ID: 1142354807

View in Genome Browser
Species Human (GRCh38)
Location 16:89597334-89597356
Sequence GGATCCTGGTGTGCTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 327}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142354807_1142354820 18 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354820 16:89597375-89597397 TGCGGGATGCACAGGCTGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 211
1142354807_1142354821 19 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354821 16:89597376-89597398 GCGGGATGCACAGGCTGCCAGGG 0: 1
1: 0
2: 2
3: 13
4: 165
1142354807_1142354823 30 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354823 16:89597387-89597409 AGGCTGCCAGGGGCAGAGAGCGG 0: 1
1: 1
2: 7
3: 116
4: 902
1142354807_1142354812 -7 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354812 16:89597350-89597372 AGGATCCTCCCTGGACTGAATGG 0: 1
1: 0
2: 2
3: 23
4: 176
1142354807_1142354819 10 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354819 16:89597367-89597389 GAATGGGATGCGGGATGCACAGG 0: 1
1: 0
2: 1
3: 11
4: 130
1142354807_1142354817 1 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354817 16:89597358-89597380 CCCTGGACTGAATGGGATGCGGG 0: 1
1: 0
2: 1
3: 27
4: 312
1142354807_1142354815 0 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354815 16:89597357-89597379 TCCCTGGACTGAATGGGATGCGG 0: 1
1: 0
2: 0
3: 26
4: 168
1142354807_1142354822 20 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354822 16:89597377-89597399 CGGGATGCACAGGCTGCCAGGGG 0: 1
1: 1
2: 1
3: 13
4: 188
1142354807_1142354813 -6 Left 1142354807 16:89597334-89597356 CCAGGCCCAGCACACCAGGATCC 0: 1
1: 0
2: 5
3: 20
4: 327
Right 1142354813 16:89597351-89597373 GGATCCTCCCTGGACTGAATGGG 0: 1
1: 0
2: 0
3: 20
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142354807 Original CRISPR GGATCCTGGTGTGCTGGGCC TGG (reversed) Intergenic
900203659 1:1421983-1422005 GGATCCTGGGGGCCTGGGGCAGG + Intergenic
900498922 1:2990136-2990158 GGATCTTGGAATGCTGGCCCAGG - Intergenic
900640449 1:3685786-3685808 GGAAGCTGCTGTGCTGGGGCTGG + Intronic
900795026 1:4702683-4702705 GGCCCTTGGTGTGCTGGGGCAGG + Intronic
900839022 1:5032310-5032332 GGAGCCTGGTGCAGTGGGCCTGG - Intergenic
901836252 1:11925961-11925983 GGGTCCTGGAGTGCCGGCCCTGG - Exonic
902220659 1:14962509-14962531 GGATCCTGGGAAGCTGGGCGTGG - Intronic
902603063 1:17553103-17553125 GGATGCTGGGGTTCTGGTCCCGG - Intronic
902617709 1:17632907-17632929 GGAGCCTGGTTTGCTGGTTCTGG + Intronic
902988860 1:20172098-20172120 GGATCCTGGGGTCCTGGGCTGGG - Intronic
903055613 1:20633928-20633950 AGATCCAGGTGAGCGGGGCCGGG + Exonic
903071371 1:20728486-20728508 GGATCCTGGTGTTCTGGGCTGGG + Intronic
903724402 1:25430373-25430395 GGATGCTGGAGAGCTCGGCCAGG - Intergenic
903909145 1:26709487-26709509 GGAACCTGGGGTCCTGGGTCGGG - Intronic
904312193 1:29636037-29636059 GGATCCTTGAGTGCTGGGTGTGG + Intergenic
904312289 1:29636669-29636691 GGATCCATGAGTGCTGGGCCAGG - Intergenic
904988561 1:34572938-34572960 GGGACCTGGTCAGCTGGGCCGGG + Intergenic
