ID: 1142352787

View in Genome Browser
Species Human (GRCh38)
Location 16:89587485-89587507
Sequence AAGCAGCCCCAAGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142352775_1142352787 28 Left 1142352775 16:89587434-89587456 CCTGGGGGTCCTCCCTTTTGCGC 0: 1
1: 0
2: 0
3: 8
4: 74
Right 1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 161
1142352779_1142352787 16 Left 1142352779 16:89587446-89587468 CCCTTTTGCGCAGGCGAGGAAAC 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 161
1142352780_1142352787 15 Left 1142352780 16:89587447-89587469 CCTTTTGCGCAGGCGAGGAAACG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 161
1142352778_1142352787 19 Left 1142352778 16:89587443-89587465 CCTCCCTTTTGCGCAGGCGAGGA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG 0: 1
1: 0
2: 0
3: 21
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142352787 Original CRISPR AAGCAGCCCCAAGCCCGCCT TGG Intronic
900891416 1:5452242-5452264 AAGCAGCACCCAGACCACCTTGG - Intergenic
900913965 1:5621441-5621463 AAGTAGCCCCAAGCCAGGCAAGG + Intergenic
901813064 1:11778747-11778769 AAGCTGCACCAAGACCCCCTCGG + Exonic
903134567 1:21301159-21301181 ACATAGCCCCAAGCCAGCCTAGG - Intronic
903271608 1:22191978-22192000 AAGCCACCCCAAGCACTCCTGGG - Intergenic
904697507 1:32338413-32338435 CAGCAGCCCCATGGCCTCCTCGG + Intergenic
905793508 1:40802571-40802593 CAGGTGCCCCCAGCCCGCCTCGG - Intronic
905893955 1:41533414-41533436 AACCAGCCCCAAGCCTCCCTGGG + Intronic
906057240 1:42926919-42926941 AAGGAGCCCCAGGCCCGGCTCGG + Exonic
906500752 1:46340547-46340569 AAGAAGCCCCTAGCCCACTTGGG - Exonic
910851368 1:91652208-91652230 AAGCAGCCCCAGAGCCTCCTTGG - Intergenic
912033124 1:105274671-105274693 AAGCAGCCAAAATCCCCCCTGGG - Intergenic
915088029 1:153401668-153401690 AAGCACCCCCATCCCCGCTTCGG + Intergenic
920753958 1:208709587-208709609 GAGCAGCCACAAGCCTGCCCAGG + Intergenic
922677760 1:227563176-227563198 CAGCATTCCCAAGCACGCCTCGG + Intergenic
922986601 1:229870696-229870718 AAGCTGCCCCAAGCCCACAGAGG - Intergenic
923325651 1:232877874-232877896 AAGCAGCCTGAAGCCCTCCGCGG + Intergenic
924383716 1:243484560-243484582 AAGCAGGCGCAAGCCCTCCCAGG + Intronic
924546401 1:245031712-245031734 AAGGAGCCCAAAGCCTTCCTTGG - Intronic
1067064374 10:43095437-43095459 AACCTGCTCCAGGCCCGCCTGGG + Intronic
1070931637 10:80265003-80265025 AAGCCGCCCCAGGCCCGCCCCGG - Intergenic
1071934386 10:90511317-90511339 AAGCAGCCTGAGGCCCTCCTCGG - Intergenic
1073313250 10:102559379-102559401 AAGAAGCCCCAGCCCTGCCTGGG + Intronic
1076065527 10:127444875-127444897 CAGCAGTCCCTAGCCCTCCTTGG + Intronic
1076258666 10:129048781-129048803 AAGCAGCAGCCAGCCCGCCCCGG - Intergenic
1076736665 10:132462109-132462131 AGGGAGCCCCCAGCCCGCCCCGG - Intergenic
1076992294 11:281808-281830 AAGCGGCTCCAGGCCAGCCTGGG + Exonic
1077088528 11:766879-766901 ACACAGCCCCATGCCCGGCTAGG - Intergenic
1078107889 11:8370105-8370127 AAGCAGCTCCAAGCCAGCCCTGG - Intergenic
1082076504 11:47980116-47980138 ACGCACCCCCAAGCCCACCCAGG + Intergenic
1083206440 11:61152468-61152490 AGTCTGCCCTAAGCCCGCCTTGG + Intronic
1084608174 11:70184578-70184600 AAGCAGCCCCAGACCCGGGTAGG + Intronic
1085405178 11:76257365-76257387 AAGCAGCCCCAGGCTAGGCTGGG - Intergenic
1087906131 11:103699827-103699849 AAGCAGTTCAAAGCCAGCCTGGG - Intergenic
1089515693 11:119030293-119030315 CTGCAGCCCGAAGCCCGCCGGGG - Intronic
1096779435 12:53983684-53983706 AAGGAGGCCCAAGCCCGCTGCGG - Intergenic
1102008858 12:109606042-109606064 AGGCAGCCACAAGCCAGGCTTGG + Intergenic
1105290136 13:19048313-19048335 AAGCAACCCCAACCCCACCAAGG + Intergenic
1112586241 13:100721365-100721387 AGGCAGCCTCAAGCCTTCCTGGG - Intergenic
1118607141 14:67512799-67512821 AAGGAGCTCCAAGCCATCCTGGG + Intronic
1119703687 14:76771275-76771297 AAGAAGCTCCAAGCCAGCCCTGG - Intronic
1121409091 14:93737175-93737197 TAGGAGCCCCAAGCCCAGCTGGG + Intronic
1121444980 14:93973029-93973051 CAGCAGCCCCAGCCCAGCCTTGG - Intronic
1122153616 14:99737739-99737761 GAGGAGCCCCAAGCCCTGCTGGG + Intronic
1122499385 14:102186630-102186652 TAGCAGCCCCAAGCCTGACTAGG + Intronic
1125540138 15:40465482-40465504 AAGCAGCCCCAAATATGCCTGGG - Intronic
1125546703 15:40511561-40511583 AGGACGCCCCCAGCCCGCCTCGG - Intergenic
1125758670 15:42083008-42083030 CAGCAGCCCCATGCCCGCTCTGG + Intronic
1125769070 15:42153189-42153211 AAGGACACCCAAGCCCTCCTCGG - Intronic
1125849059 15:42886517-42886539 AGGCAGCCTCTGGCCCGCCTGGG - Intronic
1128983086 15:72200425-72200447 AAGCATCCCCAAGCTCCTCTAGG + Intronic
1129744422 15:78008139-78008161 CAGCAGCCCCAGCCCAGCCTAGG + Intronic
1130701737 15:86190572-86190594 AACCAGCTCCAGGCCCACCTGGG + Intronic
1131119253 15:89812968-89812990 AAGCAGCCCCCAGCACTCCCTGG - Intronic
1132647463 16:1005605-1005627 AAGGAGCGCCAAGTCCTCCTGGG - Intergenic
1132688373 16:1171642-1171664 AGGCAGCCCCCAGGCGGCCTTGG - Intronic
1134507665 16:14821245-14821267 AAGCAGCCCCATGTCCAACTGGG + Intronic
1134816168 16:17207685-17207707 CAGCAGCACCAAGCCCTGCTGGG + Intronic
1135803745 16:25523303-25523325 CAGCAGCCCCATGGCCACCTTGG + Intergenic
1139754713 16:69132803-69132825 GAGTAGCCCCCACCCCGCCTCGG - Intronic
1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG + Intronic
1145400378 17:22527189-22527211 AAGCAGCTTCAATCCTGCCTGGG - Intergenic
1147686419 17:42289030-42289052 AAGGATCCCCCAGCCCACCTCGG - Intronic
1150433907 17:65139497-65139519 AAGCAGCCACAGGCACCCCTGGG + Intronic
1151538009 17:74749450-74749472 ACGCAGCCCCAGGCCTGCCTAGG - Intronic
1151595984 17:75078210-75078232 CAGCAGCCCCACCCCTGCCTGGG - Intergenic
1152631744 17:81413634-81413656 AAGCAGCCACAAGGCCGCGGGGG + Intronic
1152821914 17:82441741-82441763 AAGCCGCCCCACGGCTGCCTTGG + Intronic
1153222539 18:2874483-2874505 AAGCAGCCCCCTCCCCTCCTTGG + Intronic
1153583364 18:6597651-6597673 GAGCTGCCCCAAGCCCTGCTGGG - Intergenic
1158946287 18:62449809-62449831 AAGCAAACCCAAGTCCTCCTTGG - Intergenic
1160070939 18:75627116-75627138 AGGCAGCCCCAAGCGCCCATGGG - Intergenic
1160280428 18:77485152-77485174 CAGCAGACCCAGGCACGCCTCGG - Intergenic
1160571211 18:79818785-79818807 AAGCAGCCCCAAAGCCCCCACGG - Intergenic
1160907145 19:1456735-1456757 GGGCAGCCCCACGCCCACCTGGG - Intronic
1161296077 19:3520825-3520847 GAGCAGCACCAAACCCGCATGGG + Intronic
1163297574 19:16422091-16422113 ATGCAGCCCCAACCCCACCAGGG + Intronic
1165469640 19:35995853-35995875 AGGCCGCCCCAAGCCCTCATGGG - Exonic
1166355731 19:42226154-42226176 ATGCAGTCGCAAGCCCGCCATGG - Exonic
1167166688 19:47803710-47803732 AGGCAGCCCCCAGCCCCCCTAGG + Intronic
1167175149 19:47860054-47860076 AGGCAGCCCCCAGCCCCCCTAGG - Intergenic
928108844 2:28490303-28490325 AAACAGCCCCAAGCCCCTCCTGG - Intronic
930984868 2:57573175-57573197 AAGCAGCCTGAAGCCCTCATCGG + Intergenic
934654928 2:96112439-96112461 AAACAGCCCCAAGCTAGCCCCGG - Intergenic
936065976 2:109332435-109332457 ACTCAGCCCCAAGCCCGTCCAGG - Intronic
941039043 2:160599793-160599815 AAGCAGCCCCAGGCTGGCCTTGG + Intergenic
947633802 2:231670140-231670162 GGGCAGCCCCAGGCCCTCCTAGG + Intergenic
1168765525 20:379733-379755 AAGTAGCACCAAGCCCTCCCAGG + Intronic
1169065025 20:2690323-2690345 AAGAAGCCCCATCCCAGCCTAGG + Intergenic
1170572249 20:17638974-17638996 AAGGAGCCCCAAGGCCCTCTGGG - Intronic
1171994227 20:31719876-31719898 AAGCAGCCTCAATCCCTACTTGG + Intronic
1175368501 20:58471232-58471254 AAGCAGCCCCCAGGGCTCCTTGG - Intronic
1176034672 20:63030391-63030413 AAGCAGCCCCAGGTCCCCCATGG - Intergenic
1176131008 20:63496867-63496889 GAGCACCCCCAACCCCGCCAGGG + Intronic
1176546670 21:8205331-8205353 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176554565 21:8249521-8249543 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176565621 21:8388378-8388400 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1176573486 21:8432546-8432568 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1177150368 21:17449669-17449691 TAGCAGCCCCAAGCCCCTCTGGG - Intergenic
1178304957 21:31483824-31483846 AAGCAGATCCAAGGCAGCCTTGG + Intronic
1179142046 21:38734233-38734255 AAGCATCCCGAAGCCCTGCTAGG + Intergenic
1179320841 21:40289765-40289787 CAGCAGCCCCAAGACCCCCAGGG - Intronic
1179719373 21:43306621-43306643 AAGCAGCCCCCAGCGGGTCTGGG + Intergenic
1180744322 22:18077412-18077434 CAGCGCCCCCAACCCCGCCTCGG + Intergenic
1180979418 22:19871712-19871734 CAGCAGCCCCACGCCCGTCCTGG - Intergenic
1181174418 22:21027684-21027706 AAGCAGCCCCTTGCCTCCCTGGG - Exonic
1183688155 22:39373954-39373976 AAGGAGCCACAGGCCCTCCTGGG - Intronic
1184189049 22:42882758-42882780 AGGCAGCCCCCACCCCGTCTTGG - Intronic
1184404233 22:44291184-44291206 AAGCAGCCCCTATCCCGGGTAGG - Intronic
1184405662 22:44299036-44299058 TGGGAGCCCCCAGCCCGCCTTGG - Intronic
1184457315 22:44618535-44618557 CAGCAGCCCCAGGCCAGCCACGG - Intergenic
1203251535 22_KI270733v1_random:121597-121619 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1203259585 22_KI270733v1_random:166679-166701 GGGCAGCCCCACGCCCGCCTCGG - Intergenic
950261212 3:11544410-11544432 GACCAGCCCCAATCCTGCCTGGG + Intronic
954105286 3:48406536-48406558 ATTCAGCCCCAGGCCTGCCTGGG - Intronic
954316312 3:49803548-49803570 ACGCCGCCCCCACCCCGCCTCGG - Intronic
955391942 3:58528372-58528394 AAGCTGCCCCAAACCCCACTGGG - Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
964647850 3:158977672-158977694 AAGCAGCCCACAGCACGACTGGG - Intronic
964927310 3:161975114-161975136 AAGCTGCCCTCAGCCCTCCTTGG + Intergenic
967808341 3:193734628-193734650 AAGCAGCCCTCAACCCTCCTAGG - Intergenic
968082115 3:195853845-195853867 AGGCAGCCCCGAGGCCTCCTCGG + Intergenic
968982615 4:3858594-3858616 AAGCAGCCCCAGGAATGCCTCGG - Intergenic
969327315 4:6451509-6451531 AAGCAGACCCCAGCCCGCGCTGG - Intronic
969626186 4:8306823-8306845 AGGCTGCCCCATGGCCGCCTTGG - Exonic
970483220 4:16498706-16498728 AAGCAGCCACAAGCCAGCCCAGG - Intergenic
970555854 4:17231854-17231876 ATGCTGCCCCAAGCCCCACTGGG + Intergenic
972816075 4:42646676-42646698 AAGAAGGCCAAAGCCAGCCTGGG - Intronic
979980035 4:127243480-127243502 AATCAGTCCCAAGTCCTCCTGGG + Intergenic
982169140 4:152644279-152644301 AAGGATCTCCAACCCCGCCTGGG + Intronic
983164028 4:164452347-164452369 AAGCAGGCCCAAGCAGACCTAGG - Intergenic
983552392 4:169031395-169031417 CAGCAGCCCCAAGTCCGCTTGGG + Intergenic
983642719 4:169958132-169958154 AAGCAGCCTCAAGCCCACCCAGG + Intergenic
985467529 5:12031-12053 ATGCAGCCCCAAGCCTTCCTTGG + Intergenic
985545744 5:508146-508168 AAGCAGCCCAGAGCGCGCCCGGG + Intronic
985545807 5:508433-508455 ACGCAGCCCATAGCGCGCCTGGG + Intronic
985545847 5:508602-508624 ACGCAGCCCATAGCGCGCCTGGG + Intronic
986600480 5:9467753-9467775 AGGCAGGCCTAAGCCCGCCCTGG + Intronic
993067708 5:83120463-83120485 AAGCAGCCCAATGGCTGCCTGGG - Intronic
997912419 5:137889290-137889312 CAGCAGCCCGCAGCCCGCCTCGG + Intronic
999963096 5:156777897-156777919 ACGCAGCCCCTTGACCGCCTTGG + Intergenic
1000373089 5:160555859-160555881 AAGCAACCCCAAGGCTCCCTTGG - Intergenic
1003421311 6:5960759-5960781 AAGCTGCCCCAAGCTCCCCCAGG - Intergenic
1007186502 6:39976591-39976613 CAGCAGCCCCAAGACCCTCTTGG + Intergenic
1013836916 6:114343626-114343648 CAGCAGCCCCAAGCACGCCGCGG - Intergenic
1015327582 6:131940989-131941011 AAGCTGCCCCCAGACCACCTTGG - Intergenic
1023792312 7:43762848-43762870 GATCAGCCCCATGCCCGCCTCGG + Intronic
1024004077 7:45212519-45212541 AACCAGCCCACAGCCCACCTGGG - Intergenic
1025027652 7:55530974-55530996 AAGGAGCCCAAAGCCCACCAGGG + Intronic
1025850335 7:65239127-65239149 AGGGTGCCCCAGGCCCGCCTTGG - Intergenic
1026634022 7:72065536-72065558 AAGCATCCCCAATCCCATCTCGG + Intronic
1026913984 7:74108841-74108863 AAGCAGACCCAAGCACAGCTGGG + Intronic
1029502361 7:100939793-100939815 AGTGAGCCCCAAGCCTGCCTGGG + Intergenic
1030268223 7:107642794-107642816 AAGCAGCCCCAGGACTGCTTTGG - Intergenic
1033620603 7:143058850-143058872 AATCAGACCCAAGCCCCCCAGGG - Intergenic
1036711720 8:11083581-11083603 AAGCATCCCCAGGCCCCCCAAGG - Intronic
1038367063 8:26947278-26947300 AAGCAGCCCAAAGAACACCTGGG - Intergenic
1042608977 8:70577182-70577204 AAGCTGCCCTCAGCCCCCCTCGG - Intronic
1043798692 8:84579112-84579134 AAGCAGCCCTCAGCCCCCCTAGG + Intronic
1046763965 8:118049836-118049858 AGGCAGCCCCACGACCGCCAGGG + Intronic
1047407812 8:124599713-124599735 AAGGAGCCCCAAGACCGTTTTGG - Intronic
1049483662 8:142840159-142840181 AAGCAGCCCCAGGACCTCCCTGG + Intronic
1049603791 8:143519955-143519977 AACCACCCCCCAGCCTGCCTAGG + Intronic
1049658884 8:143810905-143810927 CAGCAGCCCCCACCCAGCCTCGG - Exonic
1049850136 8:144826539-144826561 AGGCAGCCCCCAGCCCCCCAGGG - Intergenic
1049960571 9:734333-734355 AAGTGGCCCCAAGCCAGCCCAGG - Intronic
1053159738 9:35805768-35805790 GGGCACCCCCAAGCCCACCTGGG - Intronic
1054142456 9:61540193-61540215 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054191092 9:61986223-61986245 AGGCAGCCCCAAGCCTGGGTGGG + Intergenic
1054462200 9:65471343-65471365 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1054647277 9:67601494-67601516 AGGCAGCCCCAAGCCTGGGTGGG - Intergenic
1055718130 9:79141287-79141309 AAGCAGCCCCAGGCCAACCTGGG - Intergenic
1057271912 9:93656256-93656278 AAGCAACCCCAACCCCACCAAGG - Intronic
1061072123 9:128317271-128317293 ATGCAGCCCAAAGCCATCCTGGG - Intronic
1061773656 9:132946084-132946106 CACCAGCCCCAAACCCTCCTGGG + Intronic
1203467937 Un_GL000220v1:104748-104770 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1203475758 Un_GL000220v1:148720-148742 GGGCAGCCCCACGCCCGCCGCGG - Intergenic
1193152568 X:78139999-78140021 AAGCAGCCCTAACACCGACTGGG - Intergenic
1198090218 X:133321400-133321422 CAGCAGACTCAAGCCTGCCTTGG - Intronic
1198641445 X:138760438-138760460 AAGCTGACACAAGCCTGCCTCGG + Intronic
1200055538 X:153458048-153458070 CAGCTTCCCCAAGCCCGCCAAGG - Intronic
1200278647 X:154757899-154757921 AAGCAGCCACAAGCCTGCTCAGG - Intergenic
1201694499 Y:16810039-16810061 AAGCTGCACCAAGACCACCTTGG + Intergenic