ID: 1142352064

View in Genome Browser
Species Human (GRCh38)
Location 16:89585098-89585120
Sequence TTTCACCTGCAGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142352064_1142352070 -2 Left 1142352064 16:89585098-89585120 CCTTCCACTTCCTGCAGGTGAAA 0: 1
1: 0
2: 2
3: 34
4: 285
Right 1142352070 16:89585119-89585141 AATGGGATTTCAGCGACGGCAGG No data
1142352064_1142352071 -1 Left 1142352064 16:89585098-89585120 CCTTCCACTTCCTGCAGGTGAAA 0: 1
1: 0
2: 2
3: 34
4: 285
Right 1142352071 16:89585120-89585142 ATGGGATTTCAGCGACGGCAGGG 0: 1
1: 0
2: 0
3: 3
4: 73
1142352064_1142352069 -6 Left 1142352064 16:89585098-89585120 CCTTCCACTTCCTGCAGGTGAAA 0: 1
1: 0
2: 2
3: 34
4: 285
Right 1142352069 16:89585115-89585137 GTGAAATGGGATTTCAGCGACGG 0: 1
1: 0
2: 0
3: 16
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142352064 Original CRISPR TTTCACCTGCAGGAAGTGGA AGG (reversed) Intronic
902043697 1:13510251-13510273 TTTCTCCGGCAGGAAGTAGGTGG + Intronic
902651859 1:17842611-17842633 TGCCACCTGCAGCAAATGGATGG - Intergenic
903809071 1:26024539-26024561 ATGTACCTTCAGGAAGTGGAAGG - Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
905434853 1:37949207-37949229 TTTCAGCTGCAAGAAGAGGTGGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906130233 1:43451448-43451470 TTTCAACTGCTGGAAGATGAAGG - Exonic
909374571 1:74924616-74924638 GTGCACCTGCAGGAGGTGGCTGG - Intergenic
909924982 1:81428412-81428434 TTGAACCTTCAGGGAGTGGAAGG - Intronic
910194712 1:84628760-84628782 TCTCTCCTGCAGGAAGTCCAAGG - Exonic
910616880 1:89208177-89208199 TATCACCTGGAGCAAGTGAATGG - Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
911501297 1:98688462-98688484 TTTCACAAAGAGGAAGTGGAAGG - Intronic
912024114 1:105145352-105145374 TTTCACCTGAAAATAGTGGAAGG - Intergenic
912501758 1:110127249-110127271 TGGCACCAGCAGGAAGTGGGTGG + Intergenic
912672970 1:111648575-111648597 CTCCATCTGCAGGAAGTAGAGGG + Intronic
914784523 1:150816498-150816520 CTTAACCTGCAGGAAGTCAAGGG - Intronic
915873200 1:159584233-159584255 GTTCACTTGGAGGAGGTGGAGGG - Intergenic
918771842 1:188571217-188571239 CTTCTCCTGCAAGAACTGGAAGG - Intergenic
919528167 1:198679987-198680009 TTGAGCCTGCAGGAAGTGGACGG - Intronic
919825788 1:201502245-201502267 TTTCTACTGGAGCAAGTGGATGG - Intronic
920499336 1:206476586-206476608 TTTCACCTGCAGGCGGTGAAAGG + Intronic
920553956 1:206890291-206890313 TCCCACCTCCAGGAAGAGGAGGG - Intergenic
921067576 1:211633462-211633484 TTTCACACGTAGGAAGTGGCTGG - Intergenic
921143934 1:212333514-212333536 TATCACTTGGAGGAAGTGTACGG - Exonic
922754931 1:228090430-228090452 TGTCACCTGCAGGGAGAGGTGGG + Intronic
923233468 1:232010273-232010295 TACCACCTGCTGCAAGTGGATGG + Intronic
