ID: 1142342442

View in Genome Browser
Species Human (GRCh38)
Location 16:89532335-89532357
Sequence CTGTTTGTAGGGAATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 208}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142342432_1142342442 20 Left 1142342432 16:89532292-89532314 CCTGAGGGGTGGCCAGGGGCCCC 0: 1
1: 0
2: 8
3: 52
4: 350
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342435_1142342442 0 Left 1142342435 16:89532312-89532334 CCCCGCGAGCAGCTGCCGTGTGT 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342431_1142342442 21 Left 1142342431 16:89532291-89532313 CCCTGAGGGGTGGCCAGGGGCCC 0: 1
1: 0
2: 2
3: 30
4: 328
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342434_1142342442 1 Left 1142342434 16:89532311-89532333 CCCCCGCGAGCAGCTGCCGTGTG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342433_1142342442 8 Left 1142342433 16:89532304-89532326 CCAGGGGCCCCCGCGAGCAGCTG 0: 1
1: 0
2: 1
3: 29
4: 263
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342437_1142342442 -2 Left 1142342437 16:89532314-89532336 CCGCGAGCAGCTGCCGTGTGTCT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208
1142342436_1142342442 -1 Left 1142342436 16:89532313-89532335 CCCGCGAGCAGCTGCCGTGTGTC 0: 1
1: 0
2: 1
3: 10
4: 79
Right 1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142342442 Original CRISPR CTGTTTGTAGGGAATGGAGC TGG Intronic
902072773 1:13754810-13754832 CTGTTTGCAGGTGCTGGAGCAGG + Intronic
903298914 1:22364061-22364083 CTGTTTGTCGGGCATGGTCCAGG + Intergenic
903429812 1:23286770-23286792 AAGTTTGCAGGGAATGGAGTGGG - Intergenic
903857452 1:26345378-26345400 CTTCTTGTAGTGGATGGAGCAGG + Exonic
905446164 1:38029722-38029744 CTGTTTGTAGAGTAGGGGGCTGG + Intergenic
907911989 1:58834998-58835020 CAGTTCATAGGGGATGGAGCTGG + Intergenic
908080305 1:60570164-60570186 CTATTTGGAGAGAAGGGAGCTGG - Intergenic
908797136 1:67841708-67841730 CTGTGTGTAGGGGTTGGGGCAGG + Intergenic
909317580 1:74243330-74243352 TTGTTTGGAGGGCATGGGGCAGG + Intronic
909362276 1:74776641-74776663 CTGTTTATATTGAATGGAGTGGG + Intergenic
913149048 1:116022134-116022156 CTGTCTGGAGAGGATGGAGCTGG - Intronic
913441852 1:118906807-118906829 CTGTTTGCTGGGAATGTGGCTGG - Intronic
915287349 1:154861504-154861526 GAGTGTGTAGGGAATAGAGCAGG - Intronic
917579033 1:176355322-176355344 CTGTTTGGAGGGACTGATGCAGG + Intergenic
924061260 1:240177210-240177232 GTGTTTATAGGCCATGGAGCAGG + Intronic
1062954631 10:1532141-1532163 CTGTCTTCAGGGAATGGTGCGGG - Intronic
1062954640 10:1532206-1532228 CTGTCTTCAGGGAATGGTGCGGG - Intronic
1063149558 10:3323916-3323938 CTATTTGTAAGGAATGTAGAGGG - Intergenic
1064305559 10:14162923-14162945 GTGTGTGGAAGGAATGGAGCAGG - Intronic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1074719321 10:116250896-116250918 CTGTTTCTGGGGAATGCACCAGG + Intronic
1076112742 10:127873339-127873361 CTGTTTGCAGGGTTTGGGGCAGG + Intergenic
1078782536 11:14453253-14453275 CTGGAGGTAGAGAATGGAGCTGG + Intronic
1079324763 11:19482234-19482256 CTTTTTGTAGGGAACGTAGATGG - Intronic
1079668187 11:23134398-23134420 CTGTTTGTGGGGCACGGAGAAGG - Intergenic
1080118589 11:28648230-28648252 CTGTTTGTAGGAGATGAAGCTGG + Intergenic
1082911715 11:58384471-58384493 CTGTTTGTAGGTAATGGGGCTGG - Intergenic
1084147074 11:67270649-67270671 TTGTTTGCAGGGAAAGGAGTTGG - Intronic
1087500331 11:98944026-98944048 ATGTTGGTGGGGAATGGAACAGG + Intergenic
1087891556 11:103542868-103542890 CTGTTTGTAGGGGAATGACCAGG - Intergenic
