ID: 1142340581

View in Genome Browser
Species Human (GRCh38)
Location 16:89519675-89519697
Sequence AAATGTTAGCAACTGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142340581_1142340584 1 Left 1142340581 16:89519675-89519697 CCCGGCAGCAGTTGCTAACATTT 0: 1
1: 0
2: 1
3: 27
4: 192
Right 1142340584 16:89519699-89519721 CACACAGCTTCTTGTGGAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 318
1142340581_1142340583 -5 Left 1142340581 16:89519675-89519697 CCCGGCAGCAGTTGCTAACATTT 0: 1
1: 0
2: 1
3: 27
4: 192
Right 1142340583 16:89519693-89519715 CATTTTCACACAGCTTCTTGTGG 0: 1
1: 0
2: 1
3: 18
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142340581 Original CRISPR AAATGTTAGCAACTGCTGCC GGG (reversed) Intronic
902319229 1:15648656-15648678 AAATGTTAGGAAATGTTGCTGGG + Intronic
902444258 1:16451990-16452012 AACTGGGAGCAACTGCTGGCTGG - Exonic
903518840 1:23931959-23931981 AAATGTTAGCTATTGTAGCCTGG + Intergenic
903623253 1:24713405-24713427 AGGTGTTAGCAACTGATTCCAGG - Intergenic
904396360 1:30225003-30225025 AGATTTGAGCACCTGCTGCCAGG + Intergenic
905458778 1:38107057-38107079 AAATCTTAGAAACTGCTGTCTGG + Intergenic
906838033 1:49105156-49105178 TAATGTAAGCAAGTGCTGCCAGG + Intronic
906903639 1:49865058-49865080 AAATGTCAGCAAGTCCAGCCAGG + Intronic
908113635 1:60920670-60920692 AAAGCTTGGCAACTCCTGCCTGG - Intronic
908330069 1:63062691-63062713 AAATGTGAGTAACTTTTGCCAGG - Intergenic
908823966 1:68115915-68115937 AAATGCCAACGACTGCTGCCAGG - Intronic
910761483 1:90736849-90736871 AAATGTTAGGGAGTGCTTCCTGG + Intergenic
910787598 1:91017664-91017686 AAAGGATAGTAACTACTGCCAGG + Intronic
912507025 1:110163435-110163457 AAATGGTAGCAGCCACTGCCTGG - Intronic
914355726 1:146882615-146882637 AGAGGTTAGTAGCTGCTGCCCGG + Intergenic
916425193 1:164673629-164673651 AAATGTTAGTAACTTTCGCCAGG - Intronic
916648892 1:166816790-166816812 AAATGTCTGCTCCTGCTGCCTGG - Intergenic
919169798 1:193939184-193939206 AAATCATAGCATATGCTGCCTGG - Intergenic
924227596 1:241934655-241934677 AAATGAAGGCAACTGCTCCCTGG - Intergenic
924270082 1:242323218-242323240 AAATATCAGCAACGGCCGCCTGG - Intronic
1062803898 10:400300-400322 AGATGTGAGCCACTGTTGCCTGG + Intronic
1062929676 10:1344661-1344683 AAATGTCAGCAACTGGTGCTAGG + Intronic
1062986744 10:1776220-1776242 AATTGGTTGCAGCTGCTGCCAGG + Intergenic
1066228447 10:33407866-33407888 AATTATTGTCAACTGCTGCCTGG + Intergenic
1066702013 10:38140021-38140043 AAATGTTAGCTAGAGCTGCGTGG + Intergenic
1068690520 10:59909043-59909065 AAATGGTAGTATGTGCTGCCTGG + Intergenic
1069219793 10:65868902-65868924 AAAAGATAGCAACTGCTCCTGGG - Intergenic
1069891043 10:71652713-71652735 AAATGTCAGCAAGTCATGCCTGG + Intronic
