAGGATGATGAGGGG - Intergenic
1158184917 18:54760530-54760552 TAGGGGTCAAGGATGGAAGCAGG + Intronic
1158327107 18:56324197-56324219 TAGGGGGTGGGGGTGGGGGATGG - Intergenic
1158488511 18:57889375-57889397 TATGGGTTCAGAATAGGGGAAGG + Intergenic
1158968507 18:62644471-62644493 TATGGGTACAGGATGGGGGGCGG - Intergenic
1159041448 18:63326674-63326696 GAGGGATGAAGGATGGGAGAAGG + Intergenic
1159063573 18:63542785-63542807 TGAGGGTGAAGGATGGGAGAAGG - Intergenic
1159226602 18:65545480-65545502 AAGGGGATAAGGCTGGGGCAGGG + Intergenic
1160653209 19:245700-245722 TAGGGGTTAAGGTTAGGGTTAGG - Intergenic
1160653293 19:245926-245948 TAGGGGTTAGGGTTGGGGTTGGG - Intergenic
1160677182 19:397684-397706 TAGGTGTTCAGGATGGTGGACGG - Intergenic
1160979810 19:1811771-1811793 GAGGGGTTTAGGCTGTGGGACGG + Exonic
1161151417 19:2712048-2712070 TAGGGGTGAGGGGTGGGGGCTGG + Intergenic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161504586 19:4636947-4636969 TGGGTGTTAGGGGTGGGGGAGGG - Intergenic
1161608456 19:5227991-5228013 AAGGGGATAAGGAGGGGTGACGG + Intronic
1162222547 19:9190068-9190090 TATGGGCTCAGAATGGGGGAGGG + Intergenic
1162245416 19:9395787-9395809 TGGGGGTTGAGGATTGGTGATGG + Intergenic
1162929258 19:13948587-13948609 TGGGGGATGAGGATGGGGGCAGG - Intronic
1165100255 19:33434897-33434919 CAGGTGTTAAGGTTGGGGGGTGG + Intronic
1165761784 19:38325927-38325949 TAGGGGCTGGGGATGGGGAAGGG + Intronic
1166007911 19:39919729-39919751 GAGGGGTCAAGGATGGGATAGGG + Intronic
1166855920 19:45782559-45782581 GAGGGGTTAAGGCTGGGAGGCGG - Intronic
1166881869 19:45934839-45934861 TAGGGGTGAGGGATGGGGGTGGG + Exonic
1166978603 19:46619888-46619910 TAGGCGTTTAGGGTGGGGGAGGG - Intergenic
1167477656 19:49710269-49710291 TTGGGGTTACAGATGGGGGTAGG - Intronic
1167541256 19:50088941-50088963 TAGGGGTTTGGGAGGAGGGAAGG + Intergenic
1167628837 19:50610545-50610567 TAGGGGTTTGGGAGGAGGGAAGG - Intergenic
925366606 2:3315638-3315660 TAGGGGGTGTGGATGGGGGATGG - Intronic
925705743 2:6683370-6683392 TATGGGTACAGGATGGGGGGTGG + Intergenic
927240111 2:20913854-20913876 ATGGGGTTCAGGTTGGGGGAAGG - Intergenic
928313645 2:30230720-30230742 TGGGAGTCAAGGATGGGGGGCGG + Intergenic
929094960 2:38254518-38254540 TATGGGTTCAGAATGGGGGAGGG + Intergenic
929591889 2:43153015-43153037 TATGGGATAGGGATGGGGGTGGG + Intergenic
929873349 2:45776050-45776072 AAGGAGATCAGGATGGGGGAAGG - Intronic
929947109 2:46380003-46380025 GAGGGGATAAACATGGGGGAAGG + Intronic
930024864 2:47023873-47023895 TAGGGGCTGGGGATGGTGGAAGG - Intronic
930853411 2:55986231-55986253 TAGTGGTACAGCATGGGGGAGGG + Intergenic
931381494 2:61757708-61757730 CAGGGGTTAAGGAGGGGGTGGGG - Intergenic
931405639 2:61974932-61974954 CAGGGGTTCAGGAAGGAGGAGGG - Intronic
932322862 2:70834709-70834731 CAGGGGTCTAGGATGGGGCAAGG + Intronic
932999220 2:76901195-76901217 TAGGGGTTTGGGATGGGGGAGGG - Intronic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933427083 2:82126771-82126793 TATGGGTTCAGGGTGGGGGGCGG + Intergenic
933721796 2:85401760-85401782 AAGGGGATCTGGATGGGGGAAGG - Intronic
934177285 2:89586436-89586458 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
934287584 2:91660749-91660771 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
934310334 2:91857227-91857249 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
934559523 2:95305657-95305679 CAGGGGTTAAGGATGGGGGGAGG - Intronic
935182622 2:100704341-100704363 TGGGGGTTCAAAATGGGGGAAGG + Intergenic
935308461 2:101759765-101759787 GAGGGGGAGAGGATGGGGGAAGG - Intronic
935381971 2:102462043-102462065 CAGGAGTTAGGGATGGAGGAGGG + Intergenic
936569565 2:113602839-113602861 TAAGGGTTAAGGGTTGGGGTTGG + Intergenic
936569579 2:113602871-113602893 TAGGGGTTAGGGTTGGGGTTGGG + Intergenic