923448181 1:234092059-234092081 TTTCACTTCCAGGAGCTGGAAGG + Intronic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924743229 1:246809803-246809825 TCTCACCTGCTTGAACTGGATGG + Intergenic
1064039183 10:11943841-11943863 TTTCAGCTGATCGAAGTGGAGGG - Intronic
1064893104 10:20202383-20202405 TTTCACCTGCATCAGGTGGATGG - Intronic
1065953779 10:30675543-30675565 TTTAACCTGCAGGAAGAAGGAGG + Intergenic
1068596118 10:58904901-58904923 ATGCACCTGCAGGAGGTGGATGG - Intergenic
1070713356 10:78699684-78699706 TCACACCACCAGGAAGTGGAAGG - Intergenic
1075393028 10:122106796-122106818 TTGCACCAGCAGGAAGTCCAAGG + Intronic
1075411676 10:122233179-122233201 TTTGACCAGAAGGATGTGGAAGG - Intronic
1075627601 10:123973743-123973765 TTGCACCTGAAGGAGCTGGATGG - Intergenic
1075850794 10:125585298-125585320 CTTGACCTGCTGGAAGTGGGAGG - Intronic
1078386335 11:10896318-10896340 TTTCACCAGCAGGAAATAAAAGG + Intergenic
1079237864 11:18702415-18702437 TTTCATCTGCACAAAGTTGAGGG + Exonic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081653162 11:44839227-44839249 TTTCACCTTGATGCAGTGGAAGG + Intronic
1082232355 11:49782909-49782931 TTACACTAGCAGTAAGTGGAGGG - Intergenic
1083085916 11:60145263-60145285 CTGCACCATCAGGAAGTGGATGG + Intergenic
1083504995 11:63148399-63148421 TTTCCACTGCAGAAGGTGGAGGG + Intronic
1084475827 11:69388592-69388614 TTCCACCTGCAGGCACTGCATGG - Intergenic
1085299379 11:75449469-75449491 TGGCACCTGCAGGGATTGGAGGG + Intronic
1085980112 11:81714602-81714624 TTATACCTGCAAGAAGTGTAAGG + Intergenic
1086610418 11:88748665-88748687 ATTCACCTGTAGGAGGTGGCTGG - Intronic
1086618278 11:88851040-88851062 TTACACTAGCAGTAAGTGGAGGG + Intronic
1087328936 11:96755530-96755552 ATGCACCTGTAGGAAGTGGCTGG + Intergenic
1087727987 11:101744214-101744236 TTTCACGTGTCTGAAGTGGAAGG - Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089959702 11:122604949-122604971 TCTAACCTGCAGGAAGGAGAAGG - Intergenic
1089972295 11:122703905-122703927 TGTGACCTGCAGGCACTGGAGGG + Intronic
1090963269 11:131575773-131575795 TTTCACCTGCAGCGCTTGGATGG + Intronic
1091124989 11:133086497-133086519 TTTCATCTACAGGAAGAAGATGG - Intronic
1091551378 12:1537680-1537702 TTTCTCCTGCATGAGATGGAAGG - Intronic
1093535331 12:20216665-20216687 TTTCAGCTGGAGCAACTGGAAGG + Intergenic
1093837120 12:23846183-23846205 TTTCTCTTTCAGGAAGTTGATGG - Exonic
1094042573 12:26133216-26133238 TTTCAGGTGCAGGGACTGGATGG + Intronic
1094478795 12:30863603-30863625 TTTCATCTGCAGGAAAATGAAGG - Intergenic
1094743866 12:33320434-33320456 ATTCACCAGCAGGCAGTGGCAGG - Intergenic
1095177080 12:39105162-39105184 TTTTACCTTCAGGAAGTGGCTGG + Intergenic
1096849721 12:54427845-54427867 TTTCAACTGCAGATACTGGAGGG + Intergenic
1099640174 12:85276597-85276619 TAACACTTGCAGGAAGTGGTGGG - Intergenic
1101091479 12:101291125-101291147 TTACACTAGCAGTAAGTGGAAGG - Intronic