1069986783 10:72289956-72289978 AAAATTTAGCAAATGCTGCCGGG - Intergenic
1076413304 10:130266852-130266874 AATTGGCAGCCACTGCTGCCTGG - Intergenic
1077517974 11:3013552-3013574 AAACATTAGCAAGTGCTGGCTGG + Intronic
1077728654 11:4704296-4704318 ACAGGTTAGCAACAGCTCCCAGG + Intergenic
1078137568 11:8664458-8664480 TAAGGTTAACAACTACTGCCCGG - Intronic
1078713341 11:13816247-13816269 ACATGTTTGCACCTGCTGACTGG - Intergenic
1085003258 11:73060934-73060956 AAATGCTACCAACAGCTGCCAGG + Intronic
1086054327 11:82629187-82629209 AAATGGTTGCCACTGCTGGCTGG - Intergenic
1088651038 11:111958367-111958389 AAATGCTTGCTCCTGCTGCCTGG + Intronic
1089409447 11:118227519-118227541 AAATGATAGCAGCTGATGACTGG + Exonic
1090367862 11:126222986-126223008 AAATGTTACCATCTGTAGCCTGG - Intronic
1095309744 12:40684466-40684488 AAATCTTAGCTTCTGCTTCCTGG - Intergenic
1096260731 12:50088978-50089000 TAATTACAGCAACTGCTGCCAGG - Intronic
1102223209 12:111208823-111208845 AAAGGTTAGCAAGTGCTGGAGGG - Intronic
1102664650 12:114561364-114561386 AAATGTTCCCAACTGCTACTTGG - Intergenic
1103624493 12:122207571-122207593 AAAGTGTAGCAAATGCTGCCAGG + Intronic
1104632754 12:130418231-130418253 AAATGTCAGTAATTTCTGCCAGG + Intronic
1106572437 13:30939185-30939207 AATTGTTAACATGTGCTGCCTGG + Intronic
1107150085 13:37100845-37100867 ATATGTTGGGAACTGCAGCCAGG + Intergenic
1108550026 13:51534686-51534708 AAATGTTAACAGCTGCAGCTGGG + Intergenic
1109525173 13:63566205-63566227 AAGTGTCTGCTACTGCTGCCTGG + Intergenic
1110175185 13:72547775-72547797 AAATGTTACCAAAAGCTGCCAGG - Intergenic
1110307216 13:74002745-74002767 ATATTCTAGCAACTGCTGGCAGG + Intronic
1110390598 13:74968948-74968970 AAATGTTAGCCACTTCTACAAGG - Intergenic
1115927231 14:38449150-38449172 AAATTTCAGCAACTCCAGCCAGG + Intergenic
1116453575 14:45091776-45091798 AAATGATAGCTATTGTTGCCGGG + Intronic
1116777132 14:49194023-49194045 TGATGTTAGCACCTGCTGCTGGG + Intergenic
1119587756 14:75852843-75852865 AACTGTCAGTAACTGCTGACTGG - Intronic
1124575102 15:30901206-30901228 AAAGGGTAGCAACTGCTTCATGG - Intergenic
1124818864 15:33022868-33022890 AGAGGTTGTCAACTGCTGCCTGG + Intronic
1125457264 15:39872652-39872674 TAATGTCAGCAACTGCTTCTAGG + Intronic
1125793021 15:42384116-42384138 AAATAATAGCTACTGCGGCCGGG + Intronic
1127603299 15:60560778-60560800 AAACATTAGCAGCTGCTGCTGGG - Intronic
1129147403 15:73661317-73661339 AACTGTTAGCAACTGTTGAAAGG - Intergenic
1131614248 15:93997794-93997816 AAATGGTTCCAACTGCTTCCTGG + Intergenic
1131658707 15:94490501-94490523 AAATATTTGCAACTTCAGCCAGG + Intergenic
1133222974 16:4327285-4327307 AAATGACAGCAGCTACTGCCAGG + Intronic
1134538582 16:15046342-15046364 AAATGAGAGCAACACCTGCCAGG + Intronic