905171863 1:36114446-36114468 GGATCCTAGTGTGTTGGGGGAGG - Intronic
906523464 1:46480295-46480317 GGATGCTGATATTCTGGGCCAGG - Intergenic
907835166 1:58101901-58101923 GGATCCAGGTTTGCAGGTCCTGG + Intronic
911149037 1:94579754-94579776 GGAGCCTGGGGTGGTGGGGCAGG - Intergenic
914748033 1:150513605-150513627 GGATCTTGGTGCCCTGGCCCAGG + Intronic
914748191 1:150514616-150514638 GGATCTTGGTGCCCTGGCCCAGG + Intergenic
917868753 1:179223220-179223242 GGGTCTTGCTGTACTGGGCCAGG - Intronic
917926500 1:179793592-179793614 GGATCCTGGTGAGATAGGTCTGG + Intronic
918431692 1:184467475-184467497 GGTTTCTGCTGTGCTGGGGCAGG - Intronic
918719633 1:187836695-187836717 GGATCGGGGTATGGTGGGCCAGG + Intergenic
919466216 1:197923323-197923345 GGCCCCTGCTGTGCTGGGGCAGG + Intronic
919934975 1:202245385-202245407 TGTTCGTGGTGGGCTGGGCCAGG + Intronic
920260037 1:204683180-204683202 GGAGCCTGGGCTGGTGGGCCTGG - Intronic
920383365 1:205548826-205548848 CGATCCTGCTGTGCTGGGGGAGG + Intergenic
920506597 1:206519442-206519464 AGATCCTGGTGTGGTGGGAATGG + Intronic
920756900 1:208741102-208741124 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
920875203 1:209828277-209828299 GGCTCCCGCTGTGCTCGGCCGGG + Intronic
923579555 1:235195300-235195322 GGATCCTGTGGGGCTGGGCGTGG + Intronic
1065435855 10:25703160-25703182 GGACCCAGTTGGGCTGGGCCTGG + Intergenic
1066392846 10:34992567-34992589 ATATCCTGGTGAGCTGGGCGCGG - Intergenic
1067448319 10:46366651-46366673 GGATCCTGGTCTGAGGGGCTGGG - Intergenic
1067589058 10:47494115-47494137 GGATCCTGGTCTGAGGGGCTGGG + Intergenic
1067636183 10:48002206-48002228 GGATCCTGGTCTGAGGGGCTGGG + Intergenic
1069825118 10:71250168-71250190 GCATCCTGGGGAGCAGGGCCTGG - Intronic
1069895763 10:71679228-71679250 GCCTCCTGGCGTCCTGGGCCAGG + Intronic
1069995768 10:72341201-72341223 GGATCCTGGGGTGCGGGGGGAGG + Intronic
1070132744 10:73666211-73666233 GGATCCTGGTCTGAGGGGCTGGG + Intergenic
1071567680 10:86680196-86680218 GGTTCCTGGAGTGCTGGCCCTGG + Intronic
1071608938 10:87017863-87017885 GGATCCTGGTCTGAGGGGCTGGG - Intergenic
1072188161 10:93061344-93061366 GGGTCCAGAGGTGCTGGGCCAGG - Exonic
1072948055 10:99828298-99828320 GGATGCTGCTGTGTTGGCCCTGG + Intronic
1073300436 10:102467982-102468004 GGATGGGGGTGTGGTGGGCCGGG + Intronic
1073352407 10:102829302-102829324 GGAGGCTGTTGTGCTGGTCCAGG - Intergenic
1073771834 10:106743357-106743379 GGATGGTGGTGTGGTGGGACTGG - Intronic
1075528155 10:123203133-123203155 GGGTCATGGTGTGCAGGGGCTGG + Intergenic
1076334997 10:129700993-129701015 AGAACCTGGTGTGGAGGGCCAGG - Intronic
1077059250 11:610527-610549 GGATGCTTGAGGGCTGGGCCGGG - Exonic
1077249287 11:1553948-1553970 AGAGCCTGGTGTGTTGGGTCTGG - Intergenic
1077298668 11:1837564-1837586 GGACCCTGGTGAGCGGGCCCGGG - Intergenic
1078606912 11:12785126-12785148 GGCTCCTGGTGGCCTGTGCCTGG + Intronic
1081589072 11:44408328-44408350 GGATACAGCTGTGCAGGGCCCGG - Intergenic
1082037411 11:47656589-47656611 AGATACTTGTGTGCTGGCCCAGG + Intergenic
1082124991 11:48421978-48422000 GGATACTGGTGGGCTGAGGCTGG + Intergenic