1101598932 12:106191574-106191596 ATCCACCTGCAGGAAGTGTTGGG - Intergenic
1101819917 12:108175690-108175712 GTTCACCTGGAGGCAGAGGATGG - Intronic
1103574043 12:121863862-121863884 TTTCAGGTTCAGGAAGTGGAAGG - Intergenic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1104645800 12:130496533-130496555 TCCCTCCTGCAGGAAGTGGATGG - Intronic
1108381473 13:49858959-49858981 TTTCTCCTGCCAGAATTGGAAGG + Intergenic
1108572460 13:51764991-51765013 TTGCAAGAGCAGGAAGTGGAGGG - Exonic
1108629576 13:52268729-52268751 ATACACCTGTAGGAAGTGGCTGG + Intergenic
1108656482 13:52537759-52537781 ATACACCTGTAGGAAGTGGCTGG - Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110762521 13:79245980-79246002 TTTCACGTGGAAGATGTGGAAGG + Intergenic
1111113964 13:83751747-83751769 TGTCACCTGGAGGAAGGGGGTGG - Intergenic
1111456777 13:88494872-88494894 TTTCACCTGAAGGAATGGGATGG - Intergenic
1112372569 13:98807052-98807074 TTTCACCTTCAGGAAGCAGAGGG + Intronic
1112966644 13:105204773-105204795 TTTCAGCTGCTGTAAGTAGATGG - Intergenic
1113199723 13:107853854-107853876 TTTCACCTGCAGTGAGTCAAAGG - Intronic
1116317547 14:43417378-43417400 TTGCACCTGCAGTAGGTGGCCGG + Intergenic
1116907659 14:50420704-50420726 TTTCACTAACAGGAAGAGGATGG + Intronic
1118624929 14:67649968-67649990 TTTGGCCTGGAGCAAGTGGAAGG - Exonic
1118697942 14:68403201-68403223 TTTCATCTGCAGGGACTGGAGGG + Intronic
1118960899 14:70530922-70530944 TTACACCTTCAGGAACTAGAAGG + Intronic
1118985248 14:70748880-70748902 GTTGTCCTGCAGGCAGTGGAAGG + Exonic
1119151420 14:72363234-72363256 ATTCACATCCATGAAGTGGATGG + Intronic
1119467890 14:74873714-74873736 AGTCACCTGCAATAAGTGGATGG + Intergenic
1119540974 14:75438066-75438088 TTTCACCTCCAGGAAGTGCAAGG - Exonic
1120094520 14:80373870-80373892 TTTTAGCTGAAGTAAGTGGAAGG + Intronic
1122049240 14:99043921-99043943 GTTCACCTGCAGGGAGTTGGCGG - Intergenic
1122151851 14:99730067-99730089 TGTCACCTGCAGGGAAGGGAGGG + Intergenic
1122761690 14:104033454-104033476 TTTCACCTGCTGGAAGCAGCAGG + Intronic
1123160244 14:106271256-106271278 TCACACCTGCAGGAAGGGCAGGG + Intergenic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1123755479 15:23394661-23394683 TTCCTCCTGCAGGAAGAGGACGG - Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124445607 15:29729110-29729132 TTTCACCTGAAGGAAGTTGGTGG - Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1127918395 15:63474066-63474088 TTTCACCTGCCTGAAGAAGAGGG + Intergenic
1128286122 15:66438565-66438587 TTTCTCCTGAAGGAGGAGGAAGG - Intronic
1128936607 15:71751130-71751152 TTTAGCCTGGAGAAAGTGGAAGG - Intronic
1129165303 15:73773837-73773859 TTTCAGCTGCAGCAAAGGGAAGG + Intergenic
1130700061 15:86169326-86169348 GACCACCTGCAGGAAATGGAGGG + Intronic