1135257934 16:20956222-20956244 AAACGTTAGCAACTCTGGCCGGG - Intronic
1136643501 16:31588708-31588730 GAATTTTAGCAACTCCAGCCAGG - Intergenic
1137764822 16:50969993-50970015 AAATGTTGGCATCTGTTTCCAGG + Intergenic
1139978291 16:70832829-70832851 AGAGGTTAGTAGCTGCTGCCCGG - Exonic
1142181211 16:88671562-88671584 AGATGTTAGGAACCCCTGCCTGG - Intergenic
1142340581 16:89519675-89519697 AAATGTTAGCAACTGCTGCCGGG - Intronic
1143053872 17:4148218-4148240 AAGTGTTAGGAACTGCAGGCTGG + Intronic
1153298889 18:3575522-3575544 CAATGTAACCAACTGTTGCCAGG + Intronic
1153428723 18:4992504-4992526 AGATGCTAGTAACTGCTGCCTGG + Intergenic
1153788166 18:8553458-8553480 AATTGGTTGCAGCTGCTGCCAGG - Intergenic
1155674437 18:28412473-28412495 AAATGTTGGCCCCTGCAGCCTGG - Intergenic
1156593818 18:38522890-38522912 AAATCTTACCAGCTGCTGACAGG + Intergenic
1156837547 18:41573269-41573291 AAATGTTGGTAACTGCCGTCAGG + Intergenic
1157506994 18:48233787-48233809 AAATTATATCAGCTGCTGCCAGG + Intronic
1158879313 18:61761488-61761510 AAATTTAAGTAACTGCTGCAAGG + Intergenic
1158900290 18:61956112-61956134 AAAAGTTAGTAACTGCAGCATGG + Intergenic
1161405022 19:4086627-4086649 ATATGTTAGCAAATCCTGCCCGG + Intergenic
1161407770 19:4099952-4099974 AAAAGTTAGCCAAGGCTGCCGGG + Intronic
1163837866 19:19586612-19586634 AAATGTTTGCAACTCCTCACAGG - Intronic
1163985879 19:20950845-20950867 AAATTTAAGCAACTGCTTCAGGG - Intergenic
1164104137 19:22090345-22090367 AAATTTTAGCAACTGCTTCAGGG - Exonic
1166117755 19:40666434-40666456 AAATATTATGAACTGCTGGCTGG - Exonic
1167179878 19:47894750-47894772 AAATATTATTAACTGCTGCTGGG - Intergenic
1167658065 19:50779281-50779303 AAATGTTAGCTCCTCCTCCCTGG - Intergenic
1167851932 19:52208793-52208815 AAGAGTTAGGAACTGCTGGCCGG - Intronic
1167878417 19:52433659-52433681 AAATGTTAGGTATTACTGCCGGG - Intronic
1168375480 19:55875224-55875246 AAATCTTAGCAAATGCTTCAAGG + Intronic
926212535 2:10881576-10881598 AAATCTAAGCCACTGTTGCCAGG - Intergenic
929082961 2:38139281-38139303 AAATGTAAGCACCTGCAGCAGGG + Intergenic
929208652 2:39328032-39328054 AAAAGTTAGCGAATGCTGGCCGG + Intronic
930179876 2:48343909-48343931 AAATGTTAGCCACTGCTGTTTGG + Intronic
930753424 2:54953612-54953634 AAATGTGAGCCACTGCCGCCCGG - Intronic
937744675 2:125397653-125397675 AAATGGTAGCCATAGCTGCCTGG - Intergenic
940162202 2:150725527-150725549 AAATGTTAACTAGTTCTGCCAGG + Intergenic
942620711 2:177842747-177842769 AAATGTAAGCCACTGCTATCTGG - Intronic
942707481 2:178793000-178793022 AAATCTTAGCAACTGCTTCCTGG - Intronic
1171366464 20:24628183-24628205 AAGAATTAGCAACCGCTGCCAGG + Intronic
1173002940 20:39118530-39118552 AAATGGTTGGAACTGTTGCCAGG + Intergenic
1174270265 20:49363333-49363355 AAATGTTAGCAACTATGGCTGGG - Intergenic
1177080962 21:16638415-16638437 AAATGTTAGGAACTTATGGCCGG + Intergenic
1177253324 21:18625359-18625381 AAATTTAATGAACTGCTGCCTGG + Intergenic
1177420807 21:20854065-20854087 AAATGTTGGCAAATGTTCCCTGG - Intergenic
1178240410 21:30893418-30893440 AAATGGTGGTAACTGCTGACTGG - Intergenic
1178751022 21:35303166-35303188 AGATCTTGGCCACTGCTGCCTGG + Intronic
1180196424 21:46197591-46197613 AAAACTGAGAAACTGCTGCCGGG + Intronic
1180973729 22:19832510-19832532 AAGTTTTAGCCACTGCTGCCTGG - Intronic
1183092747 22:35534328-35534350 GACTGATAGCAACAGCTGCCTGG - Intergenic
1183367493 22:37414908-37414930 AAATGTTAGCAGCTGCCACCTGG + Intronic
949679095 3:6491852-6491874 AAATGATTGAAAATGCTGCCAGG - Intergenic
949789309 3:7775549-7775571 AAATGTTATCACTTGCTGGCTGG + Intergenic
949982735 3:9512461-9512483 AAATGTTAACAATGGCTGCCTGG + Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
950913598 3:16619799-16619821 AAAGGATTGCAACTGCAGCCAGG - Intronic
951432848 3:22628201-22628223 GAATTTCAGCAACTGCAGCCAGG - Intergenic
954529236 3:51304104-51304126 GAATTTTAGCAACTTCAGCCAGG - Intronic
955123276 3:56083368-56083390 AAATGAGAGCAACAGTTGCCTGG + Intronic
958797487 3:98721468-98721490 AAATATTAGAAAATGCTGGCCGG + Intergenic
960467591 3:118016435-118016457 AAATGTTAGCAAGTTATGGCTGG + Intergenic
961170174 3:124791987-124792009 ACATGTTATCAAGTCCTGCCTGG + Intronic
961243799 3:125434527-125434549 AAATGTCTGCAACTGCTCTCAGG - Intergenic
964960838 3:162423046-162423068 AAATGATAGCAATTGAGGCCGGG - Intergenic
966828512 3:183985831-183985853 AAATGTCAGCATCAGCTGGCTGG + Intronic
966909571 3:184551472-184551494 GAATGTTAGCTACTGCTGTGAGG - Intronic
967112699 3:186308720-186308742 AATTGACAGCATCTGCTGCCTGG - Intronic
967139665 3:186545072-186545094 AAATGTTAACAACTGGTGAATGG + Intronic
968329569 3:197855142-197855164 CAGTGCTAGTAACTGCTGCCAGG + Intronic
970976777 4:22050941-22050963 AAATGTTAATAATTGATGCCAGG + Intergenic
971289340 4:25322316-25322338 AAATGGGAGTAACTGCTGACAGG - Intronic
973258226 4:48134978-48135000 AAATGTTGACAAATGTTGCCAGG + Intergenic
973562382 4:52150075-52150097 AGATGTAAGCATTTGCTGCCTGG - Intergenic
975715950 4:77206040-77206062 AAATGTTTGCTACTTCTTCCGGG - Intronic
975849873 4:78561149-78561171 AAATGTTGGGAAAGGCTGCCAGG + Intronic
979742409 4:124167952-124167974 AAATTTCAGCAACTCCAGCCAGG + Intergenic
980516488 4:133868965-133868987 AAATGTTTGCATCTGCAGGCTGG - Intergenic
981877477 4:149564870-149564892 AAATGTTATTAATTGCTGCTAGG - Intergenic
982085207 4:151828524-151828546 ATATGTCAGCAGCTGCTGCTGGG - Intergenic
982957621 4:161792096-161792118 AAATGCCAGCTCCTGCTGCCTGG + Intronic
987298393 5:16574626-16574648 AACAGTCTGCAACTGCTGCCAGG + Intronic