1083333007 11:61907722-61907744 GGAACCTGGTCCGGTGGGCCTGG - Intronic
1084206113 11:67594091-67594113 GGATATGGGTGTGGTGGGCCAGG + Intergenic
1084421413 11:69062503-69062525 GAAGCCAGGTGTGCTGGGCAAGG + Intronic
1084440463 11:69169889-69169911 GGAGGATGGGGTGCTGGGCCAGG - Intergenic
1084652669 11:70498387-70498409 GGACCCTGGTGGACTGGTCCTGG + Intronic
1086951735 11:92897693-92897715 GGATCCTGGTTGGGTGGGGCAGG - Intergenic
1087304323 11:96471278-96471300 GGATCTTGGGGTGCTGGGCCTGG - Intronic
1088314961 11:108498253-108498275 GGAGCCTGGTGTGGGGGCCCGGG - Exonic
1088737820 11:112742745-112742767 GTTTCCTGGTGTGCAGGGGCTGG + Intergenic
1088820676 11:113454031-113454053 GGACAGTGGTGTGCTGGGGCTGG + Intronic
1090456085 11:126850812-126850834 GGATCCTGGAGTACTCTGCCTGG + Intronic
1091782156 12:3220688-3220710 TGTTACTGGTGTGCTGGGCCGGG + Intronic
1091837752 12:3597659-3597681 GGCTCCTGGGCTGCAGGGCCTGG + Intergenic
1092048846 12:5453755-5453777 CATTCCTGGTCTGCTGGGCCAGG - Intronic
1092214635 12:6672429-6672451 GGATACGGAGGTGCTGGGCCAGG + Exonic
1092214776 12:6673295-6673317 GTATACGGATGTGCTGGGCCAGG + Exonic
1092372471 12:7928498-7928520 TGATCCTGTTTTGCAGGGCCTGG + Intronic
1096790764 12:54043406-54043428 GTATTCTGGTGTTCAGGGCCAGG - Intronic
1097229403 12:57500303-57500325 TGATTCTGGTGAGGTGGGCCAGG - Exonic
1102459862 12:113093548-113093570 GGATACTGCTGTGCGCGGCCGGG + Exonic
1103566821 12:121820241-121820263 AGGCCCTGGGGTGCTGGGCCAGG + Intronic
1104624204 12:130338746-130338768 GGAGCCTGGGGTGCAGGGGCCGG + Intronic
1104836441 12:131795190-131795212 TGTCCCTGGTGAGCTGGGCCCGG - Intronic
1105780416 13:23701293-23701315 GGATCGTGGTGGGCAGGACCTGG + Intergenic
1107132773 13:36914046-36914068 GGATCCTAGTGAGCTGGCCAGGG - Intronic
1108039933 13:46330677-46330699 GAATCCTGGTGAGAAGGGCCAGG - Intergenic
1108112926 13:47096062-47096084 GGATACTGGTGAGCTGGGGAAGG - Intergenic
1108322539 13:49302368-49302390 GGAGGCTCCTGTGCTGGGCCTGG + Intergenic
1111343979 13:86924779-86924801 GGATGGGGGTGTGATGGGCCAGG + Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1117281857 14:54248817-54248839 GGAACTGGGTGTGCTGGACCAGG - Intergenic
1118216066 14:63809577-63809599 GGAGCCTGGAGTGCTGGGCCTGG - Intergenic
1119724799 14:76915458-76915480 ACATCCTGGTGGGCTGGGCGCGG + Intergenic
1120860719 14:89253044-89253066 TGATCCTGGTGGACTGTGCCAGG + Intronic
1121328755 14:93036618-93036640 GGCCCCTGGGGTGCTGAGCCTGG - Intronic
1121475696 14:94199920-94199942 GGATGAGGGTGTGGTGGGCCAGG + Intronic
1121511289 14:94515069-94515091 GGGTCAGGGTGTGCTAGGCCTGG + Intronic
1122742448 14:103880112-103880134 GGTTCCTGTTGGGCGGGGCCTGG + Intergenic
1122790911 14:104183813-104183835 GGATCTTGCTGGGCTGTGCCGGG + Intergenic
1123110627 14:105865358-105865380 GGAGCCAGGTGTACTGGGCCAGG - Intergenic
1128606492 15:69040073-69040095 GGGTCCTGCTGGGCTGGGTCTGG - Intronic
1129232813 15:74206123-74206145 GGTTACTGGTGTGCAGGGACGGG - Intronic
1129394061 15:75234764-75234786 GGATTAGGGTGGGCTGGGCCTGG - Intergenic
1130353764 15:83112177-83112199 GGATGCTGGTCTGTTGGCCCTGG + Intronic