1132526828 16:420842-420864 TTTCTCCGGCAGGTACTGGAAGG + Intergenic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1133422392 16:5657551-5657573 TTTCACTTGCTGGACTTGGAGGG + Intergenic
1134381091 16:13726639-13726661 TTTCACCTGCAGTAACCTGAGGG - Intergenic
1136654283 16:31700674-31700696 TGTGACCTGCAGGTACTGGACGG + Intergenic
1137398477 16:48134021-48134043 TGTCAGCTGCCGTAAGTGGATGG + Intronic
1137727247 16:50665253-50665275 TTCCGCTTGCGGGAAGTGGAGGG + Intergenic
1138284136 16:55794916-55794938 TCTCACCTGCAGGCAGGAGACGG + Intergenic
1138284866 16:55802071-55802093 TCTCACCTGCAGGCAGGAGACGG - Intergenic
1141869037 16:86772021-86772043 TTTCAACGGCAGGAAGGGAATGG + Intergenic
1142000753 16:87662874-87662896 TTTTCCCTGCAGGCAGTGGAAGG - Intronic
1142352064 16:89585098-89585120 TTTCACCTGCAGGAAGTGGAAGG - Intronic
1143385847 17:6530040-6530062 TGTCTCCTGGAGGGAGTGGAAGG - Intronic
1143920740 17:10329273-10329295 AGTCACCTGCAGGGATTGGAGGG - Intronic
1147632365 17:41940321-41940343 TTTAACCTGCAGGCAGTGAGGGG - Intronic
1149299819 17:55294750-55294772 TTTCAGATCCAGGAAGTGCATGG - Intronic
1149350738 17:55784257-55784279 GTTCTCCAGCAGGAAGTAGACGG + Intronic
1151717194 17:75836908-75836930 TGTCCCCTGCAGGCAGTGGCTGG - Exonic
1152140428 17:78533302-78533324 TTTCACCTGAAGCAAGGGGGAGG - Intronic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1157944737 18:51966525-51966547 TTCCACCTGCAGGGAAGGGAAGG + Intergenic
1159115968 18:64113672-64113694 TTTCACCTGCAGGGAAAGGATGG + Intergenic
1159199456 18:65165566-65165588 TTACACTTGTAGGAAGTTGAAGG + Intergenic
1159755553 18:72359607-72359629 TTTCAGCTGAATGAAGTGGGTGG - Intergenic
1161596767 19:5154609-5154631 AGTCACCTGCAGGGAGTGGGTGG + Intergenic
1162766758 19:12924521-12924543 TGATACCTGCAGGAAGTGGGGGG + Exonic
1163302322 19:16455808-16455830 TTTTACCTGGAGCCAGTGGAAGG - Intronic
1164270946 19:23671154-23671176 TTTTCCCTTCAGGAAGAGGAAGG - Intronic
1164889119 19:31807900-31807922 TTTCCCATGCAGGAACAGGATGG - Intergenic
1165261096 19:34618691-34618713 TTTCACATGCAGGGTGTGTAAGG - Intronic
1165705149 19:37970647-37970669 CCTCTCCTGCAGGATGTGGAGGG + Intronic
1165789562 19:38483405-38483427 CTCCACCTGCAGGAAGTGGTTGG - Exonic
1167569529 19:50278206-50278228 TTACAGCTGCAGGAGGTGCAGGG + Exonic
1168207152 19:54859316-54859338 TCTCACCTGCAGGAAATTAAAGG - Intronic
1168254931 19:55159967-55159989 ATTGAGCGGCAGGAAGTGGACGG + Exonic
1168258105 19:55178221-55178243 GTCCACCTTCAGGAAGTGAAGGG - Exonic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
928877120 2:36053099-36053121 GTTCTCCTGCAGGAACTGGAAGG - Intergenic
930229385 2:48827705-48827727 ATTCACCTGTAGGAGGTGGCTGG - Intergenic
933515660 2:83297889-83297911 TTTCCCTAGCAAGAAGTGGAGGG + Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
937266051 2:120615226-120615248 TTCTGCCTGCAGGAAGAGGAGGG - Intergenic