989760845 5:45014610-45014632 AAAAATTAGCAATTGTTGCCTGG + Intergenic
990846661 5:60148154-60148176 AAAAGTTAGGAACTACTGCTTGG - Intronic
991443955 5:66680332-66680354 CAGGGTTAGCAACTGCTGCGTGG - Intronic
992159029 5:73982741-73982763 AGATGTAAGCATCTGCTGCTGGG + Intergenic
996036290 5:118762541-118762563 CAATTTTGGCAACTGCAGCCAGG + Intergenic
997908866 5:137848832-137848854 AAATGGTAGCAGGGGCTGCCTGG + Intergenic
998557126 5:143136386-143136408 AAATGTTAGGAAATGCTCCCTGG + Intronic
998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG + Intergenic
999533946 5:152496032-152496054 AAATGTATGCAACAGCTCCCAGG - Intergenic
1001157593 5:169286671-169286693 AATTTTTAGCAACTGCAGCATGG - Intronic
1003985290 6:11428932-11428954 AGATGTTTACAACTGCTGTCTGG - Intergenic
1005712356 6:28514432-28514454 CTATGTCAGCCACTGCTGCCTGG - Intronic
1008129506 6:47704324-47704346 AAAGAATAGCACCTGCTGCCGGG - Intronic
1009230857 6:61059683-61059705 GAATTTCAGCAACTGCAGCCAGG - Intergenic
1011215645 6:85002975-85002997 AAATTCTGGCAACTGCTGCCCGG + Intergenic
1011672439 6:89695873-89695895 AACTGTGAGCAGCTGCTGCTTGG - Exonic
1011922045 6:92590020-92590042 AAAAGTCAGCACCTGCTGCAAGG + Intergenic
1011988015 6:93474490-93474512 AAATGCTAGCTACCCCTGCCTGG - Intergenic
1012238357 6:96843835-96843857 AGGTGTGAGCCACTGCTGCCCGG + Intergenic
1015538002 6:134285864-134285886 AAATGTTAGGAACAACTGACTGG + Intronic
1016442017 6:144094381-144094403 AAATGTTAGAAGATGCTGCGGGG - Intergenic
1017307822 6:152939710-152939732 ATAAATTAGCAACTGTTGCCAGG + Intergenic
1017722886 6:157256494-157256516 AAATGGGAGCAGCTGCAGCCTGG + Intergenic
1021507643 7:21403085-21403107 AAATGTTACCAACTGATGAATGG + Intergenic
1025041708 7:55651447-55651469 GAATTTTAGCAACTCCAGCCAGG + Intergenic
1026526123 7:71154869-71154891 AAATGTTAGCTATTGTGGCCGGG - Intronic
1026660838 7:72301199-72301221 AGATCTTAGCAACTGCTGACTGG - Intronic
1027133010 7:75604719-75604741 AAATGGTAGAAACTGCTTCAGGG + Intronic
1027440618 7:78215616-78215638 AACTCTGATCAACTGCTGCCTGG + Intronic
1028037171 7:85999399-85999421 AGCTTTTAGCAAATGCTGCCAGG + Intergenic
1029001471 7:97159446-97159468 AAATGTTAGTCAGTGCTGCCTGG - Intronic
1029066040 7:97849527-97849549 AGATGTTAGCCACTGCACCCGGG - Intergenic
1031732718 7:125318176-125318198 AAAAGTTAAAAACTCCTGCCAGG - Intergenic
1032724742 7:134580452-134580474 AAATGTTAACAATTGCTAGCCGG + Intergenic
1033587210 7:142782945-142782967 AAATGTTAGTGACTGAAGCCGGG - Intergenic
1033868227 7:145718412-145718434 GAATTTTAGCAACTCCAGCCAGG - Intergenic
1034520197 7:151613786-151613808 AAATGCTTGGGACTGCTGCCGGG - Intronic
1036956614 8:13194520-13194542 AAATGTTTGCAAATGCTGTTTGG + Intronic
1039045746 8:33447724-33447746 AAATGTTTGCAAAAGCTTCCAGG + Intronic
1041053812 8:53962164-53962186 AAAAGTAAGGAACTCCTGCCGGG + Intergenic
1042743406 8:72076241-72076263 AAACGTAAGCCACTGCTGACTGG + Intronic
1042759190 8:72252378-72252400 AAAGGTAAGCCACTGCTGACTGG + Intergenic
1044102432 8:88157478-88157500 CAAATTTATCAACTGCTGCCTGG + Intronic
1045388730 8:101694370-101694392 ACATGTTAGGAACTTCTGGCAGG - Intronic
1046109771 8:109708625-109708647 AAATGTTAGTAACTAAAGCCAGG - Intergenic
1046404234 8:113751682-113751704 AAATTTTAGTAACTGCACCCTGG + Intergenic
1047476861 8:125240857-125240879 AAATGTTAGGAACAACTGCATGG + Intronic
1050941893 9:11471289-11471311 AAGTGCTTGCTACTGCTGCCTGG + Intergenic
1051459085 9:17293462-17293484 GAATTTCAGCAACTGCAGCCAGG - Intronic
1053039380 9:34856948-34856970 AAATTTTAGCAACTCCAGCCAGG - Intergenic
1055343321 9:75308661-75308683 AAATTTCAGCAACTCCAGCCAGG - Intergenic
1056667398 9:88591633-88591655 AAATGTGCGCAGCTGCTGCAGGG - Intergenic
1057131502 9:92657445-92657467 AAATGTAGCCAACTGCTGCCTGG + Intronic
1057590635 9:96370257-96370279 ATATGTTAGGAAGTGATGCCAGG - Intronic
1059952956 9:119486821-119486843 AAATGTGTGAAACTGCAGCCTGG - Intergenic
1060230523 9:121822193-121822215 GAGTGTTAGGATCTGCTGCCGGG - Exonic
1203369508 Un_KI270442v1:289532-289554 AAATATATGCAAATGCTGCCTGG + Intergenic
1186293414 X:8123428-8123450 AAATTTTAGCCACGGATGCCAGG - Intergenic
1186491686 X:9978837-9978859 AAATGTAGGCAACTGCTCCCGGG + Intergenic
1187588619 X:20691222-20691244 AAATGTTAGCAACATCGGCAAGG + Intergenic
1191043775 X:56114052-56114074 GAATTTTAGCAACTCCAGCCAGG - Intergenic
1191046307 X:56141261-56141283 AACTGTTAGCAAATGCTGGCCGG - Intergenic
1191185527 X:57607408-57607430 GAATTTTAGCAACTCCAGCCAGG - Intergenic
1191768819 X:64733015-64733037 GAATTTTAGCAACTCCAGCCAGG - Intergenic
1192355367 X:70397898-70397920 AAATTTTAGCAAATGATTCCAGG - Intronic
1193533622 X:82686514-82686536 AAATTTCAGCAACTACAGCCAGG - Intergenic
1194162035 X:90465922-90465944 AATTGTTAACAAATGCTCCCAGG + Intergenic
1195314233 X:103662449-103662471 AAATAGTATCAAATGCTGCCAGG - Intergenic
1196284499 X:113863765-113863787 AAATTTTAGCAATTTCAGCCAGG - Intergenic
1197522679 X:127519672-127519694 GAATTTCAGCAACTCCTGCCAGG + Intergenic
1198370330 X:135983540-135983562 AAATGGTAGTAACTTCTACCAGG - Intergenic
1199308215 X:146292571-146292593 AAATTTTAGCAACTCCAGCCAGG - Intergenic
1200508315 Y:4043667-4043689 AATTGTTAACAAATGCTCCCAGG + Intergenic
1202173186 Y:22072801-22072823 AAATGTTAGCAAATGCAGACAGG + Intronic
1202218174 Y:22513570-22513592 AAATGTTAGCAAATGCAGACAGG - Intronic
1202325011 Y:23682485-23682507 AAATGTTAGCAAATGCAGACAGG + Intergenic
1202545760 Y:25987569-25987591 AAATGTTAGCAAATGCAGACAGG - Intergenic