ID: 1142343829

View in Genome Browser
Species Human (GRCh38)
Location 16:89541450-89541472
Sequence GGGGAGGTCTCCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 1, 2: 3, 3: 81, 4: 620}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142343829 Original CRISPR GGGGAGGTCTCCAGGGAGGA GGG Intronic
900252455 1:1678279-1678301 GGCGAGGTCTTCATGGGGGAGGG - Intronic
900395934 1:2453258-2453280 GGGAAGGGCCCCAGGGAGCACGG - Intronic
900423203 1:2564576-2564598 GGCGTGGTCTCCAGGGACCACGG + Intronic
900589224 1:3452350-3452372 GGGTAGGTGTCCAGGGCTGAGGG - Intergenic
900701800 1:4053268-4053290 GAGGAGGACTCCAGGCAGGGAGG - Intergenic
900866993 1:5275833-5275855 AGGGACTTCTCCAGGGAGGGTGG + Intergenic
901018488 1:6244635-6244657 GGGGAGGGCTGGAGGGAGGAGGG + Intronic
901036973 1:6342112-6342134 GGGGAAGTCTCCAGGGACTTGGG + Intronic
901459446 1:9382987-9383009 GGTGAGGACTGCAGGGATGAGGG - Intergenic
901463606 1:9406421-9406443 CGGGAGGGCTCCAAGGAGAAAGG - Intergenic
901505072 1:9679640-9679662 GGAGTGGTCTCCAGGAAGGCTGG - Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
901788276 1:11638997-11639019 GGGGAGGTCTCCAGTGGGGCAGG - Intergenic
901834060 1:11912311-11912333 AGGGAGGTCTTCCTGGAGGAAGG - Intergenic
901877600 1:12175692-12175714 GGGGTGATGTCCAGGGAGAATGG - Intronic
902336326 1:15757012-15757034 GGGAAGGACTCAAAGGAGGAAGG - Intronic
902414812 1:16232362-16232384 GGTGTGGGCTCCAGGGAGGAGGG - Intronic
902489009 1:16766898-16766920 TAGGAGGTCCTCAGGGAGGAGGG - Intronic
902573778 1:17363758-17363780 GGAGAGGACGCCAGGGAAGATGG - Exonic
902962632 1:19975675-19975697 TGGAAGGTTTCCAGGGAAGAGGG + Exonic
903223358 1:21881118-21881140 AGGGAGGGCTCCCGGGAGGAGGG + Intronic
903286366 1:22279440-22279462 GGGGAGGTGGGCAGGGTGGATGG + Intergenic
903450647 1:23451734-23451756 GAGAAGGTCTGCTGGGAGGAGGG - Intronic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903667976 1:25019364-25019386 GGAGGGGCATCCAGGGAGGAGGG + Intergenic
904091284 1:27946657-27946679 GGGGAGCTCTCGAGGAAGGCTGG + Intronic
904322601 1:29707288-29707310 GGAGGGGTCTGCAGAGAGGAGGG + Intergenic
904644403 1:31955083-31955105 GGGGAGGCAGGCAGGGAGGAAGG + Intergenic
904799813 1:33084263-33084285 GGAGGGGTCTCAAGGGATGAGGG + Intronic
904860312 1:33533010-33533032 GGGAAGCTCTCCAGGGCGGGAGG - Intronic
904940421 1:34162229-34162251 TGGGAAGTCTCCAGGGAGGCTGG + Intronic
905012868 1:34759079-34759101 GGGAAGGCCTCCAGGGAGGCTGG - Intronic
905257416 1:36693745-36693767 GGGCTGGTTTCCAGGGAGGTGGG + Intergenic
906517092 1:46446056-46446078 GGAGAGGGCTCCAGAGAGCAAGG + Intergenic
906520613 1:46464881-46464903 GTGGAGGTCTCAAGAGAGGTGGG + Intergenic
906608085 1:47184906-47184928 GGGGAGGTGGCTGGGGAGGACGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907302764 1:53498809-53498831 GTGGGGGTCTCCAGCTAGGAAGG - Intergenic
907329321 1:53660936-53660958 GGGGAGGTGGCCATGCAGGATGG + Intronic
907680120 1:56555244-56555266 GGGGAAGTCACCAAGCAGGAGGG - Intronic
908434525 1:64092120-64092142 AGGGAGGCATGCAGGGAGGAAGG - Intronic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
912206589 1:107515883-107515905 GGGGTGCTGCCCAGGGAGGAAGG - Intergenic
912421218 1:109543560-109543582 GGAAGGGTCTCCTGGGAGGAAGG + Exonic
912437014 1:109668856-109668878 GGGAGGGTCCCCAGGAAGGAGGG + Intronic
912795200 1:112689167-112689189 GGGGAGGTCTGCAGGGTGTGAGG + Intronic
912804545 1:112744603-112744625 GGGAAAGTCTCCACGCAGGAAGG + Intergenic
913077445 1:115353053-115353075 GGGGAGGACTGCAGAGGGGATGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914920081 1:151840344-151840366 GGGGAGGGCTACAGAGAAGAGGG + Exonic
915348803 1:155212061-155212083 GGGCACTTCACCAGGGAGGAAGG - Intronic
915351995 1:155232687-155232709 GGGCACTTCACCAGGGAGGAAGG - Intergenic
915637058 1:157194855-157194877 GGGGCGGGCTCCAGGGCGGCAGG - Intergenic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
916444174 1:164856615-164856637 AGGGAGGGCTCCTGGGAGGGCGG - Intronic
917431264 1:174972026-174972048 GGCGAGTTCTCAAGAGAGGAAGG - Intronic
917668199 1:177246181-177246203 GGAGAGATCCCCAGGCAGGAAGG - Intronic
920959748 1:210653839-210653861 GGGAGGGTCTTCATGGAGGATGG + Intronic
920961828 1:210670475-210670497 CTGAAGGCCTCCAGGGAGGATGG + Intronic
922078254 1:222268983-222269005 GGAGAGATATCCAGAGAGGAGGG - Intergenic
922707069 1:227795447-227795469 GGGGAGCTCCCCTGGAAGGAGGG - Intergenic
922762275 1:228140511-228140533 GGGGAGCTCTGGAGGGCGGACGG + Intronic
922785348 1:228279806-228279828 GGGGATGTCTGCAGGGAGTGGGG - Exonic
923531427 1:234815626-234815648 TAGGAGGTCCTCAGGGAGGAGGG + Intergenic
923785068 1:237058727-237058749 GGTGAAGTCTCCGGGGAGGAAGG - Intronic
924146997 1:241086752-241086774 AGGGATGACTCCAGAGAGGAAGG - Intronic
924385717 1:243496620-243496642 GGGCAGGTCTCCTGTGAGCAGGG + Intronic
1062987095 10:1779200-1779222 GGGGATTTCTCCAGGGTGGCCGG + Intergenic
1063381826 10:5590556-5590578 TGGGAGGGTTCCAGGGAGGGGGG - Intergenic
1063623278 10:7667410-7667432 TGGGGGGTGTCCAGGGAGGCAGG - Intergenic
1063646463 10:7888518-7888540 GTGGAGGTCTGCAGTGTGGAGGG + Intronic
1063968495 10:11364950-11364972 GGGGACATCTCCAGGCAGGGGGG - Intergenic
1064295667 10:14076946-14076968 GGGGAGGTGTCCAAGCTGGAGGG + Intronic
1065497229 10:26341848-26341870 GGGGAGGAGTGGAGGGAGGAAGG + Intergenic
1065895613 10:30160856-30160878 TGGAAAGTCTCCAGGGAGCAAGG + Intergenic
1066963683 10:42242599-42242621 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1067070402 10:43126672-43126694 AGGGAGGGCTCGAGGGAGGGGGG - Exonic
1067448936 10:46369356-46369378 GGGGAGGTCTCCTGGGGGCAGGG + Intronic
1067588433 10:47491409-47491431 GGGGAGGTCTCCTGGGGGCAGGG - Intronic
1067635559 10:47999500-47999522 GGGGAGGTCTCCTGGGGGCAGGG - Intergenic
1067796707 10:49326482-49326504 GGGGAGGCCCCCTCGGAGGACGG - Exonic
1067829896 10:49605497-49605519 GGAGTGGTCTCAATGGAGGAGGG + Intergenic
1067832012 10:49615805-49615827 AGGGAGGTATGCAGGGAGGCTGG - Intronic
1067877970 10:50020903-50020925 GGGGAGGTCTCCTGGGGGCAGGG + Intergenic
1067972677 10:50991037-50991059 GAGGGGGTCTCAGGGGAGGAAGG + Intergenic
1068788492 10:61001835-61001857 GGGGAGGCCTCCAGGAAGGGCGG - Intergenic
