ID: 1142342976

View in Genome Browser
Species Human (GRCh38)
Location 16:89536243-89536265
Sequence AGCACCAGAGGCCACACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142342976_1142342980 4 Left 1142342976 16:89536243-89536265 CCTTCAGTGTGGCCTCTGGTGCT 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1142342980 16:89536270-89536292 GGCCTTCAGTGTGGCCTCTCTGG 0: 6
1: 9
2: 1
3: 25
4: 205
1142342976_1142342984 26 Left 1142342976 16:89536243-89536265 CCTTCAGTGTGGCCTCTGGTGCT 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1142342984 16:89536292-89536314 GTGCTGTGTGGCCTTCAGTGTGG 0: 11
1: 6
2: 4
3: 31
4: 241
1142342976_1142342982 14 Left 1142342976 16:89536243-89536265 CCTTCAGTGTGGCCTCTGGTGCT 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1142342982 16:89536280-89536302 GTGGCCTCTCTGGTGCTGTGTGG No data
1142342976_1142342979 -5 Left 1142342976 16:89536243-89536265 CCTTCAGTGTGGCCTCTGGTGCT 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1142342979 16:89536261-89536283 GTGCTGTGTGGCCTTCAGTGTGG 0: 11
1: 6
2: 4
3: 31
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142342976 Original CRISPR AGCACCAGAGGCCACACTGA AGG (reversed) Intronic