937332406 2:121039821-121039843 TTCGTTCTGCAGGAAGTGGAAGG - Intergenic
938191144 2:129281892-129281914 TGTCTCCTGCAGGATGTGGATGG + Intergenic
940196551 2:151101493-151101515 TCTCACCATCAGGAAGTGGTGGG + Intergenic
942162208 2:173202541-173202563 TTTCACCTCAAGGGAGTGTAAGG - Intronic
945814366 2:214585902-214585924 TTTCACTTGCAGAAAATGGAAGG + Intergenic
946164425 2:217855303-217855325 TTTCACGGGCAGGATGAGGAAGG - Intronic
947394235 2:229671708-229671730 TTTCACTTGCAGGAAAGGGACGG + Intronic
948061343 2:235045014-235045036 GGTCACCTGCAGGGAGGGGATGG + Intronic
1170561063 20:17558936-17558958 TTTTCCATGCTGGAAGTGGAAGG - Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172460722 20:35116367-35116389 TTTATCCTGCATGAAATGGAGGG - Intronic
1173347789 20:42216817-42216839 TTTCTTCTGCAGGTAGTGCATGG + Intronic
1173525835 20:43731881-43731903 TTTAACCTGCAGGAGGTGCCTGG - Intergenic
1174484866 20:50854893-50854915 TCTCGCCTGCAGGAATTGAATGG + Intronic
1174536340 20:51254312-51254334 TTACACCTGTGGGAAGTGGAAGG + Intergenic
1175961096 20:62636711-62636733 TTCCATCTGCAGGAAGGGGGTGG - Intergenic
1177944128 21:27446131-27446153 TTTCCCATACAGGAAGAGGAGGG + Intergenic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179390005 21:40979766-40979788 TCTCACCTGGCAGAAGTGGAAGG - Intergenic
1180708498 22:17824117-17824139 TTGCACCAGCAGGAAGAGGGCGG + Intronic
1180840620 22:18957282-18957304 TTTGAGCTGAGGGAAGTGGAGGG - Intergenic
1181043568 22:20204212-20204234 TGTCCCCGGCAGGAAGTGGAGGG - Intergenic
1181508168 22:23375745-23375767 TTGCACCTGAAGGATGTGGTTGG - Intergenic
1182166715 22:28182144-28182166 TTTTACTTGGGGGAAGTGGAGGG + Intronic
1183377909 22:37475740-37475762 CTGCACCTGCAGGAGTTGGAGGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184111336 22:42397251-42397273 GTGCATCTCCAGGAAGTGGAAGG - Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184641971 22:45877645-45877667 TTTCTCGTCCAGGAAGAGGATGG + Intergenic
1185019226 22:48364097-48364119 TTTCACCTCCAGGAAGGGGATGG + Intergenic
949979835 3:9495308-9495330 TTCCATCTTCAGGAAGTAGAAGG - Intergenic
950459745 3:13114206-13114228 TTACACCTGCAGGATGCGGGTGG + Intergenic
950667774 3:14507601-14507623 AGCCACCTGCAGGAGGTGGATGG + Exonic
951064636 3:18249597-18249619 TCTCACCACCAGGAAGTGGCAGG + Intronic
954521849 3:51234855-51234877 TTTCACCACCAGGAAGTGCCTGG - Intronic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
956854058 3:73258508-73258530 TTGCACCTGCAAAAAGTGTAGGG - Intergenic
957230626 3:77509734-77509756 GTACACGTGCAGGAAGGGGAAGG - Intronic
957547319 3:81656373-81656395 TTTCAGCTTCTGGAAGTGGCTGG - Intronic
958640648 3:96800684-96800706 ATGCACCTGCAGGAGGTGGTTGG + Intergenic
959619234 3:108382097-108382119 ATTCAGCTGCAGGAGGTTGAAGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962363603 3:134761940-134761962 TTGCTCCTGCAGGAAGAAGAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963508698 3:146220887-146220909 TTTCACCTGCAGGCTGTTCAGGG + Exonic
963833369 3:150032259-150032281 TTCCACCTGCACGGAGTGCATGG + Intronic
964277621 3:155024869-155024891 TTACTGCTGCAGGAAGTAGAGGG + Intronic
965123478 3:164594178-164594200 TTTCAGCTGCAGGAAGAGGGAGG + Intergenic
965317751 3:167212054-167212076 AGTCACCTGTAGGAAGTGGCTGG - Intergenic
965381118 3:167989897-167989919 TTTCACCTGCTTTAAGTGCATGG + Intergenic
965736217 3:171823795-171823817 TTTCACCTCCAGGATGAGTAAGG - Intergenic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
969641646 4:8402282-8402304 GCCCACCTGCAGGAAGTGAAGGG + Intronic
971953416 4:33383533-33383555 TTTCAACTGTGGGAAGTGGAAGG - Intergenic
973876013 4:55219374-55219396 TGTCAGCTGCATTAAGTGGATGG + Intergenic
974115585 4:57575572-57575594 TTTTTCCAGCAGGAAGTGGGAGG + Intergenic
974516915 4:62927710-62927732 TTTCAAGTTCAGTAAGTGGAAGG + Intergenic
982136307 4:152277243-152277265 TTTCTTCTGTAGGAAGTGAATGG - Intergenic
984748516 4:183248363-183248385 TTTCAGCTGCATGAAGTGAGTGG + Intronic
984864723 4:184271867-184271889 TTTCCCATGCTGGAAGGGGAAGG + Intergenic
985485155 5:144669-144691 CTGCACCTTCGGGAAGTGGAAGG + Intronic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
991290383 5:65028275-65028297 ATCACCCTGCAGGAAGTGGAGGG + Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993226148 5:85168760-85168782 ATACACCTGCAGGAAGTGGCTGG + Intergenic
993318455 5:86441201-86441223 TTTCACTTGCACTTAGTGGAAGG + Intergenic
994996740 5:107073262-107073284 TTTTACCTGCAGAGAGTGCAAGG - Intergenic
995566478 5:113436271-113436293 TTTCCCCAGCAGGAAGGAGAAGG - Intronic
996561134 5:124830775-124830797 ATTCCCCTGAAGGAAGGGGAAGG - Intergenic
996718095 5:126603558-126603580 TTTCACTTGCAGAAAGTGCTAGG + Exonic
997280633 5:132642039-132642061 GCTACCCTGCAGGAAGTGGAGGG - Intronic
997429232 5:133826026-133826048 TCTCACCTGGAGGCAGTGGCAGG - Intergenic
997445049 5:133934445-133934467 GTCCAGCTGAAGGAAGTGGAAGG - Intergenic
998404164 5:141864262-141864284 TTCCAGCTGAAGGCAGTGGATGG - Exonic
999257979 5:150220417-150220439 ATTTACCTGCAGGAACTGGCAGG - Intronic
1000050024 5:157554868-157554890 TTACACCTCCAGGTAGTGCAAGG + Intronic
1000289734 5:159859291-159859313 TTTCACCTGCAAGTACTGAAAGG + Intergenic
1001036959 5:168303838-168303860 CTTCAACTCCAGGAAGTGCAGGG + Intronic
1001242374 5:170080448-170080470 TGTCACCCCCAGGAAGTGGTGGG - Intronic
1001934844 5:175696628-175696650 GGTCAGCAGCAGGAAGTGGATGG + Intergenic
1002674559 5:180900469-180900491 TTTCAAGGGAAGGAAGTGGAAGG + Intronic
1003327284 6:5101534-5101556 TCTCACCACCAGGAAGTGGCAGG + Intergenic
1003544424 6:7046887-7046909 TTCCATCTGCAGGAAGTGCTGGG + Intergenic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1003992415 6:11499201-11499223 CTCCCCCAGCAGGAAGTGGATGG - Intergenic
1005247326 6:23902826-23902848 TTTCACATGGTGGAAGGGGAAGG + Intergenic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1010494990 6:76523237-76523259 ATTCAGCTGCAGGACATGGATGG - Intergenic
1010744320 6:79543607-79543629 GTTCTGCTGCAGGAAGTGGGTGG - Intergenic
1010946908 6:81985542-81985564 TTTCACCTGAAGGAAATGGGTGG + Intergenic
1011007019 6:82656950-82656972 GTTCACCTGGAGGATGTGGTGGG - Intergenic
1013574633 6:111469628-111469650 TTTCACCTGGAGGCAGTAGTAGG - Intronic
1014229839 6:118891273-118891295 TTTCACCCACAGGAAGTGCTTGG + Intronic
1014810965 6:125885147-125885169 TTTCTCCTGCAGGGTGTGGTTGG + Exonic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1016367141 6:143331740-143331762 TTTCGCCTGCAAGAAGAGGGGGG + Intronic
1017212936 6:151876753-151876775 TTTGACTGGCAGGAAGTGGAGGG - Intronic
1017986330 6:159446011-159446033 TGTGATCTGCAGGTAGTGGAAGG - Intergenic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019173805 6:170149641-170149663 GTCTACCTGCAGGCAGTGGAGGG - Intergenic
1019486754 7:1292947-1292969 TTTCACATCCAGGCAGTGAATGG + Intergenic
1019736424 7:2652226-2652248 TCTCACCTGCTGGAAGGGGTTGG - Exonic
1019928237 7:4207107-4207129 TTCCACCTGCAGGATGTAGTGGG - Intronic
1020695143 7:11404642-11404664 TTTCAGCAGCAGGAAGTGAAAGG + Intronic
1021630872 7:22646415-22646437 TTTCACCTCCAGGAAGGTGTGGG + Intergenic
1022616465 7:31935972-31935994 GTTCCCCTGTGGGAAGTGGAGGG - Intronic
1022804113 7:33804661-33804683 TTTTATCTGAAGGCAGTGGAAGG - Intergenic
1024871314 7:53964491-53964513 TTTCACAGGCAGGAAGAAGATGG - Intergenic
1025040901 7:55644733-55644755 TTTCACCTACTGGCAGGGGAGGG - Intergenic
1026062944 7:67042609-67042631 TTTCTCCTGAAGGCAGTGGGAGG + Intronic
1026715405 7:72784881-72784903 TTTCTCCTGAAGGCAGTGGGAGG - Intronic
1027185539 7:75968625-75968647 TTTAACCAGCAGGAACTTGAAGG + Intronic
1029509656 7:100985982-100986004 TTCAACCTGATGGAAGTGGAGGG - Intronic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1034149542 7:148903282-148903304 CTACGCCTGCAGGAAGTGCAAGG - Intergenic
1034514197 7:151561599-151561621 TTTCACCCGCAGGAAGGGAGCGG + Intronic
1034530809 7:151695354-151695376 CTCCCCCTGCAGGAAGTGGATGG - Intronic
1034731872 7:153394179-153394201 TTTTACATGCAGGATGTGTAAGG + Intergenic
1034834863 7:154342793-154342815 TTTAACTTTTAGGAAGTGGACGG - Intronic
1035001843 7:155619047-155619069 TTTCACCAGCAGGAAATGAAAGG - Intronic
1035956586 8:4087287-4087309 AATCACCTGCAGGAAGGAGAAGG - Intronic
1037659382 8:20913851-20913873 TGACACTTGCTGGAAGTGGAGGG + Intergenic
1038091846 8:24263064-24263086 TTTCAGCTGCTGTAAGTAGATGG + Intergenic
1038214187 8:25546568-25546590 TGTCACCAGTAGAAAGTGGATGG - Intergenic
1038293079 8:26267269-26267291 TTTCTCGTGGGGGAAGTGGAGGG - Intergenic
1041458938 8:58090624-58090646 TTTCAACTGCATGGGGTGGAGGG + Intronic
1043569085 8:81581349-81581371 TTTGACCCTCAGGAAGGGGAAGG + Intergenic
1045594351 8:103635634-103635656 AGACACCTGCAGGAAGTGGCTGG + Intronic
1045657914 8:104406061-104406083 TTACACCGTCAGTAAGTGGAGGG + Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1047700861 8:127448131-127448153 TTTCACAGGGAGGAAGAGGAAGG + Intergenic
1049016705 8:139925044-139925066 TTTCCCCTGTAGGCAGTGGGAGG - Intronic
1049433894 8:142577449-142577471 CTTGACCTGCAGGACGGGGAGGG - Intergenic
1049855072 8:144856629-144856651 CTTCACCTGCAGACAGTGGGTGG - Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1051838093 9:21363388-21363410 TGTGACCTGCAGTAAGTAGAGGG + Intergenic
1052826855 9:33182960-33182982 TTAATCCTGCAGGAGGTGGAGGG - Intergenic
1053472506 9:38356990-38357012 TTTCACCTCCAGTGGGTGGAGGG + Intergenic
1057039283 9:91835727-91835749 TTGCAGCTGCAGGAGGCGGAAGG + Intronic
1057825627 9:98370303-98370325 TTTCACCTGCATCAAGAGGACGG + Intronic
1058765016 9:108174110-108174132 TTGCAGCTGAAGGAAGTGGTAGG - Intergenic
1058930123 9:109710547-109710569 TTTCACCTGCAAGACGGGGTGGG + Intronic
1061884728 9:133585771-133585793 TTTCCCCATCTGGAAGTGGAGGG - Intronic
1185828536 X:3276294-3276316 TTTCACTTGCTGGGCGTGGACGG - Intronic
1186977014 X:14918298-14918320 GTTCTCCTGCAGAAAGTGGGAGG + Intronic
1187096262 X:16151617-16151639 TTTCCCCTTGAGGTAGTGGATGG + Intronic
1187207450 X:17196790-17196812 TGTCACCTCCAAGAACTGGAAGG - Intergenic
1190939657 X:55028144-55028166 TTTCACAAGCAGGCAGGGGAAGG - Intronic
1191880518 X:65840313-65840335 TGTCATCAGCAGGAAGTGCAGGG - Intergenic
1192434885 X:71137013-71137035 ACTCACCTGCAGGTAGTGGCTGG - Exonic
1194830554 X:98618591-98618613 ATGCACCTGTAGGAAGTGGCTGG + Intergenic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1196542446 X:116925165-116925187 TTTCTCCTGCAGGCAGGGGTGGG + Intergenic
1197382003 X:125756213-125756235 TTTAATCTTCAGGAAGTGGTGGG - Intergenic
1198340282 X:135707391-135707413 TTACACCTGAAGATAGTGGATGG - Intergenic
1198483389 X:137061870-137061892 TTCCACCTGCAGGCACTGGAGGG + Intergenic
1198774230 X:140162594-140162616 TGTCAACTGCTGGATGTGGAGGG - Intergenic
1200182161 X:154157157-154157179 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200187815 X:154194271-154194293 TGTAACCTGCAGGAGGTGGGGGG - Intergenic
1200193465 X:154231411-154231433 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200199220 X:154269215-154269237 TGTAACCTGCAGGAGGTGGGGGG - Intronic
1200244032 X:154513240-154513262 TTTCAGAGGCAGGAAGTTGAGGG - Intronic
1202061788 Y:20896717-20896739 TTTCTCTTGCAGGAAGGGGCGGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic