ID: 1142341757

View in Genome Browser
Species Human (GRCh38)
Location 16:89528026-89528048
Sequence AGTGATGTACAGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 515}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142341751_1142341757 26 Left 1142341751 16:89527977-89527999 CCTGGAAGATCACTGCTCTGAGG 0: 1
1: 0
2: 2
3: 19
4: 190
Right 1142341757 16:89528026-89528048 AGTGATGTACAGAAGATGGAGGG 0: 1
1: 0
2: 7
3: 34
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142341757 Original CRISPR AGTGATGTACAGAAGATGGA GGG Intronic
900896808 1:5488382-5488404 ATGGATGTAAAGATGATGGATGG - Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907516081 1:54994299-54994321 AGTGATGTAGAGGAGAGGAAGGG - Intergenic
908081890 1:60589720-60589742 AGAGATGTTCAGGAGCTGGATGG - Intergenic
908941903 1:69445374-69445396 AATTATGGACAGAAGAGGGATGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
909977601 1:82063724-82063746 ATTGGTTTAAAGAAGATGGAAGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910437044 1:87215941-87215963 AGTGATGTACAGGATTTGAATGG - Intergenic
910615628 1:89195215-89195237 AGATATGTACAGAAGTTGAAGGG + Intronic
910704994 1:90119464-90119486 AGTCATGGAGAGAAGAAGGATGG - Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
915140791 1:153767391-153767413 AGTCAGGAACAGAAGAGGGAGGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919127125 1:193408629-193408651 AGAGATAGACAGATGATGGATGG - Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920058118 1:203207388-203207410 AGTGAAGTACAGGAATTGGAAGG + Intergenic
920802329 1:209201029-209201051 AGTGATTTAAAGAATATGGGAGG - Intergenic
922132391 1:222792690-222792712 GTTGATGTAGAGAAGATGGTTGG - Intergenic
922790881 1:228310296-228310318 ATTGATGGACAGACGATAGAAGG - Intronic
922845098 1:228678405-228678427 CGTGAGGGACAGAAGTTGGAAGG + Intergenic
923572468 1:235128708-235128730 AGCGTTGTAGAGAAGATGGTGGG - Exonic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924946537 1:248850521-248850543 AGTCAGGGACAGAAGAGGGAAGG + Intronic
1064064476 10:12169264-12169286 AGTGAAGTTAAGAAGGTGGAAGG + Intronic
1064455731 10:15485782-15485804 AGTGAAGTTCAGAGGAAGGAAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066039892 10:31538258-31538280 TGTGATGTATACAAAATGGATGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068616589 10:59125097-59125119 AGTGAGTTACAGATGAGGGAAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068988156 10:63125748-63125770 AGTGATGTACAGAAAATAGGAGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070252618 10:74786220-74786242 AGTGATGTATAGAAAATGGAAGG + Intergenic
1070462821 10:76686972-76686994 GGTGATATACAGAAGATGTCAGG + Intergenic
1070530231 10:77330580-77330602 AGGGATGTTAAGAAGATTGAAGG - Intronic
1071083118 10:81836656-81836678 AGGGTTGTTCAGAAGATAGACGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071673929 10:87637431-87637453 AGTTATCTTCAGAAGATGGTAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073131352 10:101191026-101191048 AGTGAGGTGCAGAAGATGCCGGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076998305 11:310194-310216 AGAGATGCACAGAGGCTGGAAGG - Intronic
1077676323 11:4196472-4196494 AGCAAGGTAGAGAAGATGGAGGG - Intergenic
1077795591 11:5488393-5488415 AATGATGTGCAGGATATGGAGGG + Intronic
1077846950 11:6035760-6035782 TGTTATGTTCAGAAGATGGTGGG - Intergenic
1078249585 11:9606107-9606129 CGTGATGTCAAGAAGATGGAAGG + Intergenic
1078632624 11:13017219-13017241 AGTAATGTTCAGAATATGTAAGG - Intergenic
1079461743 11:20686559-20686581 AGTGATGTACAAAAAATGGAAGG + Intronic
1079475339 11:20823920-20823942 AATGATTTAAACAAGATGGAAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085067934 11:73514873-73514895 AGTAGTGTACAGGTGATGGATGG - Intronic
1085988343 11:81810819-81810841 CGTGAGGGACAGAAGTTGGAAGG - Intergenic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088280354 11:108128702-108128724 AATGATGTAGAGGAGAAGGAAGG + Intronic
1088512480 11:110592380-110592402 AGTGATGTCCAAAAACTGGATGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091997403 12:5004584-5004606 ATTTATGGACAGAAAATGGAAGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093168231 12:15829826-15829848 ATTGATGTATAGAAGATGTGAGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095527905 12:43150123-43150145 AGTGAGATAGAGAAGAGGGAGGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097588494 12:61544231-61544253 ACTGATGAAGAGATGATGGAGGG + Intergenic
1097761766 12:63474307-63474329 AAAGATGTACATGAGATGGAAGG - Intergenic
1097888472 12:64754160-64754182 AGTGGTGGACAGAGGATAGATGG + Intronic
1098711364 12:73767018-73767040 AGTGACATACAAAAAATGGAAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099578071 12:84405367-84405389 AGGCATATACAGAAGATGGCAGG - Intergenic
1099644418 12:85333739-85333761 AGTGAGGTACATAATATAGAAGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100343187 12:93701206-93701228 AGTGATTTTAACAAGATGGAAGG + Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102116432 12:110406603-110406625 CGTGAGGGACAGAAGTTGGAAGG + Intergenic
1102216528 12:111165391-111165413 AGTTAAGCACAGAAGATGCAAGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106351717 13:28937075-28937097 AGTGATGCTCAGAAGGAGGAGGG + Intronic
1107723217 13:43271223-43271245 ACTGATGTCCAGAAGAAGGGAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1110458281 13:75714797-75714819 AGTAATGTTTAGAAGATGGAGGG + Intronic
1111140127 13:84106161-84106183 AGTGATGTTCAAAAGATCCATGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111357805 13:87132631-87132653 AGAGATGTAGAGAAGACAGATGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1112118214 13:96380939-96380961 TGAGATGTTCAGAAGATAGATGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113322452 13:109248437-109248459 AGTGATGTACAGAAAACAGAAGG + Intergenic
1113403729 13:110019192-110019214 AGTGATGTGGGGAAGATGGTGGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1118731625 14:68670861-68670883 AGAGATGAGCAGGAGATGGATGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119425338 14:74531398-74531420 AGTGATGTGGAGTAGAAGGAAGG + Intronic
1119521733 14:75291329-75291351 TGTTCTGTTCAGAAGATGGATGG - Intergenic
1120074896 14:80145126-80145148 ATTAATTTACTGAAGATGGATGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120830868 14:88996319-88996341 AGTCAAGTACATAAGTTGGAGGG + Intergenic
1121627186 14:95394481-95394503 AGAGATGAACAGAGGATGGATGG + Intergenic
1122218797 14:100222231-100222253 AGTGATGAGCGGAAGCTGGAAGG + Intergenic
1122315288 14:100822630-100822652 AGTGATGTTCAGAGGCTTGAAGG + Intergenic
1124593251 15:31071572-31071594 AGTGAGGGAGGGAAGATGGAAGG - Intronic
1125155317 15:36579141-36579163 CGCGATGTACAGAAGTTGTAGGG + Intergenic
1125530198 15:40408176-40408198 AGTGATGTAGAGAAGGCAGAGGG + Intronic
1125629633 15:41136604-41136626 CGTGAGGGACAGAAGTTGGAAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128124170 15:65178880-65178902 AGTAATTTACAGAAAATGTAGGG + Intronic
1128523177 15:68389078-68389100 AGAGGAGTACAGCAGATGGAGGG - Intronic
1128557250 15:68640185-68640207 GGTGATGGACAGAGGCTGGAAGG - Intronic
1130728921 15:86469526-86469548 AGTGCTGTACTGAATATGGGAGG + Intronic
1130990604 15:88873597-88873619 AGGGATGAAGAGAAGATGAAAGG - Intronic
1131661029 15:94516572-94516594 AGTGATGTCAAAAAGATGGTGGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134395943 16:13863430-13863452 AGAGAGGAACAGAAGATAGAAGG + Intergenic
1134632283 16:15765457-15765479 ATGGATGGACAGATGATGGATGG + Intronic
1135953320 16:26935552-26935574 AGTCAAGTGCAGAAGAGGGAGGG + Intergenic
1136071410 16:27789795-27789817 ATGGATGGACAGATGATGGATGG + Exonic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1137765488 16:50974692-50974714 AGTGCTGCCCAGAGGATGGAAGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139190596 16:64858609-64858631 AATGAGGTAAAGAAGATGCATGG + Intergenic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1140289692 16:73641590-73641612 ACTGATGTAGGGAAGATGGGAGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142341757 16:89528026-89528048 AGTGATGTACAGAAGATGGAGGG + Intronic
1142341848 16:89528523-89528545 GATGATGTACAGAAGATGGAGGG + Intronic
1143340116 17:6204433-6204455 AGTGAGGCAAAGAAGTTGGATGG - Intergenic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1148123019 17:45223319-45223341 AATGATGTCAAGGAGATGGAGGG - Intronic
1148377985 17:47167378-47167400 AGTGATGTACAAACACTGGAGGG - Intronic
1148783890 17:50135859-50135881 AGGGAGGCACAGAAGTTGGAGGG - Intronic
1148982959 17:51595141-51595163 AGTGATGTATAGAAAATGGAAGG + Intergenic
1149499065 17:57137756-57137778 AGTGATGTAAAGCAGATTGTTGG - Intergenic
1150645710 17:66976385-66976407 AGGGATGGAAAGAAGTTGGAGGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151110963 17:71677141-71677163 AAAGTTGTACAAAAGATGGATGG + Intergenic
1151278724 17:73055866-73055888 ATTTATGGACAGAAGATGGAAGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153545599 18:6202134-6202156 AGTGATGTGCAGAAAAGGGAAGG - Intronic
1153908968 18:9689757-9689779 GGTGACATACAGAAAATGGAAGG - Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1161421325 19:4177301-4177323 AGAGATGCACAGCAGATGAATGG - Intronic
1161832423 19:6616633-6616655 AAAGATGTACTGAAGATGGTAGG + Intergenic
1162203314 19:9036997-9037019 ATGGATGAATAGAAGATGGATGG + Intergenic
1162258795 19:9515754-9515776 AGTGGTGAACACAAAATGGATGG - Intergenic
1163349129 19:16764348-16764370 ATGGATGGACAGAAGATGGGTGG - Intronic
1164742368 19:30585373-30585395 AGGGATGAATAGTAGATGGATGG + Intronic
1165183053 19:33989425-33989447 AGGGATGAAGAGAAGATGGGAGG - Intergenic
1165312684 19:35038358-35038380 AGTGCTGTAGAGAGGATGTAGGG + Intronic
1166159943 19:40944982-40945004 AGGGTTGTAGTGAAGATGGAAGG - Intergenic
1166164222 19:40975827-40975849 ACTCCAGTACAGAAGATGGAAGG - Intergenic
1166186611 19:41143542-41143564 ACTCCAGTACAGAAGATGGAAGG + Intergenic
1166654223 19:44598524-44598546 AGTTATGTACTGAAGATGACAGG - Intergenic
1167173337 19:47848514-47848536 AATGAAGGACAGAAAATGGAGGG - Intergenic
1167601370 19:50456858-50456880 ATGGAGGTACAGATGATGGATGG - Intronic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
1168508255 19:56954521-56954543 GGTAATGGACAGAGGATGGATGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926608753 2:14923931-14923953 AGTAATTCACAGCAGATGGAGGG + Intergenic
926611663 2:14953813-14953835 AGTGAGGTACAGAAGATAAATGG + Intergenic
928805180 2:35141254-35141276 AGTTTTTTACAGATGATGGAAGG - Intergenic
929175868 2:38975463-38975485 AGTGATAAACAGAAGATGAAAGG - Intergenic
932589075 2:73052685-73052707 AATTATGGACCGAAGATGGAAGG - Intronic
933716270 2:85363221-85363243 AATGATGAACAGCAGATGCATGG - Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935385807 2:102499028-102499050 AGGGAAGGACAGAAGCTGGATGG + Intronic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937795566 2:126014539-126014561 AGGGATATAGGGAAGATGGAAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939674326 2:145053260-145053282 ATTCATGGCCAGAAGATGGAAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940216466 2:151308699-151308721 AGAGATGTGCAAAAGATGGTTGG + Intergenic
940306517 2:152232901-152232923 AATGATGTTCTGCAGATGGAGGG - Intergenic
941499263 2:166249125-166249147 CGTGATGTAAAGAAAATTGAAGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943320663 2:186438616-186438638 ACTGATGTACAGGAGATGTGGGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943520351 2:188942058-188942080 GGTGTTGTAGTGAAGATGGAAGG - Intergenic
945359113 2:208874670-208874692 AGTGATATACATGAAATGGAAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946202160 2:218076707-218076729 AGGGATGCACAGAGGAGGGAGGG - Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947463049 2:230319730-230319752 AGTGCTGTACAGGAGCTGGCTGG + Intergenic
947472026 2:230409496-230409518 AGTGCTGTACAGGAGCTGGCTGG + Intergenic
948274732 2:236699674-236699696 AGAGATGGTGAGAAGATGGAAGG + Intergenic
1168857585 20:1019644-1019666 GGTGATAGACAGTAGATGGATGG - Intergenic
1169531966 20:6494992-6495014 AGTGATGTACAGAAAATAGAAGG - Intergenic
1173193788 20:40896983-40897005 ACTGAGGCCCAGAAGATGGAAGG - Intergenic
1173351894 20:42253123-42253145 AGGGATGGACAGAGGATGGGAGG + Intronic
1173538193 20:43831770-43831792 AGTGAGGTCCAGAATAGGGAAGG - Intergenic
1174455457 20:50645620-50645642 AGGGATGGACAGCAGCTGGAGGG - Intronic
1175776576 20:61657631-61657653 AAAGATCTACAGAAGTTGGATGG + Intronic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1176130046 20:63492942-63492964 ATGGATGGACAGAGGATGGATGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177180386 21:17738694-17738716 ATTGAAGAACAGAAGATGGAAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177711314 21:24778727-24778749 AGTGAAGTACAGAATAATGATGG + Intergenic
1177879272 21:26672819-26672841 TGTTATGTACAGAAGAGAGATGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178096566 21:29221987-29222009 AGTGAGTTTCAGAAAATGGATGG + Intronic
1178125251 21:29508866-29508888 AGTAATGCAGAGAAAATGGATGG + Intronic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1178784050 21:35635841-35635863 AGGGATTGCCAGAAGATGGAGGG + Intronic
1179363530 21:40734535-40734557 AGTGATTTACACAGGTTGGATGG - Intronic
1180023412 21:45143730-45143752 AGTGAAGAAAGGAAGATGGAAGG - Intronic
1180455134 22:15508753-15508775 AGCTATGCACACAAGATGGATGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1183303955 22:37072088-37072110 GATGATGGACAGATGATGGATGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949566337 3:5248213-5248235 AATGATGTACAGGAGTTGAATGG + Intergenic
949685596 3:6566165-6566187 AGAGATGAACAAAAGGTGGAGGG - Intergenic
949761920 3:7480344-7480366 AGTGATATATAGAAAAAGGAAGG + Intronic
950971245 3:17190554-17190576 AGGGATGAACAGAAGAGGAAGGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
954011793 3:47646679-47646701 AATGAAGTGCAGAAAATGGAGGG - Intronic
954943069 3:54392915-54392937 AGTGATGTCAACAAGATGGCTGG + Intronic
956041108 3:65146022-65146044 GTTGATGTACAAATGATGGAAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957120088 3:76078990-76079012 AGTGATGTTGAGCACATGGACGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958799101 3:98735460-98735482 AGAGATGTGCAGAAGATAGAAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
962180127 3:133197910-133197932 AGTGGTAGACAAAAGATGGAAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965028869 3:163337071-163337093 AGTGATATTCAGAAGAAGGCTGG - Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965368953 3:167836857-167836879 AGTGATGAAGGGAAGAAGGAAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966504459 3:180683957-180683979 AGTGATGTATTGAAGATGAGAGG - Intronic
966554226 3:181241100-181241122 AGTGTTATAGAGAAGCTGGAAGG + Intergenic
968912035 4:3481310-3481332 ATTGAGGTCCAGAAGATGGAGGG + Intronic
969514891 4:7641747-7641769 ATAGATGTATAGATGATGGATGG + Intronic
969703230 4:8779107-8779129 AGTGAGGTTCAGTAGCTGGATGG - Intergenic
969833832 4:9822134-9822156 AGTGATGTTGGGGAGATGGAGGG - Intronic
971008135 4:22398536-22398558 AGTGATGAACAGAGGTTGTAGGG - Intronic
971048052 4:22828476-22828498 TGTTATGCCCAGAAGATGGAGGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971861168 4:32108088-32108110 AGGGAGGTAGAGAAGAAGGAAGG + Intergenic
972070343 4:35011655-35011677 AGAGAGGTACAGAAGAAGAAAGG - Intergenic
972571462 4:40314219-40314241 TGTGATGCACAGACCATGGAGGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973653786 4:53024433-53024455 AGAGATGAAAAGAAGATTGAGGG + Intronic
974103892 4:57445843-57445865 AGTGCTGGACTGAAGAGGGAGGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
974940881 4:68466201-68466223 ATTGATGTATAGTTGATGGAAGG + Intronic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976060321 4:81120237-81120259 AGTGACGTACAGAAATCGGAAGG - Intronic
976368111 4:84253844-84253866 GGTGATCTACAGATGATTGATGG - Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977238128 4:94533500-94533522 AGAGATGTAAAGAAGGTGAATGG + Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980534274 4:134095476-134095498 AGTGATATTCAGAAAATAGATGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980944151 4:139302280-139302302 AGGGAGGGACAGATGATGGAGGG - Intronic
981913805 4:150012146-150012168 AGTAATGTACAGAAGTTGTTGGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983019785 4:162661288-162661310 AGTGACATACAGAAAATGGAAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983281017 4:165680937-165680959 AGTGAGCTAGAGAAGATGAAGGG + Intergenic
983415215 4:167443595-167443617 ATTGATGTACATATGAAGGAGGG - Intergenic
983417934 4:167482129-167482151 ACTGATGTAAAGAAGTAGGATGG + Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983926123 4:173404352-173404374 AAATATGAACAGAAGATGGACGG - Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984401810 4:179275503-179275525 AGAGATGGAAAGAAGGTGGAAGG + Intergenic
986185046 5:5427797-5427819 AATGATGAACAGAAGAGGCATGG + Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988359263 5:30213628-30213650 AGTGATGTCCAGAAGACAGGAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989145513 5:38245708-38245730 AGTGATGTCCTGAAGCTGGAAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991480349 5:67071454-67071476 AAAGATATACAGAAGATGGCTGG + Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992033726 5:72750124-72750146 AGTGATACACAGAGGATGGCAGG + Intergenic
992109901 5:73483098-73483120 AGTGATGTGCAGACGAGAGAAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992594259 5:78329803-78329825 ATGGATGTATAGTAGATGGATGG - Intergenic
992839603 5:80675049-80675071 AGAGATGCACAGAAGATAGCTGG - Exonic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994778643 5:104065506-104065528 CGTGAGGGACAGAAGTTGGAGGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995365454 5:111354950-111354972 TATGATGTACATAAGAGGGATGG + Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995898424 5:117041443-117041465 AGTGTTGTCCAAAAGATGGGAGG + Intergenic
996022783 5:118610191-118610213 TCTGATGCACAGAAGCTGGATGG + Intergenic
997389352 5:133501169-133501191 AGTGAGGTACAGCAGACGGCTGG + Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001422773 5:171599977-171599999 AGTGACAGACAGAAGATGGTGGG + Intergenic
1002844100 6:931088-931110 AGTGATATGCAGAAGAGAGAAGG + Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1003791217 6:9549963-9549985 AGTTATCTTCAGAAGATGGTAGG - Intergenic
1004324810 6:14665070-14665092 TGTCCTGTACAGAAGGTGGAAGG - Intergenic
1004517592 6:16333800-16333822 AGTGATGTAATAAAGCTGGAAGG - Intronic
1004942730 6:20577945-20577967 ATGGATGTCAAGAAGATGGATGG + Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005704980 6:28442586-28442608 ACTGAGGTACAAAAGAAGGACGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007183098 6:39944914-39944936 AGCAAGGTGCAGAAGATGGAGGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008368272 6:50707133-50707155 AGTAAAGACCAGAAGATGGAGGG + Intergenic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011743337 6:90385374-90385396 AGTGATATACAGAAAAGAGAAGG - Intergenic
1011812083 6:91144402-91144424 AGGGAAGCACAGAAGAAGGAAGG - Intergenic
1011925930 6:92644787-92644809 AGACATGGACAGAAGGTGGATGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013226370 6:108121660-108121682 AGAGATGGGCAGAAGCTGGAAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014835325 6:126154969-126154991 AGTGAGGTATGGAAAATGGAAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015831830 6:137378094-137378116 AGTTATTCACAGAAAATGGAAGG + Intergenic
1015846942 6:137530726-137530748 AGTGAAGCAGAGGAGATGGATGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016572829 6:145533786-145533808 AGTGATGTGCAGAAGACAAATGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018535035 6:164810522-164810544 GGTTATATACAGAAGATGGCAGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019335977 7:483055-483077 ATGGATGGATAGAAGATGGATGG + Intergenic
1019345622 7:528894-528916 ATAGATGGACAGAAGATGAATGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1020778596 7:12489812-12489834 AGTGATGTGTAGAAGATGGGTGG + Intergenic
1021086701 7:16429137-16429159 AGTGATGTCCAAAGGATGTAAGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025614091 7:63103213-63103235 AGAGATGTACAGATGGTGAAAGG - Intergenic
1025888993 7:65628414-65628436 AGTGATGTAGATATGATGCATGG + Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026480606 7:70775954-70775976 ATTGTTGGACAGAAGATGGATGG + Intronic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1030061393 7:105624136-105624158 AGTGATGAAGGGGAGATGGACGG - Exonic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1031853456 7:126893512-126893534 AGTGATGTAGATATGATGCATGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032976821 7:137234222-137234244 ACTGATGTACAAAAGATGAAAGG - Intronic
1034419740 7:150983379-150983401 AGGGGTGTTCAGAAGAAGGAGGG + Intergenic
1034507629 7:151506910-151506932 AGTGATGTGCAGTAGATGTTAGG - Intronic
1034883664 7:154781167-154781189 AGGAATGAACAGTAGATGGATGG + Intronic
1036410874 8:8499239-8499261 AGTGATGTAAGGAAGGGGGAGGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037766569 8:21775834-21775856 AGTGAATAACAGGAGATGGATGG + Intronic
1038726348 8:30085692-30085714 AGTCATGAACAAAAGATGAAAGG + Intergenic
1038957378 8:32482463-32482485 AGTGATGTGCAAAGAATGGATGG - Intronic
1039150937 8:34504756-34504778 GGTGATGTGGAGTAGATGGATGG + Intergenic
1039166081 8:34681568-34681590 AGTGATGTCCAAGAGATGGTGGG + Intergenic
1039324174 8:36466555-36466577 AGTTATCTACAGAAGATGTGAGG + Intergenic
1039622938 8:39016968-39016990 AGTGATCTACGGGAAATGGAAGG - Intronic
1041727046 8:61028180-61028202 AGTGATGTATAGATAGTGGAAGG + Intergenic
1041824638 8:62080206-62080228 AGTGCTATACAGAAGATTGATGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043803902 8:84646768-84646790 AGTTATTGACAGTAGATGGAAGG - Intronic
1044027716 8:87194721-87194743 AGTGAACTACAGAATAAGGAGGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046867510 8:119167246-119167268 AGTGACGTACAGAAAATGGAAGG + Intronic
1047739493 8:127795102-127795124 AGTGATGGTCAAAGGATGGAGGG - Intergenic
1048237084 8:132701436-132701458 AGTGAAGTACAGAGGATGCCTGG + Intronic
1048323455 8:133420434-133420456 GGTGATGGAGAGAAGATGGAAGG - Intergenic
1048528423 8:135225845-135225867 AGTGAGGCATGGAAGATGGATGG + Intergenic
1048799332 8:138181611-138181633 AGTGATGAAAAGAAGAAGAAAGG - Intronic
1049035745 8:140074507-140074529 GGAGATGCACAGAAGATGGCAGG + Intronic
1049073691 8:140376897-140376919 AGTGTTGGGAAGAAGATGGATGG + Intronic
1049348218 8:142150243-142150265 AGTGATGGATAGTGGATGGATGG + Intergenic
1049350597 8:142162469-142162491 ATGGATGGACAGAGGATGGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049415981 8:142495372-142495394 AGAGAAGGAAAGAAGATGGAAGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1051989389 9:23133151-23133173 AGTGAGGGAGAGAAGAAGGAAGG + Intergenic
1052240685 9:26269264-26269286 AGTGGAGTATAGAAAATGGAGGG - Intergenic
1052455095 9:28686175-28686197 AGTTATATAAAGAAGATGTAAGG - Intergenic
1053387950 9:37709818-37709840 AGTGAAGTCCAGATGATAGAAGG + Intronic
1053610815 9:39711399-39711421 AGTTATTCACAGAAGATGGCAGG - Intergenic
1054242707 9:62630996-62631018 AGTTATTCACAGAAGATGGCAGG + Intergenic
1054740593 9:68802417-68802439 TGTGATGGATAGAAAATGGATGG + Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058145882 9:101410889-101410911 ACTGAGGTACAGGAGAAGGAGGG - Intergenic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058524270 9:105841157-105841179 AGCCTTGTACAGAAGATGGGTGG - Intergenic
1058579096 9:106435526-106435548 AGTGATGTGAGAAAGATGGAAGG - Intergenic
1060893950 9:127205635-127205657 AAGGATGGACACAAGATGGAAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1185636733 X:1557611-1557633 ATGGATGAATAGAAGATGGATGG - Intergenic
1185934505 X:4240530-4240552 TGTCATGTACAGAAGAGGAATGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187004419 X:15217986-15218008 ATTAATGGACAGTAGATGGATGG + Intergenic
1187044213 X:15630088-15630110 ATGGATGGACAGAAGATGGGTGG + Intronic
1187044231 X:15630238-15630260 ATAGATGGACAGAAGATAGATGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187887698 X:23904948-23904970 AGTGATGTTTAGAAAATCGAGGG - Intronic
1187937215 X:24347529-24347551 AGTGATGCACAGAAAATGGAAGG + Intergenic
1188763768 X:34064303-34064325 TGTGATGCATAGAAGATGGCTGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190465544 X:50722227-50722249 AGAGATGTCCAGAGGAAGGAGGG + Intronic
1190650590 X:52564904-52564926 AGTGATGTAGACAAAAGGGATGG - Intergenic
1190799571 X:53775053-53775075 ATTGACCTAGAGAAGATGGAAGG + Intergenic
1190938694 X:55019648-55019670 ATTGATATAGTGAAGATGGAGGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192678264 X:73223109-73223131 AGCGCTGTAGAGAAGATGGTGGG + Intergenic
1192896717 X:75450688-75450710 AGTGGTTTTCAGAAGATGGGAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193170471 X:78329877-78329899 AGATATGTAATGAAGATGGATGG - Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198874903 X:141213822-141213844 ACTGATGTGAAGAAGATGGGAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200559671 Y:4686104-4686126 AGTGAGGAACGGAAGAGGGAGGG + Intergenic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic