ID: 1142343907

View in Genome Browser
Species Human (GRCh38)
Location 16:89541921-89541943
Sequence GTGGCCACCCTGATACATAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142343893_1142343907 28 Left 1142343893 16:89541870-89541892 CCACATGTCCCTGACACATAGCG 0: 1
1: 1
2: 0
3: 6
4: 108
Right 1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1142343901_1142343907 3 Left 1142343901 16:89541895-89541917 CCGGTAGGGAGCACGTGCCCTGC No data
Right 1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1142343896_1142343907 20 Left 1142343896 16:89541878-89541900 CCCTGACACATAGCGGCCCGGTA 0: 1
1: 0
2: 1
3: 1
4: 13
Right 1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1142343900_1142343907 4 Left 1142343900 16:89541894-89541916 CCCGGTAGGGAGCACGTGCCCTG 0: 1
1: 0
2: 3
3: 10
4: 160
Right 1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG 0: 1
1: 0
2: 0
3: 9
4: 69
1142343897_1142343907 19 Left 1142343897 16:89541879-89541901 CCTGACACATAGCGGCCCGGTAG 0: 1
1: 0
2: 1
3: 7
4: 31
Right 1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142343907 Original CRISPR GTGGCCACCCTGATACATAG CGG Intronic
921785187 1:219221299-219221321 GTGGAGCCCCTGATTCATAGAGG - Intergenic
1065970498 10:30802439-30802461 TTGGCCACCCTGAGACATGATGG - Intergenic
1070479785 10:76870763-76870785 GCAGCCACAGTGATACATAGTGG + Intronic
1076137243 10:128053612-128053634 GTAGCCACCCAGATGCACAGAGG - Intronic
1084357948 11:68652073-68652095 GTGGGCACCCTGCTGCCTAGGGG + Intergenic
1085862933 11:80256053-80256075 GTTTCTACCCTGATACATAGGGG - Intergenic
1098058901 12:66539046-66539068 GTAGCCCCCCTTATCCATAGGGG - Intronic
1098869056 12:75796335-75796357 GTGGAGACCCTGATACATAAGGG - Intergenic
1105245016 13:18641979-18642001 GTGGCCACGCTGTTACCGAGAGG + Intergenic
1108081178 13:46737770-46737792 GTAGCCAATCTGCTACATAGAGG - Intronic
1111092223 13:83462304-83462326 GTGGCCACCCCGCCACCTAGGGG - Intergenic
1114505814 14:23212162-23212184 GTAGCCAGCCTTATACATAATGG + Intronic
1129863103 15:78878716-78878738 GAGCACACCCTGATACAAAGGGG - Intronic
1133485789 16:6217129-6217151 GAGGCTACCCTCATACACAGAGG - Intronic
1134470596 16:14521853-14521875 GTGGACCCCCTTATACATGGTGG + Intronic
1142343907 16:89541921-89541943 GTGGCCACCCTGATACATAGCGG + Intronic
1142343923 16:89541971-89541993 GTGGCCATCCTAACACATAGCGG + Intronic
1142847535 17:2689577-2689599 GTGGCCACCCTGAGACCCGGAGG - Exonic
1146930777 17:36776381-36776403 GTGGCCACCCTGAGCCATAAAGG - Intergenic
1147698795 17:42378210-42378232 GTGGTAACGCTTATACATAGGGG - Intronic
1147699051 17:42380348-42380370 GTGGTAACGCTTATACATAGGGG - Intronic
1148955455 17:51350273-51350295 GTGCCCAGCCTGCTCCATAGAGG - Intergenic
1149002504 17:51771629-51771651 GTGGCAAGGCTGAGACATAGTGG - Intronic
1154443932 18:14417953-14417975 GTGGCCACGCTGTTACTGAGAGG - Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1157306968 18:46524660-46524682 GTGGCCATCCTCATGCCTAGGGG - Intronic
1163123875 19:15233608-15233630 GTGGATACCCTGATTCCTAGGGG + Intergenic
1166824959 19:45602707-45602729 GTGACCACCTTGATTCAAAGAGG - Intergenic
1166947603 19:46406569-46406591 GATGCCACCCTGAGACATGGGGG - Intergenic
925429347 2:3777879-3777901 ATGGCCACCCTGAGTCACAGTGG - Intronic
926716798 2:15930844-15930866 GGGGCCACCTTGATCCATTGGGG + Intergenic
929820515 2:45269722-45269744 GTGGCCTCCCTAAGGCATAGTGG + Intergenic
931185297 2:59945213-59945235 GTGGCCAACCCGACACCTAGGGG + Intergenic
932147150 2:69332228-69332250 GTGGCCAAAGTGATAAATAGAGG - Intronic
938391876 2:130913108-130913130 GTAGCCACCCTTATCCACAGGGG - Intronic
942422425 2:175821611-175821633 GTGAGGACCCTGAAACATAGGGG - Intergenic
942685186 2:178523312-178523334 GTGGCCACACGGACACATGGGGG - Intergenic
1172047278 20:32089275-32089297 GTGGCCAGACTGTTACATTGAGG - Intronic
1176452157 21:6873273-6873295 GTGGCCACGCTGTTACTGAGAGG + Intergenic
1176830329 21:13738322-13738344 GTGGCCACGCTGTTACTGAGAGG + Intergenic
1177446156 21:21198918-21198940 TTTGCCACCCAGATACATAATGG - Intronic
1184031517 22:41897702-41897724 GTGGCCACCCTGGAAGATGGGGG + Intronic
1184123603 22:42471031-42471053 TTGGCCACCCTGAGATACAGAGG - Intergenic
954366322 3:50148044-50148066 GTGGCCACACAGACACATGGAGG + Intergenic
957577733 3:82031346-82031368 GTGGCTACCATGATACACAGGGG - Intergenic
958100040 3:88997885-88997907 GTGACCTACCTGATACACAGAGG + Intergenic
959233781 3:103691818-103691840 GTGGCCACCCAGATTAACAGTGG - Intergenic
959291457 3:104479745-104479767 GTGCCCACCCAGATAGAGAGTGG + Intergenic
959520403 3:107317598-107317620 GTGGCCAGACTGTTACATGGGGG - Intergenic
977721945 4:100249382-100249404 GTGCCCACCCAGATAAAGAGTGG + Intergenic
986088336 5:4476248-4476270 GTGGCTATCCTGAAACAAAGAGG - Intergenic
987834671 5:23146069-23146091 GTGGCCACTCTTCTCCATAGGGG + Intergenic
991531766 5:67623121-67623143 GTGGCCAACCTGTTTCTTAGGGG + Intergenic
994004314 5:94819624-94819646 GTGGCCATCCTGTTAAAAAGAGG + Intronic
995299706 5:110564784-110564806 GTGGCCACCCTGATCTCTACAGG - Intronic
998716988 5:144895557-144895579 GGGAGCACCCAGATACATAGAGG + Intergenic
999074492 5:148781388-148781410 GTGGCCAACCTGTTACATGGGGG + Intergenic
1001543495 5:172555516-172555538 GTGCCCACCCAGATAAAGAGTGG - Intergenic
1004074738 6:12334640-12334662 GTGGCCATCCGGATACACTGTGG - Intergenic
1004760142 6:18656886-18656908 GTGGCCACCCTGACCCCTAGGGG - Intergenic
1011530654 6:88317514-88317536 GTGTCCACCCAGATAGAGAGTGG - Intergenic
1019358255 7:592121-592143 GTGGGGACCCTGATCCATGGGGG - Intronic
1019995997 7:4724946-4724968 GTGGCCACACAGAAAAATAGTGG + Intronic
1025008898 7:55379421-55379443 GTGGCCACCCTTGTGCATAACGG + Intronic
1033031199 7:137828763-137828785 GTGGCTCCCCTGATTCCTAGGGG - Intronic
1035249113 7:157585435-157585457 GTGGCCATCCTGCCGCATAGGGG + Intronic
1041867967 8:62598573-62598595 GTTTCCACCCTGCTACATAGGGG + Intronic
1045507542 8:102789209-102789231 GGGGCCACCCTGACACCCAGGGG - Intergenic
1049262723 8:141648461-141648483 GTGGCCACACAGCTACATAGAGG - Intergenic
1053530394 9:38875546-38875568 GTGGCCACCCTGAACAAGAGTGG - Intergenic
1054202620 9:62099976-62099998 GTGGCCACCCTGAACAAGAGTGG - Intergenic
1054635742 9:67488389-67488411 GTGGCCACCCTGAACAAGAGTGG + Intergenic
1203517024 Un_GL000213v1:11242-11264 GTGGCCACGCTGTTACTGAGAGG - Intergenic
1186116374 X:6308823-6308845 GTGCCCACCCTGATTAATGGTGG - Intergenic
1187245904 X:17552740-17552762 GTGGCCTCCCTGAAATAGAGAGG + Intronic
1190740530 X:53285485-53285507 GTGGCCACCCTGCCAAGTAGGGG - Intronic
1190806765 X:53845055-53845077 GTTTCCACCCTGATATATAAGGG - Intergenic
1199084305 X:143611030-143611052 GTGCCCACCCAGATAAATGGTGG - Intergenic
1199314255 X:146358646-146358668 GTAGCCAAGCTGATACTTAGGGG + Intergenic