1069461630 10:68600259-68600281 GGGCAGGTCTGCATGGGGGAGGG - Intronic
1069572213 10:69501114-69501136 GGGGAGGACTGCAAGGAGGCAGG + Intronic
1069685090 10:70312794-70312816 TCGGTGCTCTCCAGGGAGGAGGG + Intronic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1070132117 10:73663507-73663529 GGGGAGGTCTCCTGGGGGCAGGG - Intronic
1070694692 10:78553097-78553119 AGGGAGGCCTTCAGGGAGTATGG - Intergenic
1070942123 10:80357074-80357096 GGGGAGGGGGCCAGAGAGGAGGG + Intronic
1070942164 10:80357231-80357253 GGGGCGGGGTCCAGGGAGGAGGG + Intronic
1070964799 10:80523375-80523397 GAGGAGTTCTCCTGGGAGGTGGG + Exonic
1071519296 10:86319150-86319172 GGGGAGGCACCCAGGGAGAAAGG + Intronic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1071609566 10:87020568-87020590 GGGGAGGTCTCCTGGGGGCAGGG + Intronic
1071794429 10:88990340-88990362 GGGGAGGTCTTGAAGGAGAATGG - Intronic
1073019859 10:100434092-100434114 GGGGAGGGCGCCAGGGAAGTAGG + Intergenic
1073328875 10:102658127-102658149 GTTGAGGTCAGCAGGGAGGAGGG + Exonic
1073583536 10:104688211-104688233 AGGGAGGTCTCCAGTGAAGCAGG + Intronic
1074761386 10:116669807-116669829 GAGGAGGTGGGCAGGGAGGAGGG + Intronic
1074772916 10:116744881-116744903 GAAGAAGACTCCAGGGAGGAAGG - Intergenic
1075630651 10:123998832-123998854 GGAGAGGTCTGCAGGGTGCATGG - Intergenic
1076064991 10:127441727-127441749 GGGGAGGCCCGCAGGGGGGAAGG - Intronic
1076510507 10:131011088-131011110 CGGGAGGCCTCCTGGGAGGCAGG + Intergenic
1076661482 10:132058529-132058551 GGAGCGGCCTCCGGGGAGGAGGG - Intergenic
1076673049 10:132133645-132133667 GGGGAGGTGCCCAGGCAGGAGGG - Intronic
1076687197 10:132203552-132203574 GGGGAGGACTGCAAGGAGGGAGG + Intronic
1076808056 10:132869170-132869192 GGGCAGGAGTCCAGGGAAGAGGG + Intronic
1076840581 10:133043378-133043400 AGGGAAGTTTCCAGGCAGGAGGG - Intergenic
1076840603 10:133043458-133043480 AGGGAAGTTTCCAGGCAGGAGGG - Intergenic
1077377958 11:2214483-2214505 GAGGAGGTCTCCAGGGCTGGAGG - Intergenic
1077403245 11:2369240-2369262 GGAGGGGACCCCAGGGAGGAGGG - Intergenic
1077484011 11:2830641-2830663 GGGAAGGTCTCCACCCAGGAAGG - Intronic
1077531073 11:3095198-3095220 GGGGAGGTCTCCAGGCTCCACGG + Intronic
1078715612 11:13836437-13836459 GGGGAGTCCTGCAGGGAGGGAGG + Intergenic
1079035067 11:17014007-17014029 GAGGAGGGCTTCACGGAGGAGGG - Exonic
1079238589 11:18706588-18706610 GGGGAGGGCTCTAGGGAGCCGGG - Intronic
1079413887 11:20214665-20214687 TGAGAGGTCTGCAGGGAGAAGGG - Intergenic
1080417754 11:32084761-32084783 GGTAGGGTCTCCAGGGAGGTAGG - Intronic
1081227449 11:40541646-40541668 GGGGAGGTAACCAAGGAGGATGG - Intronic
1081658982 11:44876270-44876292 GGGGCTGACTCCAGGGAGGCGGG + Intronic
1081771592 11:45653489-45653511 GGCCAGGTATCCAGGGAGAAAGG + Intronic
1081814245 11:45929661-45929683 GGTGGGGTCCTCAGGGAGGAAGG + Intronic
1081997867 11:47376662-47376684 GGGGAGGAGGACAGGGAGGAGGG - Intronic
1082274017 11:50201944-50201966 GGGTAGGTTTGCAGGGAAGATGG - Intergenic
1082804505 11:57439036-57439058 GGGGAAGTGTCCAGGGAGGCTGG + Intergenic
1083213053 11:61201113-61201135 GGGGAGGTCACCAGGTAGATAGG - Intergenic
1083215994 11:61220277-61220299 GGGGAGGTCACCAGGTAGATAGG - Intergenic
1083218878 11:61239103-61239125 GGGGAGGTCACCAGGTAGATAGG - Intergenic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083436533 11:62647147-62647169 CGGGACTTCTCCAGGGAGGGTGG - Exonic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1083731177 11:64653542-64653564 GGGGAGGGGTGCAGGCAGGAGGG - Intronic
1084445429 11:69200762-69200784 GCGGAGGTCTCCCGGCAGGGAGG + Intergenic
1084471096 11:69359287-69359309 CTGGAGGTCTCCAGGGTGGCAGG + Intronic
1084725585 11:70939713-70939735 GGGGAGGGCTGCGGGTAGGACGG - Intronic
1085391446 11:76184343-76184365 GGGGAGGGCTTCCTGGAGGAGGG + Intergenic
1089186448 11:116618738-116618760 GGAGGGCTCTCCAGGGAGAAGGG - Intergenic
1089479078 11:118790959-118790981 GCGGAGGTTTCCGAGGAGGAAGG - Intronic
1089587930 11:119521768-119521790 GGAGAGGTCTGGAGGGAGAAGGG + Intergenic
1090189433 11:124758829-124758851 GGGCAGATTTCCAGCGAGGAGGG + Intronic
1090239810 11:125174107-125174129 AGGAAGGTCTCCTGGGAGGAAGG - Intronic
1090247492 11:125226884-125226906 GGAGAGGCTGCCAGGGAGGAGGG - Intronic
1090262449 11:125331311-125331333 GGGGAGGTGTCCAGGGCAGCAGG - Intronic
1090654822 11:128835038-128835060 GGGCTGTTCTCCAGGGAGAATGG + Intergenic
1090718034 11:129447462-129447484 GGAGAGGGCTCCTAGGAGGAAGG + Intronic
1090856205 11:130611078-130611100 GGGGTGGTCTCCAGGGGGTGAGG + Intergenic
1090894965 11:130964087-130964109 GGTGAGGTGGCCAGGGAGGGTGG + Intergenic
1090918246 11:131186092-131186114 GGACAGGCCTCCTGGGAGGAGGG - Intergenic
1090967881 11:131614345-131614367 GGGTGGGTCTCCATGGAGCATGG - Intronic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1091671309 12:2454061-2454083 CTGGAGGGCTCCAGGGAGGTGGG - Intronic
1091797205 12:3304194-3304216 GGGGGGGTCCCCAGAGAGGGGGG + Intergenic
1091875308 12:3928921-3928943 GGGGAGGTGGGCAGGGGGGAGGG - Intergenic
1092149303 12:6236132-6236154 GAGGAGGTGCCCTGGGAGGAAGG + Intronic
1094221357 12:27997160-27997182 TGGGAGGTGTCCAGTGAGAAGGG + Intergenic
1094311325 12:29086937-29086959 GGGGGTGGCTCCAGGGAGAAGGG - Intergenic
1094339364 12:29393379-29393401 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1094687961 12:32737892-32737914 GGGGAGGGCTCCTGGGAGGCAGG - Exonic
1095957343 12:47814232-47814254 GGACAGGGCTCAAGGGAGGATGG - Intronic
1096098763 12:48956591-48956613 GGGGCGGTCTCACAGGAGGAGGG - Intronic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096652988 12:53071228-53071250 GGGGAGGACCCCTGGGAGGGCGG + Intronic
1097234031 12:57527866-57527888 GGGGAGGGCTCCAGGGCTGCTGG - Exonic
1097636192 12:62125227-62125249 GGTGAGGACTCCAGAGGGGAAGG - Intronic
1097699019 12:62801734-62801756 TGGGAGCCCTCCAGGAAGGACGG + Intronic
1097708917 12:62897274-62897296 GGGGAGGGCACAAGGGAGTAGGG - Intronic
1099503431 12:83444034-83444056 AGGGAGGTCTTCAGGGTGAAAGG - Intergenic
1099946379 12:89249394-89249416 GGGGACTACTACAGGGAGGAGGG + Intergenic
1100603508 12:96132400-96132422 GGGGTGGTGTCCAAGAAGGAGGG - Intergenic
1102445173 12:112996746-112996768 TGGGACGTCTCCAAGCAGGAGGG + Intronic
1102999568 12:117375093-117375115 GGGAAGGTGAGCAGGGAGGAGGG + Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1103347362 12:120260120-120260142 GGAGAGGTGACCAGGGAGGGAGG + Intronic
1103465534 12:121139339-121139361 GGACTGGTCTCCAGGGAAGAGGG - Intronic
1103678959 12:122678317-122678339 AGGGAGGGATCAAGGGAGGAAGG - Intergenic
1103905750 12:124326504-124326526 GGGGCGGGCAGCAGGGAGGAGGG - Intronic
1104356339 12:128090089-128090111 GGAGAGGACTCCAGGGAACAGGG + Intergenic
1104894178 12:132153768-132153790 GGGAAGGCCTCCCGGGGGGACGG - Intergenic
1104957991 12:132475245-132475267 GGGGGGGTCACCGCGGAGGAAGG - Intergenic
1105468868 13:20673527-20673549 GGAAAGGTCACCAGGGAGGCTGG - Intronic
1105892061 13:24689020-24689042 GGAGGGATCTCCAGGCAGGATGG + Intronic
1106079457 13:26488212-26488234 TGTGAGGTCTCCAGGGAAGGAGG + Intergenic
1106476886 13:30106655-30106677 TGGGAGGACTCCAGGTACGATGG - Intergenic
1106563120 13:30863487-30863509 CGGGAGGTCGCCAGAGAGGCTGG - Intergenic
1106593079 13:31114575-31114597 GTGGATGTCTCCTAGGAGGAGGG - Intergenic
1106928848 13:34641614-34641636 GGGGATGTTTCCAAGGAGAATGG + Intergenic
1108403868 13:50081163-50081185 GGTGAGGTCTCTAGGTAGGTAGG - Intergenic
1108955979 13:56157414-56157436 GGGGACTACTACAGGGAGGATGG + Intergenic
1109291487 13:60480755-60480777 TGGGAGTGCTCCAGTGAGGAGGG + Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111906208 13:94259020-94259042 GGAAAGGTTTCCAGTGAGGAAGG - Intronic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1113464769 13:110505535-110505557 GGGGAAGTGTCCTGGGAGAAAGG + Intronic
1113565977 13:111320123-111320145 CAGGCGGCCTCCAGGGAGGAAGG - Intronic
1113604337 13:111594824-111594846 GGGGTGGTCTGGAGGGTGGATGG - Intronic
1113608045 13:111624243-111624265 GGAGGGGTCTGCAGAGAGGATGG - Intronic
1113638953 13:111943644-111943666 GGTGAGGGCCCCAGGGAGGCAGG + Intergenic
1114720443 14:24875528-24875550 GGGGAGGACTCTTGGCAGGAAGG + Intronic
1115592272 14:34875200-34875222 GAGGCGGTCCCCTGGGAGGACGG - Exonic
1117079576 14:52137346-52137368 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1118270520 14:64338661-64338683 GGGGCGGTCTGCGGGGAGGGGGG - Intergenic
1118715419 14:68556404-68556426 GGAGCGATCTGCAGGGAGGAAGG - Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1119381678 14:74233305-74233327 GGGGATGGCTTCAGGGTGGAGGG - Intergenic
1119476259 14:74931526-74931548 GAGGAGTTCTCCAGGGAGTGGGG + Intergenic
1119679586 14:76582151-76582173 GTGGGCGTGTCCAGGGAGGATGG + Intergenic
1121178190 14:91906684-91906706 CTGGATGTCTCCAGTGAGGAAGG + Intronic
1121328228 14:93034149-93034171 GGGGAGGGCACCTGGGAGGAAGG - Intronic
1121506400 14:94480908-94480930 GCCGAGGTCTCCAGGGATCAGGG + Intergenic
1122263927 14:100538090-100538112 GGGGAGGCCTCCATGGAGCTCGG + Exonic
1122785554 14:104161805-104161827 GAGGAGGTGTCCTGTGAGGATGG + Intronic
1122788564 14:104175003-104175025 GGGGAGAGCTCCTGTGAGGAAGG + Exonic
1123441410 15:20294800-20294822 GGGGTGGTCTGCAGAGAGGCAGG + Intergenic
1125556965 15:40594057-40594079 GGGGAGGTCTCCACTGGGGAGGG + Exonic
1125723045 15:41854256-41854278 GGCCATGTCTCCAGGGAGAAAGG - Intronic
1126253711 15:46599472-46599494 GGAGATTTCTCCAGGAAGGAAGG + Intergenic
1127898236 15:63321568-63321590 GGGGCGGTCTCCAGTGTGGATGG + Exonic
1127903581 15:63359293-63359315 GGGGAGCTTTGGAGGGAGGAAGG - Intronic
1127964284 15:63912251-63912273 GGGGAGTTCTGCGGCGAGGAGGG - Intronic
1128157986 15:65403853-65403875 AGGGAGGTCTCCATGGGGGTTGG + Intronic
1128178642 15:65580459-65580481 AGGAAGCTCTGCAGGGAGGATGG + Intronic
1128336924 15:66792802-66792824 GGGGAGTTTTCCAGGGTGGTAGG - Intergenic
1128633946 15:69291074-69291096 GGTGCTGACTCCAGGGAGGAGGG - Intergenic
1129179943 15:73867603-73867625 TGGGATCTCTCCAGGGAGAAGGG + Intergenic
1129180236 15:73869642-73869664 GGGGAGGTCCACAGGCAAGAGGG + Intergenic
1129676080 15:77632931-77632953 GAGGAGGGATCGAGGGAGGAGGG + Intronic
1130026941 15:80278285-80278307 GGCTAGGTCCCCTGGGAGGAAGG + Intergenic
1130890200 15:88127305-88127327 GGGGAAGTCTCAAGGGAGCTTGG - Intronic
1131943451 15:97592975-97592997 AGTGAGGTCATCAGGGAGGAAGG + Intergenic
1132142252 15:99405718-99405740 GGGGGGAGCTCCAGGGAGAATGG - Intergenic
1132206167 15:99987681-99987703 GGTCTGGTCTCCAGGGAGTAAGG + Intronic
1132275890 15:100563633-100563655 GGGGAGAAGGCCAGGGAGGATGG + Intronic
1132653403 16:1031558-1031580 TGGGCAGTCTCCAGGGAGGTGGG - Intergenic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1132761334 16:1509931-1509953 GGGGAGGCCTCCAGGGACTAGGG - Exonic
1132946196 16:2532542-2532564 GGGGAGGTCCGCAGGGATGTGGG - Intergenic
1133039126 16:3050469-3050491 GGGGTGCTCCCCAGGGAAGAAGG - Exonic
1133275547 16:4636244-4636266 GGGGTGGTTCCCAGGGAAGAAGG - Intronic
1133470134 16:6066968-6066990 GGGGAGGGCGGCAGGGAGAAAGG + Intronic
1134036111 16:11032651-11032673 GGGGAGGGCTCCTCTGAGGAAGG + Intronic
1134389718 16:13808168-13808190 GAGGAGGTGTTCAGGGTGGAGGG + Intergenic
1135527241 16:23223363-23223385 GGGGATGCCTCTATGGAGGAGGG - Intergenic
1136012685 16:27374312-27374334 CGGAAGTTCTGCAGGGAGGAAGG - Intergenic
1136226587 16:28864134-28864156 TGGGGGGTGTCCAGGGAGTAGGG + Intronic
1136236112 16:28914577-28914599 GGGGACGTCTCTAGGGAAGGGGG + Exonic
1136365128 16:29806290-29806312 GGGGAGGGCGCGAGGGAGGGAGG - Intronic
1136577546 16:31133383-31133405 AGGGAGCTGCCCAGGGAGGAAGG + Exonic
1136682579 16:31976680-31976702 GGTGAGGGGTGCAGGGAGGAGGG - Intergenic
1136719800 16:32310722-32310744 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1136724848 16:32349123-32349145 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1136782839 16:32917848-32917870 GGTGAGGGGTGCAGGGAGGAGGG - Intergenic
1136838175 16:33517002-33517024 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1136843172 16:33555163-33555185 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1136886957 16:33936002-33936024 GGTGAGGGGTGCAGGGAGGAGGG + Intergenic
1137393908 16:48103680-48103702 GGGCAGGTCTCCTAGGAGGCTGG + Intronic
1137564473 16:49524687-49524709 GGGGAGGACGCCTGGCAGGAGGG - Intronic
1137582100 16:49639778-49639800 GGGGCTGTCCCCAGGGAGGGTGG - Intronic
1137707724 16:50547580-50547602 GGGGAGGTCGCGCGGGGGGAGGG - Intergenic
1138246298 16:55469387-55469409 GGGGTGGTCCCCAGGGTAGAAGG - Intronic
1138246622 16:55471337-55471359 GGGGTGGTCCCCAGGGTAGAAGG - Intronic
1138309291 16:56009488-56009510 GGCTAGGTCCCCAGGGAGAATGG + Intergenic
1138414308 16:56862590-56862612 GGAGAGGTGTCCCTGGAGGAGGG - Intergenic
1138448799 16:57080902-57080924 GGGGAGGGGAGCAGGGAGGAAGG + Intronic
1138521579 16:57574422-57574444 GGGGAAGTTTCCAGGAAAGAGGG + Intronic
1138588575 16:57986926-57986948 GGGGAAGACTTCAAGGAGGATGG - Intronic
1138693921 16:58793553-58793575 GGGAAGGAATCCAGGGAGGAAGG - Intergenic
1139038629 16:62977769-62977791 GGGGATTTGTCCAGGGAGGAAGG - Intergenic
1139372700 16:66478769-66478791 GGGGAGGGGATCAGGGAGGATGG + Intronic
1140814777 16:78611473-78611495 AGGGAGGCCTCCAGGGAGGCAGG - Intronic
1141164804 16:81653286-81653308 GGGGAGGGCTCCAGGCAGCCAGG - Intronic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141703206 16:85651743-85651765 GGGGAGGCCTCCAGGGCAGGAGG - Intronic
1141723068 16:85767616-85767638 AGGGAGGTACCCGGGGAGGATGG - Intergenic
1142119580 16:88379387-88379409 GGGGTGCTCTGCAGGGAGCAGGG - Intergenic
1142124919 16:88405487-88405509 GGGGAGGACGCCAGGGAGGCAGG - Intergenic
1142133354 16:88441001-88441023 GGGGAGGTCCTCAGTGAGGATGG - Intergenic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142194685 16:88733950-88733972 GAGGAGGACTCCAGGGACGAGGG - Exonic
1142287522 16:89177466-89177488 GAGGGGGCCTCCAGGGAGGAGGG + Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1203001582 16_KI270728v1_random:168632-168654 GGGGTGGTCTGCAGAGAGGCAGG + Intergenic
1203006631 16_KI270728v1_random:207047-207069 GGGGTGGTCTGCAGAGAGGCAGG + Intergenic
1203085487 16_KI270728v1_random:1181832-1181854 GGTGAGGGGTGCAGGGAGGAGGG - Intergenic
1203133185 16_KI270728v1_random:1705038-1705060 GGGGTGGTCTGCAGAGAGGCAGG + Intergenic
1203153337 16_KI270728v1_random:1855461-1855483 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1142560236 17:805240-805262 GGGGATGCCTGCAGGGAAGAGGG + Exonic
1142632113 17:1231800-1231822 GGGGAGGTCCCCAGGCAGCGGGG - Intergenic
1142748407 17:1972587-1972609 GAGGAAATCTCCAGGGAGAAGGG - Intronic
1142766316 17:2066142-2066164 AGGGAGGTCACCATGGAGGAAGG + Intronic
1143181320 17:4986223-4986245 GGTGAGGGCTCCAGGGGGCAAGG + Exonic
1143275042 17:5704029-5704051 TTGGAGGTCTCCAGAGTGGAAGG - Intergenic
1143516090 17:7419912-7419934 GGGGAAGTGACGAGGGAGGAGGG + Intergenic
1143765817 17:9137120-9137142 AGAGAGGTCTTCATGGAGGAGGG - Intronic
1144665479 17:17099193-17099215 GGGAGTGTGTCCAGGGAGGAGGG - Intronic
1144955231 17:19015705-19015727 AGGGAGGACTGCACGGAGGAGGG - Intronic
1145109045 17:20145602-20145624 AGGGAGGTCTGCTGGGAGGAAGG - Intronic
1145875930 17:28318398-28318420 GGGGAGGACTCGAGGGACGTAGG - Intergenic
1146269997 17:31478627-31478649 GGCCAGGGCTCCAGGGAGGGAGG - Intronic
1146789176 17:35741949-35741971 GGGGAGGTCTCCCTGGAAGCCGG - Exonic
1146789816 17:35745002-35745024 GGGGAGGCATCCCGGGTGGATGG - Exonic
1147247658 17:39132749-39132771 GGGGAGGTCCGCAGCCAGGAGGG + Intronic
1147357404 17:39908818-39908840 GGGGAGGGGTCCAGGGAAAAGGG - Intronic
1147387698 17:40091713-40091735 AGGGAGGGGTCCGGGGAGGATGG - Intronic
1147449824 17:40497202-40497224 AGGGAGGTCTTCCTGGAGGAAGG + Intronic
1147519912 17:41160714-41160736 GGGTGGGTTTCCAGGAAGGAGGG + Exonic
1148108484 17:45131956-45131978 GGTGGGGTCTCCAAGGAGAATGG - Intronic
1148441071 17:47711855-47711877 GGGGAGGGGTGCAGGGAGGTGGG - Exonic
1148671581 17:49414649-49414671 AGGGAGGTGTCCATGGAGGCAGG - Intronic
1148777411 17:50103327-50103349 GGGCAGGTCTCCAGGGCACAGGG + Intronic
1148868071 17:50639477-50639499 GGGCAGGCTTCCAGGGAGGAAGG + Intronic
1149537156 17:57441954-57441976 AGGGAGGTCTCCAGGGTGAAGGG - Intronic
1149644414 17:58229362-58229384 GGGTAGGACTGCAGAGAGGAAGG - Intronic
1149760068 17:59220907-59220929 GGGAAGGTCTCCTGAGGGGAGGG + Intronic
1149775231 17:59351969-59351991 GGGAAGGATTCCAGGGAAGATGG + Intronic
1150140561 17:62725075-62725097 GAGGAGGACTCCGAGGAGGAGGG - Exonic
1150301615 17:64051934-64051956 GCTGAGGTCTTCAGGGATGAAGG + Intronic
1150591961 17:66570895-66570917 GAGGAGGTACCCACGGAGGATGG - Intronic
1151294023 17:73170395-73170417 TTGGAGGTCTCCATTGAGGAGGG - Exonic
1151749705 17:76029510-76029532 GGGGAGGTGCCCTGGGCGGAGGG + Intergenic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1152288091 17:79423989-79424011 AGGGAGGTCTCCTTGGATGAAGG - Intronic
1152525676 17:80887098-80887120 GGTGATGTCTGGAGGGAGGAAGG + Intronic
1152637998 17:81438028-81438050 GGGGAGGTTTTGTGGGAGGAGGG - Intronic
1152667430 17:81579451-81579473 GGGGTGTTGTCCAGGTAGGAGGG - Intronic
1152750587 17:82060761-82060783 GAGGAGATATCCAGGCAGGAGGG - Exonic
1152915329 17:83031713-83031735 GGGGTGGGTCCCAGGGAGGATGG + Intronic
1153224915 18:2892216-2892238 AGGGAGGTCTCCATGGTGGAGGG + Exonic
1154017191 18:10629136-10629158 GGTAACGTCTCCAGGGAGGGTGG - Intergenic
1155064620 18:22257696-22257718 GGGGAGCTCTCCATCTAGGAGGG + Intergenic
1155248492 18:23933964-23933986 GGGGAATCCTCCAGGGAAGAGGG - Intronic
1156497867 18:37537854-37537876 GGGTAGGGCTCCAAGGAGGCAGG - Intronic
1157608818 18:48943222-48943244 GGGAAGGTTTCCAGAGATGAGGG - Intronic
1157862207 18:51151661-51151683 TGGGGTGTTTCCAGGGAGGACGG - Intergenic
1158069589 18:53455134-53455156 GGGGAAGTCTTCAGGAAGGAAGG - Intronic
1158329401 18:56344896-56344918 GGGGATCTCTGCAGGGAGGAAGG + Intergenic
1158888781 18:61853936-61853958 GGGCAGGTGGGCAGGGAGGATGG - Intronic
1160087075 18:75786480-75786502 GGGGATGTGACCATGGAGGAAGG - Intergenic
1160679284 19:405372-405394 GCGGTGAACTCCAGGGAGGAAGG - Intergenic
1160692031 19:464587-464609 GGGGAAGGCAGCAGGGAGGAGGG - Intronic
1160727816 19:625310-625332 GAAGGGGTCTCCAGGGAGCAGGG - Intronic
1160865237 19:1253274-1253296 GGGGAGGGAGGCAGGGAGGAGGG - Intronic
1160888298 19:1362743-1362765 GGGGGGCTGTCCAGGGAGGCAGG + Intronic
1160894058 19:1394634-1394656 AGCGAGGTCCCCAGGGAGGGAGG - Intronic
1161004050 19:1925668-1925690 GGGGAGGGCTCCAGGGCAGCAGG - Exonic
1161101568 19:2424421-2424443 GGGGAGGGCTGCAGGGAGCGAGG - Intronic
1161102789 19:2429522-2429544 AGGCAGGTCCCCAGGGAGGCGGG + Exonic
1161139571 19:2639656-2639678 GGGGAGGGATTCAGGAAGGAAGG + Intronic
1161667846 19:5587841-5587863 GGGGCTGGCTCCAGGGACGAGGG - Intronic
1161818942 19:6517129-6517151 GGGGAGGTCCCCAGAGGGAAGGG + Intergenic
1161868079 19:6849243-6849265 GGGGAGCACTAGAGGGAGGAGGG - Intronic
1162088000 19:8260052-8260074 GGGAAGGGGCCCAGGGAGGAGGG + Intronic
1162158623 19:8696396-8696418 GGAGAGTTCTGCAGGGATGATGG + Intergenic
1163127453 19:15251875-15251897 GGGGAGGGCGCCTGGGAAGAGGG + Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1163762853 19:19146556-19146578 TGGGGGGCCTCCGGGGAGGAAGG + Exonic
1163787038 19:19280027-19280049 GGGGAGGCTTCCAGGCAGGCAGG - Intronic
1164686165 19:30168201-30168223 GGGGCTGGGTCCAGGGAGGAGGG - Intergenic
1165096858 19:33414177-33414199 AGGGTGGTCTCCAGGGATGTGGG + Intronic
1165708798 19:37995134-37995156 AGAGAGGTCTGCTGGGAGGAGGG - Intronic
1165925019 19:39321124-39321146 GGGGGGGTCTCCGGGGAGGCCGG - Intergenic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166295767 19:41888572-41888594 GGGCAGGTGTTCAGGGAGAATGG - Intronic
1166878265 19:45911492-45911514 GGGGAGGCATCCAGGGAGTCTGG - Intergenic
1166939805 19:46355805-46355827 GGGCAGGGCTCCAGGTGGGAAGG + Intronic
1167158404 19:47752831-47752853 AGGAAGGGCTCCCGGGAGGAGGG + Intronic
1167379556 19:49130599-49130621 GGTGAGGCCCCCAGGGAGGCGGG + Exonic
1167596915 19:50432724-50432746 AGCCAGGTCCCCAGGGAGGAGGG - Intergenic
1167704227 19:51069196-51069218 AGTGTGGGCTCCAGGGAGGACGG - Intergenic
1167954961 19:53057206-53057228 GGAGAGGTCTGCAGGGAACATGG + Intergenic
1168095507 19:54112463-54112485 GGGGAGTTCTGTAAGGAGGAAGG - Intronic
1168330407 19:55564496-55564518 GGGGAGGTGCCCGGGAAGGAGGG + Intergenic
1168450926 19:56466132-56466154 GGAGAGGACTCCAGGGAGCCTGG + Intronic
1168482998 19:56737128-56737150 GGGGAGGTCTCCAGGCTGTCTGG - Intergenic
1168485707 19:56760221-56760243 GGGGAGGTCTCCAGGCTGCCTGG - Intergenic
925292238 2:2755695-2755717 TAGGATGTCTCCAGGGAGCAAGG - Intergenic
926081697 2:9992166-9992188 GGGGAGGTTACCAGGAAGGAAGG + Intronic
927022088 2:19028017-19028039 GGGCAGGTCTCCAGGCCAGAAGG + Intergenic
927462266 2:23309618-23309640 GAGGCGGTCTCCAGGCAGGAAGG - Intergenic
928071892 2:28225285-28225307 AGGGTGGGCGCCAGGGAGGAAGG + Intronic
928211322 2:29326082-29326104 GGGGTGTTCTCCAGGGTGGAGGG + Intronic
928337848 2:30413452-30413474 GAGGAGGAAACCAGGGAGGAGGG - Intergenic
929597908 2:43187589-43187611 AGGGACACCTCCAGGGAGGAGGG + Intergenic
929868033 2:45734906-45734928 GGGGAGCTCTACAGCGAGGATGG - Intronic
930103542 2:47621022-47621044 AGGCAGCTCTCCTGGGAGGAGGG - Intergenic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
931227686 2:60347883-60347905 GGGCAGGGCACCAGGGAGAATGG + Intergenic
932446348 2:71784052-71784074 GGGGAAGTCACCAGAGAGAAGGG - Intergenic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
934321327 2:91974551-91974573 GGGGTGGTCTGCAGAGAGGCAGG + Intergenic
934603818 2:95679369-95679391 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
935174556 2:100638438-100638460 GGGGAGGGCTGCAGGGATGCTGG - Intergenic
935196595 2:100820059-100820081 GGGGAGGTGGAGAGGGAGGAGGG + Intergenic
935218241 2:100991166-100991188 GGGGATGTCTCCAGGGGTGAGGG - Intronic
936537196 2:113321596-113321618 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
936674574 2:114700185-114700207 GGGGAAGTCTCCAGGCAGGGGGG + Intronic
939643653 2:144670318-144670340 GGACAAGTCTCCAGGGAAGAAGG - Intergenic
940206911 2:151213167-151213189 GTGGTGGTTTCCAGGGAAGAGGG + Intergenic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941659358 2:168179793-168179815 GTGGAGGTCAGCAGGGAGGCTGG - Intronic
942168991 2:173271292-173271314 GGGGAGGTCTCCAGGGAGGCAGG - Intergenic
942491757 2:176496335-176496357 GGAGAGGCTTCCAGGGAAGAGGG + Intergenic
943728476 2:191276642-191276664 GTGGACTTCACCAGGGAGGATGG + Intronic
944104799 2:196068602-196068624 GGGGAGTTCGCTAGGCAGGAGGG + Intronic
946076365 2:217076942-217076964 GGGGACGCCACCAGGAAGGAAGG + Intergenic
946165782 2:217863003-217863025 AGGGGTCTCTCCAGGGAGGAAGG + Intronic
946180512 2:217946199-217946221 GGAGAAGGATCCAGGGAGGATGG - Intronic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946372700 2:219290388-219290410 GGGCAGGTCCCCTGGGAGGAAGG + Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947581025 2:231318611-231318633 GGGAACGCCTCCAGGCAGGAAGG + Intronic
948453669 2:238093989-238094011 GGGCAGGTGCCCAGAGAGGAGGG + Intronic
948610149 2:239161820-239161842 TGGGGGGCTTCCAGGGAGGAGGG - Intronic
948647320 2:239413986-239414008 GGGCAGGGCTCCAGAGAGCAGGG - Intergenic
948979559 2:241485853-241485875 AGGAAGGACTCCAGGGAGGGAGG - Intronic
949031487 2:241799344-241799366 GGGGAGGGCTCTGGGGAGCAGGG + Intronic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1169080159 20:2793551-2793573 AGGGATGGCTCCAAGGAGGAGGG - Intergenic
1169132764 20:3174403-3174425 CGGGAGGACTGCCGGGAGGAGGG + Intergenic
1169422332 20:5470667-5470689 GGTGAGGTTGTCAGGGAGGAGGG - Intergenic
1170700573 20:18699552-18699574 GAGGTGGTCATCAGGGAGGATGG + Intronic
1170985823 20:21257306-21257328 GGGAAGGACTTCAGGGAAGAGGG + Intergenic
1171377084 20:24700822-24700844 GGGGAGGGTCCCAGGGAGGACGG - Intergenic
1172215333 20:33231689-33231711 CGGGAGGGCTCCAGGGAAGATGG + Intergenic
1172504479 20:35451392-35451414 GGGGAGTTCTCAAAGGAGGCTGG - Intronic
1173427854 20:42958313-42958335 GGGGAGGGAGCAAGGGAGGAGGG + Intronic
1173669729 20:44790386-44790408 GAGGAGGTAGCCTGGGAGGAGGG - Intronic
1174036619 20:47672464-47672486 AGGGATGTCTCCAGGGTGGATGG - Intronic
1174358593 20:50014436-50014458 GCCGAGGTCTCCAGGGAGTGTGG - Intergenic
1174862308 20:54102476-54102498 GGTGAGGTCAGCAGGGTGGAAGG + Intergenic
1175217285 20:57398303-57398325 GGGGAAGGCTCCACTGAGGATGG + Intronic
1175573909 20:60046097-60046119 TGGGAAGTCTCCCAGGAGGAAGG + Intergenic
1175658633 20:60793319-60793341 GCTGAGCTCTCCAGGCAGGATGG - Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1175796810 20:61776417-61776439 GGGGTGGTTTCCTGGGAGCACGG - Intronic
1175916255 20:62427374-62427396 GGGGTGCTCACCAGGGAGGCTGG - Intronic
1178581755 21:33844308-33844330 GGGGAGGCCACCAGGGAAAATGG + Intronic
1179460220 21:41529506-41529528 GAGGAGCTCCCCAGGGAGGGAGG + Intronic
1179803986 21:43825842-43825864 GGGGTGGTCCCCTTGGAGGAAGG + Intergenic
1179986939 21:44927426-44927448 GGGGTGCTCTCCAGGCAGGAAGG - Intronic
1180091351 21:45535169-45535191 CGGGGGGTCTCCCTGGAGGAGGG + Intronic
1180190753 21:46161401-46161423 TGCGAGCTCTCCAAGGAGGACGG - Exonic
1180703735 22:17796166-17796188 GCAGAGTGCTCCAGGGAGGAGGG - Intronic
1180725971 22:17946857-17946879 GGGGTGTTCCCCAGGGAAGAGGG - Intronic
1181064428 22:20298963-20298985 GGGCGGGTCTCCTGTGAGGAAGG + Intergenic
1181098078 22:20519870-20519892 GAGGAGGCCCCCAGGGAGTATGG - Intronic
1181853888 22:25768869-25768891 GGGGAGGTTTCCTGGGAAGAAGG + Exonic
1182211404 22:28680032-28680054 GGGGTGGTCTGCAGAGAGGCAGG - Intergenic
1182602348 22:31475956-31475978 GGGGAGGGGTTCAGGGAGGATGG + Intronic
1182923199 22:34098928-34098950 GGGGTGGTCTTCAGGGATGCTGG + Intergenic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
1183725456 22:39586757-39586779 GGACAGGTCCCCAGGGAGGCTGG + Intronic
1183749726 22:39712963-39712985 GGGGCGGTCTCCTGGAGGGAGGG + Intergenic
1184101038 22:42341903-42341925 TGGGAGGACCACAGGGAGGAGGG + Intronic
1184458881 22:44626091-44626113 AGGGAAGTTTCCCGGGAGGAAGG - Intergenic
1184693549 22:46128075-46128097 GGGGAGTGCTCCAGGCAGGCGGG - Intergenic
1184759806 22:46537784-46537806 GGGGAGGCCTCCGGGGAGTAGGG - Intergenic
1184837990 22:47035386-47035408 GAGGAAGTCACCAGGGAGGCTGG - Intronic
1184843484 22:47066404-47066426 GGGGAGGTCGGGAGGGAGGGAGG + Intronic
1184974570 22:48051942-48051964 AGGGACGTCCCCTGGGAGGAGGG + Intergenic
1185054658 22:48573180-48573202 GGCCAGGTGTCCAGGCAGGAGGG - Intronic
1185062264 22:48613209-48613231 AGAGAGGACTCCAGGGAGGAAGG - Intronic
1185082643 22:48718356-48718378 GGGGAGGCCCCCAAGCAGGAAGG + Intronic
1185398337 22:50603756-50603778 GGGGAGGAGGGCAGGGAGGATGG + Intronic
1203291906 22_KI270736v1_random:2906-2928 GGAGAGGTCTGCAGCTAGGAGGG + Intergenic
950165136 3:10791623-10791645 AGGGAGGGCTCCTTGGAGGAAGG + Intergenic
952716612 3:36486349-36486371 GGGCAGGTCTGCAGGGAGTCAGG + Intronic
953026423 3:39147858-39147880 GGGGAGGTCACCAGGGGGAAAGG + Intronic
953237879 3:41121830-41121852 GTGGAGGACTACTGGGAGGAGGG + Intergenic
953696597 3:45164731-45164753 GGGGAGGACAACAGGGAGGCTGG + Intergenic
953700596 3:45192642-45192664 TGGGAAGTCTTCATGGAGGAAGG - Intergenic
953703984 3:45217620-45217642 TGGGAAGACTCCAGGCAGGAGGG - Intergenic
953913922 3:46906136-46906158 GGGGTGGTCAGCAGGGTGGAGGG + Intergenic
954848297 3:53578614-53578636 GCGGAGGTCTACAAGGAGGGTGG + Intronic
954918679 3:54170601-54170623 AGGGAGGTAGTCAGGGAGGAAGG - Intronic
955083943 3:55683878-55683900 GGGGAGGTGCACAGAGAGGAGGG + Intronic
956688317 3:71853200-71853222 GTGGAGGTCTCCTGGGAAGCAGG - Intergenic
956867509 3:73384242-73384264 GGGGAGATCTCCAGGGTGAGCGG + Exonic
957149572 3:76468674-76468696 GAAGAGGTTTTCAGGGAGGAGGG - Intronic
958647046 3:96887480-96887502 GTGGAGGTGGCCAGGGAGCAGGG + Intronic
959099675 3:101996197-101996219 GGGGACATTTCCAGGGAGAAGGG - Intergenic
959920016 3:111859588-111859610 GCGGTGGTCGCCCGGGAGGAGGG + Intronic
960971184 3:123141324-123141346 TGGGTGGCCTCCAGGGAGGTGGG - Intronic
961372384 3:126439647-126439669 GGGCAGGTCCACAGTGAGGAAGG + Exonic
961379550 3:126488080-126488102 GGGGAGGTGACCAGGGAGGTAGG + Intronic
961503105 3:127351194-127351216 TGGGGGCTCTCCAGGGAGGGTGG - Intergenic
961569037 3:127785169-127785191 GGGAAGGTCTCACAGGAGGAGGG - Intronic
961677880 3:128578548-128578570 AGTGAGGTCGCCTGGGAGGAGGG - Intergenic
962246366 3:133797649-133797671 GAGGAGGTATGCAGGGAGAAGGG + Intronic
962279137 3:134037225-134037247 GGGGAGCACTCCAAGGAGAATGG + Intronic
962282841 3:134065301-134065323 AGGGAGGTCTCCAAGGATCAAGG + Intronic
962365939 3:134781490-134781512 GGGGACGGCTTCAGTGAGGAAGG + Intronic
962407013 3:135109113-135109135 AGGGAGCACTACAGGGAGGAAGG - Intronic
962904122 3:139786655-139786677 AGGAAGGGCTCCTGGGAGGATGG + Intergenic
962990342 3:140572245-140572267 GAGGAGCTCTCCAGGGAAGTAGG + Exonic
965370413 3:167855277-167855299 GTTGAGATCTCCAGGGAGGTGGG + Intergenic
966870165 3:184285139-184285161 GTGGAGGTCTCCAGCAAGGCTGG + Intronic
967685070 3:192409076-192409098 GGGGAGGGCGCGAGGGAGGGAGG + Intronic
968062972 3:195740038-195740060 GGGGAGGCCTGCAGGCATGAAGG - Intronic
968186461 3:196636249-196636271 GGGGAAGGCTTCATGGAGGAGGG + Intergenic
968228862 3:196992589-196992611 TGGGAGGGCTCGGGGGAGGAAGG - Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
969049691 4:4363916-4363938 GGGGAGGTGACGAGGGAGGCAGG - Intronic
969055722 4:4401509-4401531 GAGGAGCTTACCAGGGAGGAGGG - Intronic
969370360 4:6727727-6727749 GGGGAGGTGGACGGGGAGGAAGG - Intergenic
969615030 4:8247270-8247292 CAGGAGGTCTCCAGGAAGCAGGG + Intergenic
969891740 4:10266314-10266336 CGGGAGGTCTGCAAGGAGGGAGG + Intergenic
969966602 4:11003144-11003166 GGGCAGGTCCCCAGGGTGAATGG - Intergenic
971485563 4:27156676-27156698 GGACAGGACTCCAGGCAGGAAGG - Intergenic
972396544 4:38663784-38663806 GGCGCGGACTCCGGGGAGGAGGG + Intergenic
974920683 4:68235467-68235489 AGGGAGGGATGCAGGGAGGAGGG - Intronic
976303439 4:83536427-83536449 GAGGAGGAGCCCAGGGAGGAAGG + Intronic
977093161 4:92704780-92704802 GGGGAGGGCCCCAGAGAGGGAGG - Intronic
977682571 4:99812244-99812266 GGGGAGGATTTCAGGGAGAAAGG - Intergenic
978335542 4:107664513-107664535 TGTGGGGTCTCCAGGGTGGAGGG - Intronic
981759343 4:148176316-148176338 GAGGTGGTCTGCAGGTAGGAAGG + Intronic
982423575 4:155228626-155228648 GGGGAGAGCTCAGGGGAGGATGG - Intergenic
982673820 4:158352632-158352654 GGGGAGGGCTCTAGAGAGGTGGG + Intronic
983208174 4:164932629-164932651 GGGGAGGACTCCAGTTAGGGAGG - Intergenic
984571475 4:181399592-181399614 GGGGAGGACTTCATGGAAGAAGG + Intergenic
984992812 4:185397074-185397096 GGGGAGGTTTCCAGCCCGGAGGG + Intronic
985484707 5:141457-141479 GGGGAGGAGGCCACGGAGGACGG - Intronic
985635610 5:1034313-1034335 GGGAAGGTCACCAGGGAGGTAGG + Exonic
985720547 5:1486429-1486451 GGGAAGGTCTCCGGGGATGAAGG + Intronic
985761500 5:1751494-1751516 GCGGAGTTCCCCATGGAGGAAGG - Intergenic
986593121 5:9391896-9391918 AGGGAGGTGGCCATGGAGGAGGG - Intronic
986823147 5:11491256-11491278 GGGGAGGTCTCCATAAATGATGG + Intronic
987112459 5:14700670-14700692 GGGGAGGGCTGCAGAGGGGAGGG - Intergenic
988971535 5:36473209-36473231 GGTGAGGTGGCCAGGAAGGAAGG - Intergenic
989170496 5:38467475-38467497 GAGGAGGTGGGCAGGGAGGAAGG - Intergenic
991305304 5:65170595-65170617 GGTGAGTTTTCCATGGAGGAGGG - Exonic
992327209 5:75672506-75672528 GGGGAGTTGTCTAGGGAGGAGGG + Intergenic
993313543 5:86369531-86369553 GGAGAGGTCTGGAGGGAGGCTGG - Intergenic
994242488 5:97441280-97441302 GGGGAGGAATCAAGGGAAGAAGG + Intergenic
995131764 5:108638068-108638090 GGGGAAGTCTGTAGGGGGGAAGG + Intergenic
995495410 5:112737569-112737591 GGGGAGGTCCGCAGGGCAGAAGG - Intronic
995559187 5:113362853-113362875 TGGGATGACTCCAGGGTGGAGGG + Intronic
997282131 5:132656099-132656121 AGGGTGGTCTCCAGGGACCAAGG - Intergenic
997526324 5:134555374-134555396 GCGGAGGTCAGCTGGGAGGAGGG - Intronic
997606134 5:135176953-135176975 GGGGAAGGCTTCTGGGAGGAAGG + Intronic
997792128 5:136770594-136770616 GGGAAGGACTCCAGGAAGGAGGG + Intergenic
998057600 5:139092223-139092245 GGGGAGGCCTAGAGGGAGAAGGG - Intronic
998136323 5:139676361-139676383 GGGGAGGAGTCTGGGGAGGAGGG - Intronic
998136396 5:139676553-139676575 GGGGAGGAGTCTGGGGAGGAGGG - Intronic
999075737 5:148793555-148793577 GGGGGGGTCTACAAGGAGGTGGG - Intergenic
999751384 5:154630528-154630550 GGTGAGGTTTCCTGGGAGAATGG - Intergenic
1001266910 5:170280334-170280356 GGGAATGTGTGCAGGGAGGAGGG - Intronic
1001521251 5:172395123-172395145 GGGGAGGTGTCCAGGCAGAGGGG - Intronic
1001646837 5:173288492-173288514 GGCGAGGTCACCAGGGATGCGGG + Intergenic
1001936030 5:175706686-175706708 GGTGGGGTGTTCAGGGAGGAAGG + Intergenic
1001964481 5:175900727-175900749 GGGGAGGGCTCCCAGGTGGAGGG + Intergenic
1002051549 5:176574319-176574341 GGCGAGGTTTCCGGGGAGGGGGG - Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003075811 6:2982943-2982965 GGAGAGGCCCCCAGGGAGGTAGG + Intergenic
1003076710 6:2988973-2988995 GGGGCCTCCTCCAGGGAGGACGG + Intronic
1003134460 6:3423593-3423615 GGGGAGGAATGCAGGGAGGGAGG + Intronic
1003602108 6:7526994-7527016 GGGGAGATCTCCATGGAGGCTGG - Intergenic
1003776199 6:9368402-9368424 GGGGAGGTTTCAGGGGAAGAAGG - Intergenic
1003921610 6:10838315-10838337 GGGAAGGACTGGAGGGAGGAGGG - Intronic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004607260 6:17206395-17206417 GGGGAGGGGAGCAGGGAGGAGGG + Intergenic
1004653294 6:17633093-17633115 GGGGAGCTCACCAGTGAGCAAGG - Intronic
1005132484 6:22525068-22525090 TGAGATGTCTCCAGGGAGGGAGG + Intergenic
1005419018 6:25630121-25630143 GGTGTGGTTTCCAGGGAGAAGGG - Intergenic
1005463204 6:26088084-26088106 GTGGAGGTCTCTAGGGTGGGAGG + Intronic
1005512726 6:26525818-26525840 GAGGAGGTATGCAGGGAGAAGGG + Intergenic
1005883028 6:30074760-30074782 GAGGAGGGGTCCTGGGAGGATGG - Intronic
1006230643 6:32583798-32583820 GGGGAGGTGACAAGGGAGGTGGG - Intronic
1006295953 6:33170200-33170222 GTGGAGGCCTCCCGGGAGTAAGG + Intronic
1006630591 6:35427355-35427377 GGCCAGGTCTCCGGGGAGGCAGG + Exonic
1006794468 6:36722745-36722767 GGGGAGGGCGGCAGGGAGCAAGG + Intronic
1006981419 6:38151185-38151207 GGGGAGGGCTGCAGGGAGCCAGG - Intronic
1007167919 6:39841372-39841394 GGGGAGGGTTCCAGGGGGGAGGG + Intronic
1013990543 6:116250629-116250651 GAGGTGCTCTCCAGGGAAGAGGG - Exonic
1015440416 6:133241209-133241231 GGGGAGGCCGCCAGGGACGCGGG - Intronic
1015970911 6:138741777-138741799 GGGGAGGCCTCGAAGGAGGATGG - Intergenic
1017816694 6:158021538-158021560 TGGGAGGGCTGGAGGGAGGAGGG + Intronic
1017827971 6:158096404-158096426 AGGGATGTCTAGAGGGAGGAAGG - Exonic
1018176210 6:161181446-161181468 GGGGAGGTTTCCTGGAAGTATGG - Intronic
1019138685 6:169929357-169929379 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138744 6:169929655-169929677 GGGGAGGTCAACAGTGAGAATGG + Intergenic
1019138779 6:169929840-169929862 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138784 6:169929861-169929883 GGGGAGGTCAACAGTGAGGATGG + Intergenic
1019138813 6:169930006-169930028 GTGGAGGTCAACAGTGAGGATGG + Intergenic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019428675 7:988739-988761 GGCGTGGTGTCCAGGGAGGCCGG - Exonic
1019607956 7:1919450-1919472 TGGTAGGTCCCCAGCGAGGACGG - Intronic
1019633833 7:2064872-2064894 GGCGGCTTCTCCAGGGAGGACGG + Intronic
1019738401 7:2661400-2661422 GGGGATGTCTCCTCTGAGGAGGG - Intronic
1020014080 7:4820895-4820917 GGGCAGGTTTCCTGAGAGGAGGG - Intronic
1020092552 7:5349737-5349759 GGGGAGGGGTCAAGGGTGGAGGG + Intronic
1020092956 7:5351505-5351527 GGGGAGGAGGGCAGGGAGGAGGG + Intronic
1020103259 7:5407364-5407386 GGGGCTGGCCCCAGGGAGGAGGG + Intronic
1020203913 7:6101056-6101078 GGGGAGCGCTCTAGGGAGGAAGG + Intergenic
1021633554 7:22669137-22669159 GGTGAGCACTCCAGGGAGCAAGG - Intergenic
1021777704 7:24069915-24069937 AGGGAGGCCTCCAGGGGAGAGGG - Intergenic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022897335 7:34764588-34764610 GGGGAAGTGTCTAGGAAGGAGGG - Intronic
1022942087 7:35250678-35250700 AGAGAGGGCTCCAGGAAGGAAGG - Intronic
1023045917 7:36210002-36210024 GAGGAGGTCTCGGGGGAGGATGG + Intronic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1023997977 7:45173743-45173765 GGGGAGGACTGCAAGGAGCAGGG + Intronic
1024349913 7:48353091-48353113 GGGGATGTTTGCAGAGAGGACGG + Intronic
1024555451 7:50599598-50599620 GAGGAAGGCTCCAGGGAGGACGG + Intronic
1027411376 7:77922653-77922675 GATGAAGTCTCCAGTGAGGAAGG + Exonic
1029248316 7:99218470-99218492 GGGGAGTACTTCAGGAAGGAGGG + Intergenic
1029384612 7:100235188-100235210 GGAGAGGAGGCCAGGGAGGAGGG - Intronic
1029421557 7:100474518-100474540 GGGGAGGTGGAGAGGGAGGAAGG - Intronic
1029551052 7:101237333-101237355 GGGGAGCGCTCCAGGGAGAGAGG - Intronic
1029744511 7:102509529-102509551 GGGGAGGTCTCCGAGTGGGAGGG + Intronic
1029762502 7:102608691-102608713 GGGGAGGTCTCCGAGTGGGAGGG + Intronic
1030952799 7:115813031-115813053 GGGGAGGGGTGGAGGGAGGAGGG - Intergenic
1031123053 7:117742944-117742966 GGGCAGGGCTGCAGGGAGAATGG - Intronic
1031974095 7:128083006-128083028 GTGGTGGGCTCCAGAGAGGAAGG + Intronic
1032112129 7:129085081-129085103 GGGGAAGTTTCCAGGAAGAAGGG - Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033368798 7:140690830-140690852 GGGGAGGTCTCTGGGGAAGGTGG + Intronic
1033422697 7:141217489-141217511 GGTGAGGACCCCAGGGAGGCTGG + Intronic
1033544275 7:142385963-142385985 GGCGAGGTCTGCAGGGAAGATGG - Intergenic
1034252920 7:149706643-149706665 GGGGAGGGGACAAGGGAGGAAGG - Intergenic
1034268413 7:149792006-149792028 AGGGAGCTCTGCAGAGAGGATGG - Intergenic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034546663 7:151794057-151794079 GGTGAGGGAGCCAGGGAGGAAGG - Intronic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1035746898 8:1967484-1967506 GTGGGGGTGCCCAGGGAGGAGGG - Intergenic
1036147825 8:6270767-6270789 GGCGAGATGACCAGGGAGGAGGG + Intergenic
1036185808 8:6621737-6621759 GGACAGGTTTCCAGGGAGGGCGG + Intronic
1037300896 8:17451028-17451050 CGGGAGGACTCCATGGAGCATGG - Intergenic
1037825809 8:22160013-22160035 GGGGAGGGGTGCCGGGAGGAGGG - Intronic
1037943741 8:22973815-22973837 GAAGAGGCCTCCAGGAAGGAGGG - Intronic
1037988141 8:23302376-23302398 AGGGAGGGCTTCATGGAGGAAGG - Intronic
1038054373 8:23844475-23844497 GGGGTGGTCTCAGGGGAGCAGGG + Exonic
1038422284 8:27440945-27440967 GGGGAGGTCACTGGGGAAGAAGG + Intronic
1038456497 8:27675124-27675146 GGTGAGGTCGCCAGGGTGAAAGG - Intronic
1039476471 8:37841678-37841700 GGGGAGGACTTGAGGGAGGGGGG - Exonic
1041648493 8:60277901-60277923 AGGAAGGTCTCCAGGGAGGCAGG + Intronic
1043134407 8:76503004-76503026 GGGGAGTGTTCCAGGAAGGAGGG + Intergenic
1043586817 8:81779527-81779549 GGGGAGGTCAACGGGGAGGGAGG + Intergenic
1044589721 8:93902224-93902246 GGTGAGCTCACCAGTGAGGATGG - Intronic
1045547937 8:103144525-103144547 GTGGGGGTCTCCAAGGAGAAAGG + Intronic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047758892 8:127939512-127939534 GGAGAAGGCTCCAGGGAGTATGG - Intergenic
1048944559 8:139432277-139432299 GGTGAGCTCTCCAGCAAGGAGGG + Intergenic
1049045518 8:140148146-140148168 AGGGAAGTGTGCAGGGAGGAGGG + Intronic
1049210874 8:141385914-141385936 CGGGAGGTCTCCAGGGAGAGTGG - Intergenic
1049605134 8:143525865-143525887 GGGGAGGCCTCCTGGGAGAGTGG - Intronic
1050013347 9:1208106-1208128 GGGGAGGGCTCTAGCCAGGAGGG - Intergenic
1050083309 9:1938320-1938342 AGGGAGGTCTCCAGGGGACAGGG + Intergenic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1053454980 9:38226948-38226970 GGGGGGGTCGGCAGGGAGGGAGG + Intergenic
1056451782 9:86723529-86723551 GGGGATGTGGTCAGGGAGGAGGG - Intergenic
1056474847 9:86944047-86944069 GGGGAGGTCTCAGGGGAAAAGGG + Intergenic
1057035984 9:91811881-91811903 GGGGAGCTCCCCTGGGAGCAAGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057706439 9:97398375-97398397 GGGGAGCCCTGGAGGGAGGATGG - Intergenic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059570724 9:115431853-115431875 GGGGAGGTATACATGGAGAAAGG + Intergenic
1059694906 9:116721787-116721809 GGTAAGATCTCCAGGCAGGAAGG - Intronic
1059862945 9:118485422-118485444 GGGGTGGGATGCAGGGAGGAGGG + Intergenic
1060404804 9:123367933-123367955 GGGATGGTCTTCAGGGAAGACGG + Intronic
1060822036 9:126666804-126666826 GGGCAGGTATACAGGGATGAGGG + Intronic
1060839331 9:126781735-126781757 GGGGAGGTCTCCGGGGTGTAAGG + Intergenic
1061000315 9:127899081-127899103 GAGGAGGGCTCCAGGGAGAAGGG + Intronic
1061431705 9:130535543-130535565 GGGCAGGGGTCCTGGGAGGAGGG - Intergenic
1061578988 9:131525260-131525282 GGGGCGGTCTCCACGGAGGATGG - Intronic
1062053670 9:134459761-134459783 GGCGAGGCCTCCAGCGATGAGGG - Intergenic
1062096869 9:134708084-134708106 GGGGAGGTGTCCGGGGAGGGAGG + Intronic
1062146455 9:134992288-134992310 CGGAGGGTCTCCAGGAAGGAGGG + Intergenic
1062182666 9:135199016-135199038 GGGCAGGTCTCCAGGCTGGCCGG + Intergenic
1062250192 9:135589987-135590009 GGGGAGGCCGCCAGGGATGTGGG - Intergenic
1062264562 9:135681115-135681137 GGAAAGGTCTCCAGGTAGGGAGG - Intergenic
1062469674 9:136696946-136696968 GGGAAGGAGGCCAGGGAGGAGGG - Intergenic
1062583354 9:137237834-137237856 GGGGTGGGCTCCAGTGAGAATGG + Intergenic
1062586021 9:137250469-137250491 GGGGAGGCATCCAGAGAGGGCGG + Intergenic
1062712048 9:137980666-137980688 GGGGAGTACTAGAGGGAGGAGGG - Intronic
1185664908 X:1757915-1757937 GGGGTGGTCTGCAGGGGAGAGGG - Intergenic
1188197217 X:27251498-27251520 GGGGAGGATTTCAGAGAGGATGG - Intergenic
1189048625 X:37620127-37620149 GGGGAAGCCCCCAGGAAGGAAGG + Intronic
1189309056 X:40007413-40007435 GGGGATGTCTCCTTGGAAGAAGG + Intergenic
1190228002 X:48560604-48560626 GGAGAGGCCTCCTGGGTGGATGG - Exonic
1190287581 X:48971364-48971386 GGGTGTGTCTCCAGGGAGGGGGG + Exonic
1190324016 X:49195584-49195606 GGGGAGGTGTCCTGGGACTAAGG + Intronic
1190753234 X:53380272-53380294 GGGCAGGTATGTAGGGAGGAGGG - Intronic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1192236676 X:69300582-69300604 GGGGAGGACTACAGGCAGGATGG + Intergenic
1192239868 X:69320404-69320426 GGGGAGTTTTCCTGGGAAGAGGG - Intergenic
1192263343 X:69522473-69522495 GGGGAGATGGCCAGAGAGGAGGG - Intronic
1193694179 X:84686670-84686692 GTGGAGGTCTGCAGTGAGGCTGG + Intergenic
1194723425 X:97367187-97367209 GGGGTAGTACCCAGGGAGGAGGG + Intronic
1195937452 X:110139317-110139339 GGGGATGGGTGCAGGGAGGAGGG + Intronic
1196263133 X:113609158-113609180 AGGCAGGTATCAAGGGAGGATGG - Intergenic
1197922234 X:131607784-131607806 GGGGATGTCTTCAAGGTGGATGG - Intergenic
1198241672 X:134794043-134794065 GGGAAGCTCTGCAGAGAGGACGG - Intronic
1198421360 X:136473050-136473072 GGGGAGGAATGAAGGGAGGAAGG + Intergenic
1198421374 X:136473095-136473117 GGGGAGGAATGAAGGGAGGAAGG + Intergenic
1198459211 X:136847306-136847328 GAGAAGGTCTCCAGGGGTGAGGG - Intergenic
1200066022 X:153504444-153504466 GCAGAGGGCTCCAGGCAGGAAGG - Intronic
1200153015 X:153960432-153960454 AGGGAGGTCAGCAAGGAGGATGG + Intronic
1200273867 X:154713375-154713397 GAGGATGGCTGCAGGGAGGAGGG + Exonic
1200857846 Y:7958746-7958768 GGGTTGTTCTCCAGGGAGTAAGG + Intergenic