1088694747 11:112357153-112357175 CTGTTTGTAGGTAATGCACAAGG - Intergenic
1089088474 11:115845030-115845052 CTGTTTGTTGGAAATTGAGGCGG + Intergenic
1090299481 11:125623124-125623146 CTGTTTGTAGGGGGTGTAGATGG + Intronic
1090560413 11:127926394-127926416 GTGTGTGTAGGGGATGGATCAGG - Intergenic
1091609631 12:1994881-1994903 CTTGTTACAGGGAATGGAGCTGG - Intronic
1095947539 12:47762167-47762189 CTGCTTGAAGGGAATGGGGGAGG - Intronic
1097377139 12:58855065-58855087 CTTTTGGTAGGGAAAGGAGGTGG + Intergenic
1097806695 12:63972469-63972491 CTGATTGCAGGGAGTGGAGAAGG + Intronic
1099538775 12:83878571-83878593 CTGTCTGGAGGGTATGAAGCAGG - Intergenic
1100710588 12:97251987-97252009 GTGTTTGTTGGGAATGGGGGAGG + Intergenic
1101342565 12:103856245-103856267 CTGATTGTCGTGACTGGAGCTGG - Intergenic
1101753191 12:107600216-107600238 CAGCTTGTAGGTGATGGAGCTGG - Intronic
1102169656 12:110832667-110832689 CTGTTTGTAGGGCACCAAGCTGG - Intergenic
1102565221 12:113792840-113792862 ATGTTTGCTGAGAATGGAGCTGG - Intergenic
1102602569 12:114043203-114043225 CTTTTTGTTGGGGATGGGGCAGG + Intergenic
1104574801 12:129957312-129957334 CTGTGTGTAGGGGATGTAGCTGG + Intergenic
1104658031 12:130588414-130588436 CTGTTTGTAGTGAATGATGCTGG - Intronic
1105518927 13:21114246-21114268 CTGTGTGCAGGCGATGGAGCTGG + Intergenic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107988885 13:45799699-45799721 CTGCTTGCAGGGAGAGGAGCGGG - Intronic
1110546823 13:76765139-76765161 CTGTTTCTAGGCAAAGGACCAGG - Intergenic
1113145679 13:107204488-107204510 ATGTATGTAGGGAATAGAGGAGG - Intronic
1117729025 14:58703222-58703244 CTGTTTAGAGGGCATGGAGCAGG - Intergenic
1117928194 14:60807391-60807413 TTGTTTGTAGGGCAAGAAGCAGG + Intronic
1118755682 14:68842105-68842127 CTGCCTCTAGGGACTGGAGCAGG + Intergenic
1119416904 14:74477025-74477047 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1119416916 14:74477104-74477126 GTGTGTGTTGGGAATGGGGCTGG - Intronic
1122273995 14:100581836-100581858 CTGTCTGCTGGGATTGGAGCAGG + Intronic
1124945615 15:34262744-34262766 CTGTATGTAGGGATTGCTGCTGG - Intronic
1124969068 15:34466717-34466739 CTATTTGTAGGGGATAGTGCAGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1131645395 15:94336783-94336805 CTGTGTGTTTGGAATGGAGCAGG + Intronic
1131671354 15:94623061-94623083 CTGTTTGTGTAGAATGGAGGAGG + Intergenic
1135250940 16:20900591-20900613 TTGTTTTACGGGAATGGAGCGGG + Intronic
1137543174 16:49378392-49378414 CTGTTTGCTTGGGATGGAGCGGG + Intronic
1138514699 16:57529512-57529534 CTGGGTGAAGGGATTGGAGCAGG - Intronic
1139428127 16:66895734-66895756 CTGGCTGTAGGGAATGGGGTAGG - Intronic
1140873439 16:79128028-79128050 CTGGATGTGAGGAATGGAGCAGG + Intronic
1141241747 16:82271392-82271414 CATGTTGTAGGGAATGTAGCGGG - Intergenic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1143807420 17:9440894-9440916 ATGCTTGTAGGATATGGAGCCGG - Intronic
1143877136 17:10000458-10000480 CCGTTTGGAGGAAATGGTGCAGG - Intronic
1146635610 17:34502092-34502114 CAGGTAGTAGGGAATGGATCTGG + Intergenic
1153062304 18:1006802-1006824 CTTTTCGTTGGGATTGGAGCAGG - Intergenic
1153270889 18:3320077-3320099 CTGTCTGTAGGGGACAGAGCTGG + Intergenic
1153343006 18:3994414-3994436 CTGTTTATAGAGCAGGGAGCAGG - Intronic
1153603556 18:6807841-6807863 CTGAGTTTAGGAAATGGAGCTGG - Intronic
1154064842 18:11097112-11097134 CTGTTTGCCGAAAATGGAGCAGG - Intronic
1156193983 18:34752327-34752349 CATTCTGTAGGGAAAGGAGCAGG - Intronic
1158307884 18:56126566-56126588 TAGATTGTAGGGAATGGAGGTGG - Intergenic
1158832388 18:61294365-61294387 TTGTGGTTAGGGAATGGAGCTGG - Intergenic
1158969568 18:62654067-62654089 ATGTTTGTAGGGAATGGGGTCGG - Intergenic
1160902683 19:1436593-1436615 CTGACGGCAGGGAATGGAGCTGG - Intergenic
1161055987 19:2190830-2190852 CTGCTTGTAGGAAATGGGGCTGG + Intronic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162744344 19:12790362-12790384 CTGTTTCTAAGGAAGGGAGTGGG + Intronic
1163074711 19:14879586-14879608 CTCTTTCCAGGGAATTGAGCAGG + Intergenic
1164353607 19:27387679-27387701 CTATTTGTAGAAAATGGAACTGG + Intergenic
1165043059 19:33082471-33082493 CTGTTTGTAGGAAATAAAGGGGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
925124280 2:1443216-1443238 GTGTTTGAAGGGAATGGGGCAGG + Intronic
925124304 2:1443350-1443372 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124326 2:1443483-1443505 ATGTTGGAAGGGAATGGGGCCGG + Intronic
925124361 2:1443683-1443705 TTGTTGGAAGGGAATGGAGCTGG + Intronic
925124374 2:1443750-1443772 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124387 2:1443817-1443839 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124399 2:1443884-1443906 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124420 2:1444018-1444040 ATGTTGGAAGGGAATGGAGCTGG + Intronic
925124432 2:1444085-1444107 ATGTTAGAAGGGAATGGGGCAGG + Intronic
925124445 2:1444152-1444174 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124457 2:1444219-1444241 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124478 2:1444353-1444375 GTGTTGGAAGGGAATGGAGCTGG + Intronic
925124488 2:1444420-1444442 ATGTTGGAAGGGAATGGAGCTGG + Intronic
925124498 2:1444487-1444509 GTGTTGGAAGGGAATGGGGCAGG + Intronic
925124521 2:1444621-1444643 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124575 2:1444952-1444974 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124585 2:1445019-1445041 ATGTTGGAAGGGAATGGAGCTGG + Intronic
925124595 2:1445086-1445108 GTGTTGGAAGGGAATGGGGCAGG + Intronic
925124671 2:1445550-1445572 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124683 2:1445617-1445639 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124718 2:1445814-1445836 ATGTTGGAAGGGAATGGGGCAGG + Intronic
925124731 2:1445881-1445903 GTGTTGGAAGGGAATGGGGCAGG + Intronic
925132420 2:1503235-1503257 CTGTCTGGAGGGAACAGAGCTGG - Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
928099898 2:28430861-28430883 CAGGTTGTAGGGGATGGATCTGG - Intergenic
928773747 2:34733475-34733497 CTGCTTCTAGGGAATAGTGCTGG + Intergenic
929206845 2:39305707-39305729 CTGATTATAGGGCAGGGAGCAGG + Intronic
930769135 2:55114336-55114358 CTCTATGAAGGGGATGGAGCTGG + Intergenic
931895143 2:66720259-66720281 CAGTTTGCAGGGAATGCAGCTGG - Intergenic
934206647 2:89936682-89936704 CTGTTTGGAGGGAAATGAGTAGG - Intergenic
937420963 2:121755194-121755216 CTGTGAGTAGGGAATGGATTGGG - Intronic
941499715 2:166257132-166257154 CTGTTTGCAGAGAAAGCAGCTGG + Intronic
942643324 2:178083932-178083954 GTGTTTCTTGGGAATGGAGATGG - Intronic
944759641 2:202801096-202801118 CTGGTTGTGGGGAAGGGAACAGG + Intronic
945846305 2:214949118-214949140 CTTCTTGGAGTGAATGGAGCAGG - Exonic
945943789 2:215974785-215974807 CTGTGTTTAGGAACTGGAGCAGG - Intronic
946212629 2:218159750-218159772 CTGTTTCTGGAGAATGGAGAAGG + Intergenic
946212702 2:218160284-218160306 TTGTCTGCAGGGATTGGAGCTGG + Intergenic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
1169620910 20:7505798-7505820 CTGTTTCCAGGGAATGAAGCTGG - Intergenic
1169620919 20:7505869-7505891 CTGTCTCCAGGGAATGAAGCTGG - Intergenic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1174149541 20:48476433-48476455 CTGTTTGAGGGTCATGGAGCTGG - Intergenic
1175325554 20:58125286-58125308 CTGTCTCTAGGTAAAGGAGCTGG + Intergenic
1178326817 21:31653213-31653235 CTGTTTTTAAGGAAAGGGGCTGG - Intergenic
1178392019 21:32206369-32206391 CTCTTTGTATAGACTGGAGCCGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1183161052 22:36113391-36113413 TTGTTGGTAGGAATTGGAGCAGG - Intergenic
1184016536 22:41790033-41790055 CTGGTTGAAGGGAATGAAGGAGG - Intronic
1184992001 22:48176849-48176871 CTGCTTGTAGGGGATGAACCTGG - Intergenic
949239092 3:1848477-1848499 CCCTTTTTAGGGACTGGAGCAGG + Intergenic
951838042 3:27003806-27003828 CTTTTGGTAGGGAAAGGAGGTGG - Intergenic
952722445 3:36547116-36547138 CTGCTTGAAGGCAATGGACCTGG + Exonic
952963592 3:38607829-38607851 CTTCTGGAAGGGAATGGAGCTGG + Intronic
953375879 3:42428225-42428247 GTGGTAGAAGGGAATGGAGCAGG - Intergenic
953492961 3:43365392-43365414 CTGTTTGCTGGGAAAGGAGAGGG - Intronic
955466130 3:59238873-59238895 CCCTTTGTGGGGAATGGAACTGG - Intergenic
956007861 3:64799667-64799689 GCGTTTGAAGGGAAAGGAGCAGG - Intergenic
956066481 3:65402157-65402179 TTGTTGGAAAGGAATGGAGCAGG + Intronic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
961122077 3:124381334-124381356 CTGTTTGTAGGGAAGTGATGTGG + Intronic
962374846 3:134851066-134851088 GTGTTTGAAGGGAAAGGTGCTGG + Intronic
964624841 3:158748965-158748987 GTGTTTGCAGGGAAGGGATCGGG - Intronic
966320778 3:178699184-178699206 CTGCTTGCAGGGCATGGAGAAGG - Intronic
969153035 4:5186629-5186651 CTGTGTGTTGGGGATGGACCAGG - Intronic
969227426 4:5808031-5808053 CTGCCTGTGGGGACTGGAGCTGG + Intronic
969957075 4:10902000-10902022 CTGTCGGTAGGGCATGGAGAGGG - Intergenic
970454125 4:16205098-16205120 CTTTCTGTGGGGAATGAAGCAGG + Intronic
971003485 4:22348818-22348840 CTCTTGGTAGGGAATGTCGCAGG - Intronic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973534404 4:51867038-51867060 CTGTGTGCAGTGATTGGAGCGGG - Intronic
982660747 4:158203519-158203541 CTGTTTTTTGGAAATGGAGAAGG - Intronic
984088045 4:175336160-175336182 CCATTTCTAGGGAACGGAGCAGG + Intergenic
985135489 4:186781687-186781709 CTGTTAGCAGGGAAAGGGGCAGG - Intergenic
986041903 5:4001706-4001728 GTCTTGGAAGGGAATGGAGCTGG - Intergenic
989267206 5:39489596-39489618 TTGTTTGGAGGGCATGGAGAAGG - Intergenic
992187680 5:74259888-74259910 CTGAGGGTAGGGAATGGAGGTGG - Intergenic
994881364 5:105501473-105501495 CTGCTGCTAGGGAATGGAGGAGG - Intergenic
999089607 5:148924650-148924672 CTGTTAGTAAGTAATGGAGCTGG + Intronic
1000141855 5:158412611-158412633 CTGTTTGTTGAGAGTGGGGCTGG + Intergenic
1000160030 5:158588200-158588222 CTGATAGTAAGGAATAGAGCTGG - Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1006505882 6:34488298-34488320 CTGTTTGTATGGCAAGGGGCAGG - Intronic
1007227020 6:40322207-40322229 CTGTCTGTTGGGAACGGAGCGGG - Intergenic
1007330631 6:41104671-41104693 TTGTTTGTTGTGAATGTAGCAGG + Intergenic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1008759259 6:54834377-54834399 CCTTTTGTATGTAATGGAGCTGG - Intergenic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013952835 6:115805649-115805671 CTGTTGGGTGGGAATGGAGGAGG + Intergenic
1014109823 6:117608066-117608088 CTTTTGGTAGGGATTGGAGAGGG + Intergenic
1014467672 6:121776490-121776512 CAGCTAATAGGGAATGGAGCTGG + Intergenic
1016444592 6:144119095-144119117 CCTTTTGTAGGGAAAGGAGGCGG + Intergenic
1018623599 6:165755673-165755695 ATGTTTGTAGGAAATGGAACAGG + Intronic
1018995665 6:168708337-168708359 CTGTTTCTGGGTAATGGATCTGG + Intergenic
1020471870 7:8546720-8546742 CTTATGGTAGGGGATGGAGCAGG - Intronic
1021172902 7:17417528-17417550 CTGTTTTTAAGGAATGGAAAGGG - Intergenic
1027430206 7:78104162-78104184 GTGCTTGTGAGGAATGGAGCAGG + Intronic
1028948171 7:96604278-96604300 CTTTTTGTATGGAATGAAGCTGG + Intronic
1029775922 7:102684009-102684031 CTGTCTGCCTGGAATGGAGCAGG + Intergenic
1031130694 7:117830020-117830042 CTGTTTCTATGGAATGGAGTAGG - Intronic
1031264682 7:119568052-119568074 CCTTTTGTAGGGAAAGGAGGCGG - Intergenic
1033088932 7:138367456-138367478 CGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1035290507 7:157834969-157834991 CTGTGGGTGGTGAATGGAGCTGG + Intronic
1035649973 8:1256941-1256963 CTGTGTGAAAGGAATGGGGCAGG - Intergenic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1036059715 8:5302381-5302403 CTGTTTGGTAGGAATGGTGCAGG + Intergenic
1036954763 8:13175883-13175905 GTGTTTGCAGGGACTGGAGAAGG - Intronic
1037544116 8:19900840-19900862 CTGTTTGTGGGGAAGGGTGGAGG + Intergenic
1038397068 8:27254596-27254618 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397087 8:27254674-27254696 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397093 8:27254710-27254732 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397099 8:27254746-27254768 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397121 8:27254831-27254853 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397127 8:27254867-27254889 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397133 8:27254901-27254923 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397139 8:27254931-27254953 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1041179075 8:55229163-55229185 CTGTTTGTAAGGCAGGCAGCAGG + Intronic
1041831657 8:62161889-62161911 CTGGTTGCAGGGGCTGGAGCTGG - Intergenic
1045662706 8:104454555-104454577 CTGTATGTAGTGAAGGGAGTGGG + Intronic
1049565386 8:143335310-143335332 CTGTTTGTAGGGGATGAGGTAGG - Intronic
1049854806 8:144854586-144854608 TTGTTTAAAGGGAATGGATCTGG + Intergenic
1051493619 9:17694883-17694905 TTTTCTGTAGGGAATGGAGTAGG + Intronic
1051815180 9:21096314-21096336 GTTTGTGAAGGGAATGGAGCTGG - Intergenic
1051816903 9:21119498-21119520 GTTTGTGGAGGGAATGGAGCTGG + Intergenic
1052780395 9:32776921-32776943 CTGTTTGTTAGGAATTGTGCTGG - Intergenic
1053019245 9:34683573-34683595 CTATTTGCAGGGAATGTAGAAGG - Intergenic
1056738234 9:89227692-89227714 CACTTTGTAGGGTAAGGAGCAGG - Intergenic
1058828037 9:108792612-108792634 CTGTCAGTAGAGAAGGGAGCTGG - Intergenic
1061473264 9:130844208-130844230 CTGATAGTAGGGAGTGGAGGTGG + Intronic
1187480279 X:19648812-19648834 CTGTATGTAGGGAAGGGCGGGGG - Intronic
1189900897 X:45705362-45705384 ATATTTTTAGGGAATGGAGGAGG + Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190428891 X:50359320-50359342 ATGTTTGTGGGGAATGAAGTAGG - Intergenic
1192986759 X:76408076-76408098 CTGGTTATAGGGAATGTATCCGG - Intergenic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1197629436 X:128841516-128841538 CTTTTTGGAGGGAATTGGGCAGG + Intergenic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1201377048 Y:13333893-13333915 CTGTTTCTAGGTAAGAGAGCAGG - Intronic
1201718075 Y:17068139-17068161 CTGTATGCAGGGAAAAGAGCTGG + Intergenic