936569623 2:113602996-113603018 TAAGGGTTAAGGGTGGGGGTTGG - Intergenic
936569750 2:113603363-113603385 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
936571914 2:113624698-113624720 TAGGGGTTAGGGTTAGGGTAGGG - Intergenic
937348312 2:121142158-121142180 TAGGGGCTAAGGGTAGGGGGAGG + Intergenic
937538745 2:122923595-122923617 TATGGGTACAGGATGGGGCATGG + Intergenic
937811462 2:126204047-126204069 CAGGGCTTAGGGATGGTGGAGGG + Intergenic
938497072 2:131803392-131803414 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
938547841 2:132351895-132351917 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
939485242 2:142803181-142803203 CAAGGGTTAAGGCTGTGGGAAGG - Intergenic
939627962 2:144501613-144501635 TAGGGGTTGGGGGTTGGGGAAGG + Intronic
939700629 2:145386650-145386672 TAAGGGTATAGGATGGGGGCGGG - Intergenic
939891211 2:147738459-147738481 AGGGGATTAAAGATGGGGGAAGG + Intergenic
940658984 2:156523248-156523270 CAGGGGTTAGGGGAGGGGGAAGG - Intronic
940801089 2:158133362-158133384 TAGGGGAGCAGGATGGGGAACGG + Intronic
941008723 2:160273712-160273734 TTGGGGTTGGGGATGGGGGTGGG - Exonic
941180116 2:162249381-162249403 TAGAGGTTAAAAATGGGGAAGGG - Intergenic
942719518 2:178935266-178935288 TGAGGGTGGAGGATGGGGGAAGG - Intronic
943422312 2:187681611-187681633 TATGGGTTAGGGAAGTGGGATGG + Intergenic
943474812 2:188341001-188341023 TATGGGTACAGGATAGGGGATGG + Intronic
944382466 2:199127310-199127332 GAGGGGGTAAGGGTGGGGGTGGG + Intergenic
944481608 2:200163141-200163163 TAGGGGTTACGGGTGGGGGCAGG + Intergenic
944891105 2:204118025-204118047 TATGGGTATGGGATGGGGGACGG + Intergenic
945630279 2:212266128-212266150 TAAGGGCAAAGGAAGGGGGAAGG - Intronic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
946382684 2:219359293-219359315 CAGGGATTAACGATGGGGGGGGG + Intergenic
946418261 2:219551389-219551411 TAGGAGGTGGGGATGGGGGAGGG - Intronic
946864734 2:224032488-224032510 TAGGGGTTGGGGGTGGGGCACGG + Intronic
947136490 2:226981216-226981238 ATGGGGTGAGGGATGGGGGAGGG + Intronic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947998542 2:234548409-234548431 TGGGGGTGGAGGGTGGGGGAAGG + Intergenic
948097987 2:235351426-235351448 TAGGGGTAAGGGAAGGGGGAGGG + Intergenic
948231707 2:236353800-236353822 TAGGGGTTAGGGAGGGTGCAGGG + Intronic
948992549 2:241562154-241562176 TAGGGGCCAAGGTTGGGGGATGG + Intronic
1168771828 20:420720-420742 TAGGGATGGGGGATGGGGGACGG - Intronic
1168989765 20:2084722-2084744 CAGGGATTAAGGATGAGGGAAGG + Intergenic
1169578642 20:6994294-6994316 CAGGGGCTAAGGATGGGGTGGGG + Intergenic
1169772349 20:9215340-9215362 TAGGGGTTAAACATGGGCGAGGG + Intronic
1169913815 20:10668385-10668407 TAGGCTTGAAGGATGGGGGTAGG + Intronic
1170726395 20:18931284-18931306 TTGGGGGAAAGGATGGGGGGTGG - Intergenic
1170869337 20:20190443-20190465 CAGAGGTTAAGGATGCGGGGAGG + Intronic
1171358722 20:24571108-24571130 AAGGGGTTAAGGATGGGGAAAGG + Intronic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171876708 20:30584668-30584690 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
1172050073 20:32110319-32110341 TAGGGATGAAAGATGGGGGTGGG - Intronic
1173366800 20:42393175-42393197 CAGGGGAGAAGGCTGGGGGAAGG + Intronic
1173390251 20:42625527-42625549 TAGGGGCAGAGGATGGGAGAGGG - Intronic
1173852649 20:46228557-46228579 GTGGGGGTAAGGGTGGGGGAGGG + Intronic
1174013857 20:47472280-47472302 AGGGGGTTAAGGATGAGGGCTGG - Intergenic
1174014248 20:47475010-47475032 AGGGGGTTAAGGATGAGGGCTGG + Intergenic
1174196968 20:48779839-48779861 TCAGGGGTAACGATGGGGGAAGG + Intronic
1175270578 20:57731047-57731069 GAGGGGTAAGGTATGGGGGATGG - Intergenic
1175451586 20:59073263-59073285 TAGGGGAGAAGGATGGGGCTTGG - Intergenic
1176278269 20:64286717-64286739 TAGGGGTTAGGGGTTGGGGTTGG + Intronic
1177084210 21:16681828-16681850 AAGGGGCTAAGGATGGGGAAAGG - Intergenic
1177495396 21:21883568-21883590 TAGGGTTTTGGGGTGGGGGATGG + Intergenic
1178348730 21:31854596-31854618 TATGTGTTAAGCATGGGAGATGG - Intergenic
1180455236 22:15509408-15509430 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
1180604212 22:17044095-17044117 AAGGGGTTAGGGATGGGGAGAGG + Intergenic
1181387834 22:22558178-22558200 TGGGGGGTCGGGATGGGGGAAGG + Intronic
1181528255 22:23502232-23502254 TAGGGATGGGGGATGGGGGATGG - Intergenic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1182239465 22:28903574-28903596 GAGGGGTTCAGGATGGGGAGGGG - Intronic
1183307802 22:37092220-37092242 CAGGGGCAAAGGCTGGGGGAGGG - Intronic
1183678098 22:39311007-39311029 TAGGGGTTTTGGATTGGGCAGGG - Intergenic
1183718721 22:39549783-39549805 TGGGGAGTAAGGATGGGGTAGGG - Intergenic
1184809992 22:46824766-46824788 TGGGTGTGAAGGATGAGGGAAGG + Intronic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185428278 22:50786180-50786202 TAGGGGTTAGGGTTAGGGTAGGG + Intergenic
949152069 3:781362-781384 CAGGGGAGAAGGATGGGAGAAGG - Intergenic
949681264 3:6517110-6517132 TTGGGTTTAAGGATGGGGGTTGG + Intergenic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
950448317 3:13051187-13051209 CAGAGGTGAAGGATGGAGGAGGG - Intronic
950548274 3:13651915-13651937 GAGGGGCTGAGGATCGGGGAGGG + Intergenic
950699547 3:14731144-14731166 CAGGGATTAAGGGTGAGGGAAGG - Intronic
951071731 3:18337235-18337257 TAGGGGTAAAGGGAGGGAGAAGG - Intronic
951109041 3:18779453-18779475 TGGAGGTGAAGGATGGGGGGAGG - Intergenic
951896559 3:27614934-27614956 TATGGGCTCAGAATGGGGGAGGG + Intergenic
952003028 3:28808814-28808836 TATGGGCACAGGATGGGGGATGG + Intergenic
952150756 3:30587870-30587892 CAAGGGTTAAGGAGGGGGCAAGG - Intergenic
952337666 3:32418577-32418599 TAAGGGTTAAGTATGGGCCAGGG + Intronic
952571655 3:34725073-34725095 CAGGGGTGAAAGATGGGAGATGG - Intergenic
954504214 3:51053008-51053030 TTGGGGTGGAGGATGGAGGAAGG + Intronic
954583270 3:51715046-51715068 AAGGGGGCTAGGATGGGGGAGGG - Exonic
954991975 3:54849380-54849402 TGGTGGTTAAGGAAGGAGGAGGG - Intronic
955171876 3:56573960-56573982 TGGGGGTTGATGATGGGAGAAGG + Intronic
956598535 3:70994515-70994537 AAGGGGTGAGGGATTGGGGAAGG - Intronic
957567514 3:81904060-81904082 TAGGGGTGAAGCCTTGGGGATGG - Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
959517148 3:107281324-107281346 TATGGGTTAGGGCTGGGGAAAGG + Intergenic
960013151 3:112855482-112855504 TAAGGATTAAGGATGGGAGGAGG + Intergenic
960488753 3:118284060-118284082 TAGGGGTTAGGGGTTAGGGAAGG - Intergenic
960561409 3:119087617-119087639 TTGGGGGAAAGGGTGGGGGATGG + Intronic
960768366 3:121164110-121164132 TAGGGATGAAGGAGTGGGGATGG - Intronic
961316684 3:126041257-126041279 TAGGAGTTATGGAGGGGGGGTGG + Intronic
961425237 3:126840221-126840243 TAGGGGCTAAGTGTAGGGGAAGG + Intronic
961629280 3:128284446-128284468 TGGGGGTTGGGGGTGGGGGATGG + Intronic
962070464 3:132028510-132028532 AAGGGGTAAGAGATGGGGGAAGG + Intronic
963550837 3:146720851-146720873 TATGGGTGAAGGATGGGAAAAGG - Intergenic
964122097 3:153195473-153195495 CAGGAGTTAAGGAGGAGGGAGGG + Intergenic
964847152 3:161056703-161056725 GAGGGGCTAAGGATTGGGGTAGG - Intronic
965002314 3:162969866-162969888 GAGGGGTTAGGGCTAGGGGAGGG + Intergenic
965208385 3:165751445-165751467 TATGGGTACAGGATGGGGGAAGG - Intergenic
965343578 3:167519633-167519655 CAGGGGTGGGGGATGGGGGAGGG + Intronic
965565440 3:170111484-170111506 TGGGGGTTAGGAATGGAGGAAGG + Intronic
966141806 3:176766220-176766242 TAGGGGTAGGGGATAGGGGAGGG - Intergenic
966172201 3:177094814-177094836 TAGGGGGAAAGGGTGGGGGATGG + Intronic
967272640 3:187743818-187743840 GAGGGAGTAAGAATGGGGGAAGG - Intronic
967527991 3:190515987-190516009 GAAGGGTTAAGGGTGTGGGAGGG - Intronic
967856893 3:194124839-194124861 TAGAGATCAAGGATGTGGGAAGG + Intergenic
968001569 3:195210117-195210139 TTGGGGTGAAGGCTGGGGGAGGG - Intronic
968076979 3:195821364-195821386 TAAGGGGTAAGGGTGGGAGAGGG + Intergenic
969493403 4:7512586-7512608 TAGAGGTTAAGGATGGAGTCTGG - Intronic
970468009 4:16347231-16347253 TAGATGTGAAGGATGGGGAAGGG - Intergenic
972445483 4:39139377-39139399 TAGGGGTTAGGGGAGAGGGAAGG + Intergenic
972725741 4:41745598-41745620 TGGGGGTTGAGGAAGGGGGTAGG + Exonic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
974474693 4:62363272-62363294 TAGGGGTTGAGGTAGGGGGTGGG - Intergenic
974505873 4:62771748-62771770 TATGGGTACAGGATGGGGGGTGG - Intergenic
975397192 4:73890271-73890293 AAGGGGTGAAGGGTGGGGAATGG - Intergenic
975413377 4:74080744-74080766 TGGGGGTTGGGGCTGGGGGAGGG + Intergenic
975442383 4:74426521-74426543 TTGGGGGCAAGGATTGGGGAAGG - Intergenic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
976770256 4:88644589-88644611 CAGGGGTTAAGGATGAGGAGAGG + Intronic
976853043 4:89570907-89570929 TTGGGGTTAAGAATATGGGAGGG + Intergenic
977357818 4:95969133-95969155 TATGGGTACAGGATGGGGGTTGG - Intergenic
977441650 4:97075585-97075607 AAGGGGCAAGGGATGGGGGAAGG - Intergenic
978324738 4:107539580-107539602 GATGGGTTGAGGATGAGGGATGG + Intergenic
978360482 4:107926111-107926133 GAGGGGTTGGGGCTGGGGGAGGG + Intergenic
978651407 4:111010000-111010022 AAGGGGTGCAGGGTGGGGGATGG - Intergenic
979716520 4:123844873-123844895 TATGGGTACAGGATGGGGGCTGG + Intergenic
980006110 4:127544355-127544377 TATGGGTGTAGGATGGGGGGTGG - Intergenic
980718574 4:136661590-136661612 TGGGGCTAAAGGGTGGGGGATGG - Intergenic
980940339 4:139268120-139268142 AAGGGGGAAAGGAAGGGGGAAGG + Intronic
981728578 4:147873533-147873555 ATGGGGATAAGGGTGGGGGATGG + Intronic
983534162 4:168839575-168839597 GAGGGGTGAGGGAGGGGGGATGG + Intronic
983544384 4:168947533-168947555 TTGGGGAGAAGGATGGGAGAGGG - Intronic
984114620 4:175664175-175664197 TAGGGGTTGGGGGTGAGGGAGGG + Intronic
984482716 4:180326553-180326575 TAGGGGTTAGGGATGGAGGTGGG - Intergenic
984543779 4:181074236-181074258 TATGGGCACAGGATGGGGGATGG - Intergenic
985091204 4:186364243-186364265 CAGGTGGTGAGGATGGGGGAGGG - Intergenic
985404999 4:189629047-189629069 CAGGGGAGAGGGATGGGGGAAGG + Intergenic
985824937 5:2185046-2185068 TAGGGGTTAGGGTTGGGGTTAGG + Intergenic
986383296 5:7207817-7207839 GAGGGGTTTAGGATGAGGTATGG + Intergenic
986793287 5:11184176-11184198 TAAGAATAAAGGATGGGGGATGG + Intronic
987008944 5:13740274-13740296 CAGGGGGTAAGGCTGGGGTAGGG - Intronic
987498738 5:18678447-18678469 TAGGGGAGGAGGCTGGGGGAAGG - Intergenic
989387489 5:40867891-40867913 TATGGGCACAGGATGGGGGAGGG + Intergenic
989462775 5:41720064-41720086 CAGGGGTTAGGGATCTGGGAGGG - Intergenic
990022327 5:51142888-51142910 TGGGGTGGAAGGATGGGGGAGGG + Intergenic
990041816 5:51386035-51386057 TCGGGGTACAGGAAGGGGGAGGG + Intronic
990128378 5:52548136-52548158 TATGGGCACAGGATGGGGGAAGG - Intergenic
990192831 5:53279831-53279853 TGGGGGGTGGGGATGGGGGAGGG - Intergenic
990471392 5:56119418-56119440 CAGGGCTTAGGGATGGGAGAGGG + Intronic
990992728 5:61701350-61701372 TTGGGGTTAGAGCTGGGGGAGGG - Intronic
991137494 5:63199402-63199424 GAGAGCTTAAAGATGGGGGAGGG - Intergenic
991748165 5:69768470-69768492 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991799747 5:70348315-70348337 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991828850 5:70661723-70661745 TAGGGTGGAGGGATGGGGGAGGG + Intergenic
991892103 5:71347746-71347768 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
992111790 5:73501254-73501276 TAGGGATGGAGGTTGGGGGACGG + Intronic
992492335 5:77257815-77257837 TCAGGGTTGGGGATGGGGGAGGG - Intronic
992799305 5:80281370-80281392 AAGGGGTGAAGGAAGAGGGAGGG + Intergenic
993334718 5:86644095-86644117 TGGGGGCAAGGGATGGGGGAAGG - Intergenic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993741449 5:91545819-91545841 AGGGGGTGGAGGATGGGGGAGGG - Intergenic
994134584 5:96270706-96270728 GAGGGGGTGAGGTTGGGGGAAGG + Intergenic
994830452 5:104775086-104775108 TATGGGTACAGGATGGAGGATGG + Intergenic
995173008 5:109139288-109139310 TAGGGGTACAGGGTGGGGGTGGG - Intronic
995533610 5:113114579-113114601 TATGGGTATAGGATGGGGGGCGG - Intronic
995544390 5:113215463-113215485 TAGTGGTTAAGGGTGGGGGTTGG + Intronic
996506060 5:124268808-124268830 TAGGGGTTCAGGGGGAGGGAGGG - Intergenic
996546975 5:124690205-124690227 TAGTTGCTAGGGATGGGGGAAGG + Intronic
997471582 5:134120281-134120303 TGGGGGTTAGGGGTGAGGGAGGG - Intronic
997780427 5:136652349-136652371 TACGGGCTCAGAATGGGGGAGGG + Intergenic
998049194 5:139017234-139017256 GAGGGGACAAGGTTGGGGGAGGG + Intronic
998227196 5:140336156-140336178 TAGAGGAGAAGGATGGAGGATGG - Intronic
998940828 5:147280416-147280438 GGGGGGTTGGGGATGGGGGAGGG + Intronic
999143797 5:149379609-149379631 AAGGGGTTGAGGGTGGAGGAGGG + Intronic
999303802 5:150507230-150507252 TGGGGCTTAAGGATGGAGGTTGG - Intronic
999832951 5:155338153-155338175 TAGGGGTTCAGTAGGGGGAAAGG + Intergenic
1000837714 5:166177044-166177066 TAGGGGATAAGGCTGGGGGTTGG + Intergenic
1001290368 5:170453350-170453372 TAGTGCTGAAGGATGGGGAAAGG + Intronic
1001725181 5:173890501-173890523 TATGTGTGAAGGGTGGGGGATGG - Exonic
1001868336 5:175125685-175125707 CAGGGGTGAAGGAGAGGGGAAGG - Intergenic
1002052428 5:176578628-176578650 TGGTGGGTAAGGCTGGGGGAGGG + Intronic
1002880081 6:1243237-1243259 TTGGGCAGAAGGATGGGGGAGGG - Intergenic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003980421 6:11384675-11384697 TGGAGGATGAGGATGGGGGAAGG + Intergenic
1005277181 6:24231560-24231582 TAGTGGTGGAGGATGGGGGAGGG - Intronic
1005600393 6:27421073-27421095 TAGGAGTTAATGAGGAGGGAGGG + Intergenic
1005708372 6:28479635-28479657 TCGGGGGAAAGGGTGGGGGAGGG + Intergenic
1005906386 6:30264465-30264487 TAGGGCTCAAGTATGTGGGAAGG + Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006889121 6:37409481-37409503 TAGGGGTTAGAGATGGGGAGGGG - Intergenic
1006956227 6:37874691-37874713 CAGGGGTTTAGGGTAGGGGAGGG + Intronic
1007724842 6:43909267-43909289 TAGGTGTTATGGGTGGGGGCTGG - Intergenic
1008643291 6:53486728-53486750 TAGAGTTTCAGGATGGGGCAGGG - Intergenic
1008664203 6:53699926-53699948 TAGGGGTCTAAGATGGGGAAGGG + Intergenic
1010004425 6:70980138-70980160 AAGGGGTGGAGGCTGGGGGAGGG + Intergenic
1010121467 6:72380247-72380269 TGGGGTGGAAGGATGGGGGAGGG + Intronic
1010672446 6:78702325-78702347 TAGGGGTTAAGGGGAGGGAAAGG + Intergenic
1011955637 6:93021871-93021893 TAGGGGTGAAGGATAGGGGGTGG - Intergenic
1012052390 6:94361749-94361771 TAGGGGTCAGGGATGGGGGGGGG + Intergenic
1012334752 6:98041408-98041430 TAGGGGTTGGAGCTGGGGGAAGG - Intergenic
1012448306 6:99328763-99328785 TAATGGTTAATGCTGGGGGAGGG - Intronic
1012692754 6:102335266-102335288 TATGGGTACAGGATGGGGGCGGG + Intergenic
1012750002 6:103147852-103147874 TTGGGGATAAGGATGGGGGTTGG + Intergenic
1013286256 6:108684797-108684819 TAGGGTTCAAGAAAGGGGGAGGG - Intergenic
1013816258 6:114102048-114102070 TGAGGGTGAAGGATGGGAGAAGG + Intronic
1014106613 6:117571598-117571620 TAGAGGTTAAGGAAAGGGGGAGG - Intronic
1014276349 6:119394448-119394470 TATGGGTGCAGGATGGGGGTGGG + Intergenic
1014967164 6:127769770-127769792 TGGGGTTGGAGGATGGGGGAGGG - Intronic
1015620602 6:135127858-135127880 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1016508302 6:144810203-144810225 TAGGGAAGAAGGATGGGAGAAGG + Intronic
1016851878 6:148628392-148628414 AGGGGGATAAGGATGGGGGAGGG - Intergenic
1016898863 6:149080703-149080725 TAGGGGTCAAGGGTGGGAAATGG - Intergenic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1018304356 6:162439315-162439337 GAGGGGTAAAGGAAGGGGGAAGG - Intronic
1019087844 6:169498807-169498829 CAGGGGTTATGGATGCGGGTGGG + Intronic
1019223460 6:170493126-170493148 TAGGAATTAAGGGTGGGTGATGG - Intergenic
1019791955 7:3020155-3020177 TAGTGGTGAAGTGTGGGGGAGGG - Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021611264 7:22460204-22460226 TATGGGGTAGGGTTGGGGGAGGG + Intronic
1021818129 7:24468091-24468113 CAGAAGTTAAGGATGGAGGAAGG - Intergenic
1021924944 7:25525372-25525394 TAGGGGTTAAGGAAAGGCCAAGG + Intergenic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1022828683 7:34043015-34043037 TAGGGGTTAATGATGGGGGTGGG + Intronic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1023853670 7:44166239-44166261 TATGGGCTCAGAATGGGGGAGGG + Intronic
1024479938 7:49852676-49852698 TTGGTGTGACGGATGGGGGACGG + Intronic
1025728949 7:64092983-64093005 TAGGGTTGGGGGATGGGGGAGGG + Intronic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1027502964 7:78978475-78978497 GAGGGGTTCAGGAAGAGGGAGGG + Intronic
1027708484 7:81566978-81567000 TATGGGTACAGGATGGGGGGCGG - Intergenic
1027755865 7:82211352-82211374 TAAGGGTGGAGGGTGGGGGAAGG - Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028095507 7:86755465-86755487 TGGGGGTTAAGGATGGGAGAGGG + Intronic
1028665081 7:93332944-93332966 CAGGGGTTAAGGGTGAGGGAAGG + Intronic
1028861141 7:95651932-95651954 CAGGGGTTAGGGATGAAGGATGG - Intergenic
1029548115 7:101222058-101222080 GAGGGGTTGAAGATGGGAGAGGG + Intronic
1029895520 7:103979352-103979374 TAGGAGTGAAGCATGAGGGATGG - Intronic
1030397379 7:109003805-109003827 TAGGGCTTAGGGTTGGAGGAAGG + Intergenic
1031376799 7:121036270-121036292 TTGGGGAAAAGGCTGGGGGATGG - Intronic
1031466567 7:122119547-122119569 TTGGGGGTGAGGATGGGGAATGG - Intronic
1032376261 7:131421441-131421463 TAGGTGTTAAGTTTGTGGGAAGG + Intronic
1032412317 7:131705143-131705165 TAGGGGTGAAGGTGAGGGGAGGG + Intergenic
1032502456 7:132410121-132410143 TAGGGGTGAAAGTTGGGGGATGG + Intronic
1032510739 7:132470425-132470447 TAGGTGTGAAGTTTGGGGGATGG - Intronic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1032916757 7:136499050-136499072 CAGGATTCAAGGATGGGGGAAGG - Intergenic
1033199978 7:139360174-139360196 TAAGGGGAAGGGATGGGGGAAGG - Exonic
1033423793 7:141225262-141225284 GAGGGGTGAAGGATGGAGCAGGG - Intronic
1034128628 7:148696769-148696791 TGGGGGGTAAAGATGGAGGAAGG + Intergenic
1034553798 7:151837330-151837352 TTGGGGTCAATTATGGGGGAGGG + Intronic
1035413764 7:158667294-158667316 TAGCGGCTAAGGGTGGAGGAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035512829 8:205688-205710 TAGGGGTTAGGGTTGGGGTTGGG - Intergenic
1035514408 8:220461-220483 TAGGGGTTAGGGGTAGGGGTAGG - Intergenic
1035990264 8:4482239-4482261 TAAGGGTGGAGGATGGGAGAAGG - Intronic
1036205156 8:6800156-6800178 CAGGGGTTCGGGATGAGGGAGGG - Intergenic
1036989939 8:13580894-13580916 GAGGGGGTGAGGATGGGTGAGGG + Intergenic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037582742 8:20255188-20255210 TCGGGGCTGAGGATGGGGCAGGG + Exonic
1038273044 8:26092328-26092350 TTGGAGTTGAGGATGGGGGAAGG - Intergenic
1038809467 8:30825681-30825703 TAGGGGTTATGGTTGGGGAAAGG - Intergenic
1038809869 8:30829424-30829446 TAGGAGTTGAGGGTGGGAGAAGG - Intergenic
1039126513 8:34208935-34208957 AAGGGGATGAGGTTGGGGGAGGG - Intergenic
1040420552 8:47236232-47236254 CAGTGGTTAAGGAAGAGGGAGGG + Intergenic
1040905755 8:52468474-52468496 CAGGGTTTAAGGAGGAGGGAGGG - Intergenic
1041198891 8:55430512-55430534 TATGGGGTAAGGATGGAGGGAGG + Intronic
1041682623 8:60608593-60608615 TGGGGGTAAAGGAAGAGGGAGGG - Intronic
1042716010 8:71773238-71773260 TATGGGCTCAGAATGGGGGAGGG + Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043524459 8:81081583-81081605 TAGGAGTTAAGGATGTGGTAGGG - Intronic
1044370343 8:91402899-91402921 GAGGGGGAATGGATGGGGGAGGG + Intergenic
1045531501 8:102989418-102989440 TAGGGGTGTGAGATGGGGGATGG - Intergenic
1047505941 8:125480306-125480328 TAGGGGGTGAGGATGGGAGTTGG - Intergenic
1047992779 8:130303756-130303778 CAGGGGTTTAGGATGAGGGAAGG + Intronic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048791682 8:138110044-138110066 TAGGCGTTGAGGATGGAGGGGGG - Intergenic
1049652100 8:143774955-143774977 CAGGGGTTACGGATGGGAGTGGG + Intergenic
1050156499 9:2672324-2672346 TGAGGGTGAAGGATGGGAGAAGG + Intergenic
1050200031 9:3134946-3134968 TAGGGGTTAGGGGAAGGGGAAGG + Intergenic
1050418571 9:5438928-5438950 TAGGGCTGAGGGGTGGGGGAAGG + Intergenic
1050751434 9:8942557-8942579 TAAGGGTTAACGCTGGAGGAAGG + Intronic
1052150459 9:25108716-25108738 TAGGAGATAATGATGGGAGATGG - Intergenic
1052656783 9:31373655-31373677 TGGGGGTGGAGGATGGGGGGAGG - Intergenic
1052708494 9:32022958-32022980 TTGGGGTAAAGGATGGGAGGTGG - Intergenic
1053011288 9:34635242-34635264 CTAGAGTTAAGGATGGGGGAGGG - Exonic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053474941 9:38375877-38375899 TATTGGTTGAGGATGGAGGATGG - Intergenic
1053753064 9:41274891-41274913 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
1053884743 9:42635793-42635815 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
1054223764 9:62443244-62443266 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
1054258594 9:62839266-62839288 TAGGGGTTAGGGTTGGGTTAGGG + Intergenic
1054333184 9:63780801-63780823 TAGGGGTTAGGGCTGGGTTAGGG - Intergenic
1055012207 9:71579274-71579296 TAGGTTTTAAGGATGGGAGCTGG - Intergenic
1055503333 9:76923555-76923577 CAGGGGTTAAGGTTTGGGGCAGG - Intergenic
1056882267 9:90407299-90407321 TAGGGTTTAGGGATGGGTGGGGG - Intergenic
1057012955 9:91622634-91622656 TAGGGGTTTGGGGTGGCGGATGG - Intronic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1057761295 9:97876712-97876734 TGGGGGTTGAGGCTGGGGGGTGG + Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058346154 9:103965532-103965554 TAAGGGTGGAGGATGGGAGAAGG - Intergenic
1058504051 9:105651470-105651492 AAGGGGCTAAGGATGGAGGAGGG + Intergenic
1059342499 9:113605979-113606001 GAGGGGTTAGGGGTGGGGAATGG - Intergenic
1059977727 9:119736092-119736114 TAGAGGTTAGGGATGAGGGCAGG + Intergenic
1060203845 9:121670077-121670099 CAGGGGTTAGGGATGGTGGTGGG - Intronic
1060509757 9:124223412-124223434 TAGGGGACAAGGCTGGGGGTGGG - Intergenic
1060641390 9:125241766-125241788 TCGGGGTGAGGGATGGAGGAAGG - Intergenic
1060952497 9:127612798-127612820 GAGGGGTGGAGGAAGGGGGAAGG - Intronic
1061255710 9:129453504-129453526 TAGGGATGGAGGGTGGGGGATGG + Intergenic
1061504350 9:131022929-131022951 TAGGGGTTCAGGATGGGGACTGG - Intronic
1062523678 9:136969859-136969881 CAGGGGGTGAGGATGGGGGTGGG - Intronic
1062739401 9:138159903-138159925 TAAGGGTTAAGGGTTGGGGTTGG + Intergenic
1202800188 9_KI270719v1_random:169115-169137 TAGGGGTTAGGGTTGGGTTAGGG - Intergenic
1203782442 EBV:108148-108170 TAGGGGCGAAGGGTGGGGGTGGG + Intergenic
1185638851 X:1575166-1575188 TAGGGGTTATGGATAGAGGGTGG + Intergenic
1185676347 X:1852326-1852348 TAAGGGTTTAGGAAGGGGGGAGG - Intergenic
1185956845 X:4500327-4500349 TAGGGGCAAAGGTTAGGGGAAGG + Intergenic
1186560608 X:10608569-10608591 TGGGGGTTAGGGATGGGGTAAGG + Intronic
1186680477 X:11868356-11868378 CAGGGGTTGAGGATGGAGGCTGG + Intergenic
1186697070 X:12046679-12046701 GAAGGGTGAGGGATGGGGGAAGG + Intergenic
1187625384 X:21106519-21106541 TAGGGGTTAGGAAAGGGGCAGGG - Intergenic
1187694548 X:21905424-21905446 AAGGGGTTAGGGAGGGGGGAGGG + Intergenic
1187783268 X:22854045-22854067 TAGGAGTTAGGGAAGAGGGAGGG + Intergenic
1187864933 X:23715370-23715392 TGGGGAATAGGGATGGGGGAGGG - Intronic
1188309652 X:28600507-28600529 TGGGGGTCAAGGAAGGGGCAAGG + Intronic
1188946152 X:36304672-36304694 CAGGGGTGAGGAATGGGGGATGG - Intronic
1189364982 X:40381146-40381168 GAGGGGTTGGGGGTGGGGGAGGG + Intergenic
1189514942 X:41704028-41704050 TAGGGGAAAAGGGAGGGGGAGGG - Intronic
1189526615 X:41829289-41829311 TAGTGGTTACCGGTGGGGGAAGG - Intronic
1189672904 X:43430606-43430628 CAGGGGTTAAGCATGGGAGGAGG - Intergenic
1189802963 X:44708592-44708614 TTGGGGGTAAGGTTGGGGGTGGG + Intergenic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1190186904 X:48243294-48243316 CAGGGGTTAGGGATGGTGGATGG + Intronic
1190195050 X:48310082-48310104 CAGGGGTTAGGGATGGTGGATGG - Intergenic
1190201013 X:48360843-48360865 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190202850 X:48378914-48378936 CAGGGGTTAGGGATGGTGGACGG + Intergenic
1190207688 X:48416499-48416521 CAGGGGTTAGGGATGGTGGACGG - Intergenic
1190210807 X:48445857-48445879 CAGGGATTAGGGATGGTGGATGG + Intergenic
1190274256 X:48890377-48890399 GAGGGGTTAAGGAGGTGGGTGGG - Intergenic
1190399395 X:50016737-50016759 CAGGGGTTTAGGGTGGGGGAGGG - Intronic
1190472519 X:50797033-50797055 GAGGGGGAAAGGATGGGGGGAGG + Intronic
1190661482 X:52658305-52658327 CAGGGGTTAGGGATGGTGGATGG - Intronic
1190667839 X:52711293-52711315 CAGGGATTAGGGATGGCGGATGG - Intergenic
1190669126 X:52723572-52723594 CAGGGGTTAGGGATGGCGGATGG - Intergenic
1190670291 X:52734832-52734854 CAGGGGTTAGGGATGGCGGATGG + Intergenic
1190671578 X:52747111-52747133 CAGGGATTAGGGATGGCGGATGG + Intergenic
1190877315 X:54469144-54469166 TAGTGGTTAAGCATGTGGGATGG + Intronic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1192013238 X:67298817-67298839 GTGGGGTTGGGGATGGGGGAGGG - Intergenic
1192410435 X:70928761-70928783 CCAGGGATAAGGATGGGGGATGG - Intronic
1194411566 X:93564646-93564668 TAGTGGTTTAGTTTGGGGGAAGG - Intergenic
1194992452 X:100559395-100559417 CAGGGGTTAGGGAGGAGGGAAGG + Intergenic
1196123707 X:112077774-112077796 TAAGGCTAAAGAATGGGGGAAGG + Intronic
1196703587 X:118697469-118697491 TAGGGGTAATGGATGGGTCAAGG + Intergenic
1196973182 X:121131791-121131813 TGGGGGGTAGGGTTGGGGGAGGG - Intergenic
1197446933 X:126562228-126562250 CAGGGGTTAAGGAGGGGAGTGGG + Intergenic
1197462132 X:126755511-126755533 TATGGGTACAGGATGGGGGGCGG + Intergenic
1197487423 X:127071085-127071107 TTGGGGGTAAGGCTGGGAGAGGG - Intergenic
1197870260 X:131057723-131057745 GAGGGGTTAAGGGTGGGGGTGGG + Intergenic
1198087132 X:133292364-133292386 CACGTGTTAAGGATGGAGGAAGG + Intergenic
1198479015 X:137023553-137023575 TAGGGGCAAGGGATGGGGGGAGG - Intergenic
1198736585 X:139792300-139792322 GATGGGTGAAGTATGGGGGAAGG - Intronic
1199049388 X:143219284-143219306 TAGGGGTTAATAAAGGGAGAAGG - Intergenic
1199178139 X:144816985-144817007 TAGGGGTTAATGCTGAAGGAAGG - Intergenic
1199248357 X:145631955-145631977 AAAGGGTTAAGGAGGGGGGCGGG + Intergenic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199827630 X:151515832-151515854 TGGGGGAAGAGGATGGGGGAGGG - Intergenic
1199874617 X:151920540-151920562 TAGGGGATAGGAATGGGGGTGGG - Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1200402977 X:156030083-156030105 TAGGGGTTAGGGTTGGGGTTGGG + Intergenic