1130580710 15:85134863-85134885 AGAGCCTGAGGTGCTGGGCCAGG + Intronic
1131588064 15:93717520-93717542 GGATCCAGGTAAGCTGGGCCTGG + Intergenic
1132002658 15:98195621-98195643 GGAGCTTGGTGAGGTGGGCCAGG + Intergenic
1132623653 16:879861-879883 GGCTCCACGTGTGCAGGGCCAGG - Intronic
1132871812 16:2118729-2118751 GCAGCCACGTGTGCTGGGCCTGG - Exonic
1133096343 16:3449226-3449248 GTAGCCGGGTGTGCTGGGCGTGG + Intronic
1134520716 16:14918167-14918189 GCAGCCACGTGTGCTGGGCCTGG + Intronic
1134708388 16:16316818-16316840 GCAGCCACGTGTGCTGGGCCTGG + Intergenic
1134715603 16:16356851-16356873 GCAGCCACGTGTGCTGGGCCTGG + Intergenic
1134951214 16:18351827-18351849 GCAGCCACGTGTGCTGGGCCTGG - Intergenic
1134959154 16:18395308-18395330 GCAGCCACGTGTGCTGGGCCTGG - Intergenic
1136061971 16:27732786-27732808 GGAGCCAGGGGTTCTGGGCCAGG - Intronic
1138515435 16:57533331-57533353 GATTCCTGGTGTGCTGGGGGCGG - Intronic
1139778814 16:69334182-69334204 GGACCCGGTTGTGCTGTGCCTGG + Intronic
1141202771 16:81910529-81910551 GGATCCGGCAGTGCTGGACCCGG - Exonic
1141849825 16:86637531-86637553 GCTTCATGGTTTGCTGGGCCAGG + Intergenic
1142108614 16:88319340-88319362 GGCTCCTCGTCTGCAGGGCCAGG + Intergenic
1142354640 16:89596762-89596784 GGATCCTGCTGGCTTGGGCCCGG + Exonic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1142382238 16:89739497-89739519 GCAGCCTGGTGTGCTGATCCGGG + Exonic
1143587337 17:7856805-7856827 GGAGCCCCGTGTGCTGGGCCTGG - Exonic
1143645209 17:8225557-8225579 GGATCCTGGTGTGGAAGGGCAGG - Intergenic
1143779549 17:9222095-9222117 GGATTCAGGAGTCCTGGGCCTGG - Intronic
1143886963 17:10072135-10072157 GGATCCTGGTTTAATGGGACAGG - Intronic
1144269013 17:13600477-13600499 GGATCCGGGGGTCCTGGGCTGGG - Intronic
1144779975 17:17803134-17803156 TGCTTCTGGTGTGCTGGGCGTGG - Intronic
1144784473 17:17823992-17824014 GAGTTCTGGTGTGTTGGGCCAGG - Intronic
1145783283 17:27577819-27577841 GGATCCTGGTGGGTCTGGCCAGG + Intronic
1146635083 17:34498007-34498029 GCACCATGCTGTGCTGGGCCTGG - Intergenic
1146668995 17:34723985-34724007 GGCACCTGGTGTGCTGGGGTGGG - Intergenic
1147214045 17:38888883-38888905 GGACCAGGCTGTGCTGGGCCTGG + Intronic
1147319160 17:39635764-39635786 GGATCTTGGTGGGTGGGGCCAGG + Intronic
1147619882 17:41858862-41858884 GGAGGCTGGTGGGCTGGGCATGG - Intronic
1147998624 17:44375144-44375166 GGATGATGGGGTGATGGGCCGGG - Intronic
1151527589 17:74681541-74681563 GGATCCTGGTGTTTTGGGTTTGG - Intronic
1151786653 17:76278490-76278512 GGTTCCAGGTATGCTAGGCCAGG - Intronic
1151803982 17:76394142-76394164 GGATGCTGTTGAGATGGGCCCGG - Intronic
1152019108 17:77771281-77771303 GGGTCCCGCTGTGGTGGGCCGGG - Intergenic
1152091176 17:78248736-78248758 AGCTCCTGGAGTCCTGGGCCAGG + Intergenic
1152970811 18:159024-159046 GTGTCCTGGGGCGCTGGGCCAGG + Intronic
1153044777 18:845699-845721 GAATCCTGGTGTGCAGAGGCTGG + Intergenic
1153766627 18:8380864-8380886 GGCTCCCGGTGAGCTGTGCCAGG - Intronic
1154084557 18:11290377-11290399 GGAAGGTGGTGTGCTGGGGCAGG - Intergenic
1154193854 18:12252091-12252113 GAATCCTGGAGTGCTGCGCTAGG - Intergenic
1157002351 18:43542210-43542232 GTATCCTGGTGTTCTTGCCCTGG + Intergenic
1158494471 18:57942128-57942150 GCATCCTGGGGTCCAGGGCCAGG + Intergenic
1158583020 18:58702124-58702146 GGAAGCTGGGGTGCTGGGGCGGG + Intronic
1159040213 18:63318099-63318121 GGATCCAGGTGTGCAGGTGCCGG + Exonic
1159314485 18:66753852-66753874 GGAGCCTGCTAAGCTGGGCCTGG + Intergenic
1159416202 18:68152481-68152503 GGATAGGGGTGTGGTGGGCCAGG - Intergenic
1159957885 18:74532725-74532747 GGGAGCTGCTGTGCTGGGCCTGG + Intergenic
1160154351 18:76422224-76422246 GTCTCCTGGTTTGCTGGGTCAGG - Intronic
1161256460 19:3312700-3312722 GGCTCCTGGAGGGCAGGGCCCGG - Intergenic
1161452455 19:4354154-4354176 AGATCCAGGTGAGCTGGGGCAGG - Intronic
1164897471 19:31889902-31889924 GGATCCTGATGGGCTGGACTTGG - Intergenic
1165150050 19:33754864-33754886 AGATCCTGCTCTGCAGGGCCAGG + Intronic
1165797390 19:38526899-38526921 AGTTCCTGGGGTGCTGGGCCTGG + Intronic
1165899630 19:39163052-39163074 GGAGCCTGCTGTGCCGGGACGGG + Intronic
1166769047 19:45269556-45269578 GGATGCTGGTGACCTGGGCGAGG + Intronic
1167002104 19:46751855-46751877 GCATCTTGGTGGGCTGGGCATGG - Intronic
1167321556 19:48799895-48799917 GGGTCCTGGAGGCCTGGGCCTGG - Intronic
1167357392 19:49012246-49012268 GGATGCTGGGCCGCTGGGCCTGG + Intronic
1167723942 19:51198652-51198674 GGGTCGTGGGGTCCTGGGCCTGG + Intergenic
1168558800 19:57365892-57365914 GGCTCCTGTTGTGCAGGGGCTGG + Intronic
1168681603 19:58319901-58319923 GGATCTTGAGGTGCTGGGTCAGG - Intergenic
926683859 2:15683099-15683121 GGGCCGTGGAGTGCTGGGCCTGG - Intergenic
926801653 2:16665325-16665347 GGGTCCAGGTGTGCAGGGGCTGG + Intronic
928025856 2:27738027-27738049 GGGGCCTGGAGTGCTGGGCCTGG + Intergenic
929920483 2:46167904-46167926 GGAGCCTGCTGTGCTGGAACAGG - Intronic
932369043 2:71172672-71172694 TGATCCTGGTGTGCAAAGCCTGG - Intergenic
932412541 2:71555811-71555833 AGACCCTGGTTTGTTGGGCCTGG + Intronic
932760450 2:74436173-74436195 GGATCCGTGAGTGCTGGGACTGG - Intronic
934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG + Intergenic
935087240 2:99859874-99859896 GGAGCCTGGTCTGCTAGGACTGG - Intronic
935566935 2:104619021-104619043 GGCAACTGGTGTGCTGGGCGTGG - Intergenic
936052285 2:109233499-109233521 GGATGGGGGTGTGGTGGGCCAGG + Intronic
938376956 2:130814306-130814328 ACATCCTGCTTTGCTGGGCCTGG + Intergenic
942316668 2:174702710-174702732 GGAGCCTGGTGTGGTGGTGCCGG - Intergenic
943404366 2:187461600-187461622 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
944801883 2:203244492-203244514 GAAAACTGCTGTGCTGGGCCGGG - Intronic
946852430 2:223920237-223920259 GGTCACTGGTGTGCTGGCCCTGG - Intronic
947915819 2:233831040-233831062 AGATGCTGGTGGACTGGGCCTGG + Intronic
948483367 2:238264267-238264289 GGATCTTGGAGGGCAGGGCCTGG - Intronic
948744330 2:240075359-240075381 AGATCCTAATGAGCTGGGCCTGG - Intergenic
948795945 2:240402165-240402187 GAATCCTGGGGTGCAGGGACAGG - Intergenic
1169084320 20:2817190-2817212 GGTTCCTGGTGTGAGGGGCTGGG + Intronic
1169852162 20:10064169-10064191 GGACCCTGGGGGGCTGTGCCTGG - Intergenic
1170138889 20:13105305-13105327 GAATCCTGGTGTGTTGACCCTGG + Intronic
1170217271 20:13904917-13904939 GGATCCTTTTGTGCGGTGCCTGG + Intronic
1173421428 20:42904701-42904723 GGATGGGGGTGTGGTGGGCCAGG - Intronic
1174461822 20:50688741-50688763 GGACGCTGCTGTGCTGGGCAGGG + Intronic
1176051185 20:63120544-63120566 GGGTCCTGAGGTGCTGAGCCTGG - Intergenic
1177317198 21:19477384-19477406 GAAACATGGTTTGCTGGGCCAGG - Intergenic
1177445695 21:21192865-21192887 TGAACCTGGTGTTCTGGTCCAGG - Intronic
1178491081 21:33052287-33052309 GGATCTGGGTCTGCTGGGCCAGG + Intergenic
1179155930 21:38851353-38851375 AGAAACTGGTGTGCTGGGGCAGG + Intergenic
1179444252 21:41420391-41420413 GGACCCGGTTCTGCTGGGCCGGG - Intronic
1179556542 21:42182152-42182174 GAATCCAGGTCTGCTGGCCCTGG + Intergenic
1180060946 21:45384734-45384756 TGACCTTGGTGTGCTCGGCCTGG + Intergenic
1180831789 22:18910444-18910466 GGTGCCAGGTGTGCTGGGACTGG + Intronic
1181467058 22:23115972-23115994 CCTTCCTGGTGTGCTTGGCCTGG - Intronic
1181620146 22:24085423-24085445 GGACCCTGGTGTGCAGGGCAAGG + Intronic
1181629877 22:24145159-24145181 GGACCCTGTTTTCCTGGGCCAGG + Intronic
1182777011 22:32838717-32838739 GCTTCCTGGAGTGCTGGGTCAGG - Intronic
1182900425 22:33894021-33894043 GCATCCAGGTCTGCAGGGCCGGG - Intronic
1182994653 22:34801210-34801232 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1183537855 22:38413529-38413551 GGGTCCCGCTCTGCTGGGCCAGG - Intergenic
1183934868 22:41256327-41256349 AGAACCTGGTGTCCTGGCCCGGG - Intronic
1184826656 22:46957144-46957166 GGCACCAGGTGTGATGGGCCAGG + Intronic
1184852731 22:47130027-47130049 GGCTCCTGGGGTGGTGTGCCTGG + Intronic
1184934226 22:47707208-47707230 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
1185081820 22:48713745-48713767 GGATCCTGGTGGCCTGGACAAGG - Intronic
1185183898 22:49381165-49381187 GGATGGTGGTGTGCTGAGGCCGG - Intergenic
1185306721 22:50121744-50121766 GGACCCAGGTCTGCTGGGCTTGG + Intronic
1203281869 22_KI270734v1_random:135715-135737 GGTGCCAGGTGTGCTGGGACTGG + Intergenic
950484264 3:13263821-13263843 GGATCCTGGAGCGCCGGGCTGGG + Intergenic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
951229433 3:20159970-20159992 GGAGCCTGGCCTTCTGGGCCAGG + Intergenic
952564258 3:34635647-34635669 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
952875516 3:37941365-37941387 GCATCTTTGTGTGCTGGGACCGG + Intronic
952962943 3:38604207-38604229 GGAACCAGGTGGGTTGGGCCGGG + Intronic
953390776 3:42532474-42532496 GGATGGTGGTGGGCTGAGCCAGG - Intronic
953916888 3:46926091-46926113 GCATCTGGGTGTGCTGGGCCAGG + Intronic
954408187 3:50357031-50357053 GGGGCCAGGTGAGCTGGGCCTGG - Intronic
954663409 3:52237880-52237902 GGATCCTAGTGTGGTGGGAGGGG + Intronic
955046914 3:55369511-55369533 AGATCCTGGAGTCCTGGGCCTGG + Intergenic
955224700 3:57051092-57051114 GGATTTTGGGGTGCTGTGCCTGG - Intronic
956496523 3:69832147-69832169 GCATTCTGGAGTGCTGGGCTGGG + Intronic
956747671 3:72322474-72322496 GGAGCCTGGTGTCCTGGGTTGGG - Intergenic
958154886 3:89743863-89743885 GGATCCAGGAGTGCTGCGGCAGG - Intergenic
960715167 3:120568098-120568120 GGATGCTGCTGTGCTGGTCAGGG - Intergenic
961222356 3:125211364-125211386 GGATCCTGGTGATCTGGACAGGG + Exonic
966882869 3:184359841-184359863 GGATGCTGGGGTGATGGGACGGG + Intronic
968085204 3:195871033-195871055 GGGTTCTGGTGTGTGGGGCCCGG + Intronic
969297303 4:6277644-6277666 GGCTCCTGGTATGCTGGGCCTGG - Exonic
969612055 4:8232868-8232890 GGATGCTGCTCTGCTGGTCCAGG - Intronic
969682856 4:8652799-8652821 GGGACATGGTGTTCTGGGCCGGG - Intergenic
972561747 4:40234883-40234905 AGATGCTGGTTTGCTTGGCCAGG - Intronic
972797871 4:42440203-42440225 AGATCATGGTGTGTGGGGCCCGG - Intronic
973238031 4:47927025-47927047 GGATACAGGTGAGCTGTGCCTGG - Intronic
975428051 4:74253793-74253815 GGGTCCTGGTGTTCTGGTGCTGG - Intronic
977148597 4:93479638-93479660 GGATCCTGATGTCCAGGGGCAGG + Intronic
980100742 4:128539149-128539171 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
980485385 4:133450867-133450889 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
984643498 4:182196518-182196540 GGCGCCTGGTGTCCAGGGCCAGG - Intronic
985024413 4:185725870-185725892 GGATCATGTTGTGTTGGGCTTGG - Intronic
985727282 5:1523178-1523200 TGAGCCTCGTGTGCGGGGCCTGG - Intronic
985850711 5:2387212-2387234 GGGTCCAGGTGAGCTGGGCAGGG + Intergenic
985908808 5:2863436-2863458 GGAGCCTGGTGTCCTGGCACTGG + Intergenic
989558563 5:42825396-42825418 GGATGGGGGTGTGGTGGGCCAGG - Intronic
990368792 5:55095899-55095921 GGATCCTGGTGCAGTGGGGCAGG - Intergenic
991292774 5:65048805-65048827 GGATCCTGGAAAGATGGGCCAGG - Intergenic
997354972 5:133256511-133256533 GTATCCTGGTGAGCCGGGCAAGG + Intronic
997526229 5:134554997-134555019 GGGGCCTAGTGGGCTGGGCCAGG + Intronic
997870483 5:137501380-137501402 GGGTCCAGATGTGCGGGGCCTGG - Intronic
998340954 5:141417725-141417747 GCAATCTGGTGTGCTGGGCAAGG - Exonic
998665169 5:144288677-144288699 GCATCCTGGTTGGCTGGGCATGG + Intronic
999211878 5:149896696-149896718 AGATCCTGGTGAGCTGAACCGGG - Exonic
999307595 5:150530172-150530194 GGAGCCTGGAGGGCTGAGCCTGG - Intronic
999366389 5:151026451-151026473 GGAAACTGGGGAGCTGGGCCAGG + Intronic
1000018991 5:157302863-157302885 TGATCCTGTTGTGGTTGGCCAGG - Exonic
1000875386 5:166631545-166631567 GGATTCTGTTGGGCTTGGCCCGG + Intergenic
1001677479 5:173530681-173530703 GGATGCTGATCTGCTGGTCCAGG + Intergenic
1002181446 5:177433075-177433097 GGCTCTTGGCTTGCTGGGCCAGG - Intronic
1002374919 5:178781892-178781914 GTCTCCTGCTGTGCTGTGCCTGG - Intergenic
1002668885 5:180848995-180849017 GGATCCTTTTGTGCTGGTCAAGG + Exonic
1003147484 6:3520879-3520901 AGACCCTGCTGTGCTGGGCTGGG + Intergenic
1003844513 6:10159118-10159140 GGCATCTGGTGTGCTGCGCCAGG + Intronic
1006378563 6:33684936-33684958 AGATCCAGGTGTGGGGGGCCTGG + Exonic
1007400825 6:41601330-41601352 GCAGGCTGGTGTGCTGGGGCTGG - Exonic
1007730098 6:43940383-43940405 TGGTCCTGGTGCTCTGGGCCAGG - Intergenic
1010461665 6:76120694-76120716 GGACACTAGTGTGGTGGGCCAGG + Intergenic
1010499697 6:76582303-76582325 TGTTCCTGGGGTTCTGGGCCAGG - Intergenic
1011402790 6:86982050-86982072 AGAACCAGGTGGGCTGGGCCTGG + Intronic
1014681516 6:124436704-124436726 AGATCCTGGTGGCCTGGACCAGG - Intronic
1016450733 6:144179663-144179685 GCATCCTGGTGAGCTGAGCATGG - Intronic
1017824046 6:158068733-158068755 GGGGCCAGGTGTGCGGGGCCAGG + Intronic
1018173572 6:161160920-161160942 GGGTGCTGGGGTGCTGGGCGAGG - Intronic
1018754356 6:166836994-166837016 AAATCCCGCTGTGCTGGGCCAGG - Intronic
1019291034 7:250407-250429 GATTCCTGGTGTGTAGGGCCAGG - Intronic
1019299361 7:295717-295739 GGCCCCTGGTGGGCTGGGACTGG + Intergenic
1019377188 7:699099-699121 GGCCCCTGGCGTGCTGGGGCAGG - Intronic
1019418499 7:937890-937912 AGATCCGGGGGTGCTGGGTCTGG - Intronic
1019771163 7:2884322-2884344 GGGTCCAGGTGGGCTGAGCCCGG - Intergenic
1019906251 7:4067366-4067388 GGAGCCTGGAGTTCTGGACCAGG + Intronic
1019912733 7:4110562-4110584 GGTACCTGGTGAGCTGGGCAGGG - Intronic
1021180071 7:17495802-17495824 ATATTTTGGTGTGCTGGGCCTGG + Intergenic
1021906401 7:25338521-25338543 GGTGACTGGTGTGGTGGGCCTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023844295 7:44112371-44112393 GGGTCCTGGTGTTCTGGGCTTGG + Intronic
1024243467 7:47452924-47452946 GGAACTTACTGTGCTGGGCCTGG + Intronic
1024313547 7:47992022-47992044 AGCTCATGGTGTGGTGGGCCAGG + Intronic
1024736990 7:52316073-52316095 GGATCCTGGGGAGTTGGGTCAGG + Intergenic
1025201272 7:56963254-56963276 AGATTCTGGTGTCTTGGGCCAGG + Intergenic
1025670672 7:63613679-63613701 AGATTCTGGTGTCTTGGGCCAGG - Intergenic
1025818539 7:64942709-64942731 GGTTCCTGCTGTGCTCGGCTGGG - Intergenic
1026131803 7:67627123-67627145 AGAACCTTGTGTGCTGAGCCTGG + Intergenic
1028384038 7:90233539-90233561 GGATTCTGATGTGCTAGGCATGG + Exonic
1029375421 7:100174378-100174400 GGATCCTGGGGGGTTGGGCGGGG + Intronic
1029457427 7:100678322-100678344 GGAGCCTGGTGGGGAGGGCCTGG - Intronic
1031026548 7:116685978-116686000 GGACCCTGGTGGCCTGGGCCAGG - Intronic
1032847246 7:135762126-135762148 GTAGGCTGGTGGGCTGGGCCGGG - Intergenic
1033333728 7:140435344-140435366 GGGACCTGGTGAGCTGGGCACGG - Intergenic
1033582839 7:142752459-142752481 GGATGCTCCTGTGCTGAGCCAGG + Exonic
1033585862 7:142773947-142773969 GGATGCTCCTGTGCTGAGCCAGG + Intergenic
1034099068 7:148436159-148436181 GGAGCCAGGTGTGCTGGGTGTGG - Intergenic
1034272633 7:149810864-149810886 GGCTCCAGATGGGCTGGGCCTGG - Intergenic
1035421414 7:158731846-158731868 GGATCCTGGAGTGCTGAGTGTGG + Exonic
1036194209 8:6699740-6699762 GCCTCCTGGTGTGCTGGGAAGGG + Intergenic
1036438713 8:8760659-8760681 GGATCAAGGTGTGCTGGCACTGG + Intergenic
1037124208 8:15325588-15325610 GAATCCTGTTGGGCTGTGCCTGG - Intergenic
1037741791 8:21614347-21614369 GGCTGCGGGTGTGCTGTGCCTGG - Intergenic
1041948715 8:63476071-63476093 TGAACCTGGTGGGCTGGGCCTGG + Intergenic
1043376123 8:79651813-79651835 GCATCCTGCTTTGCTGAGCCTGG - Intronic
1043858199 8:85286056-85286078 GGGTTCTGGTGTCCTGGGCTAGG + Intergenic
1044844569 8:96367339-96367361 GGACCCAGTTATGCTGGGCCTGG + Intergenic
1045655566 8:104383172-104383194 GGATTCTGATGTGCCTGGCCTGG - Intronic
1045942461 8:107755145-107755167 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1047642212 8:126832873-126832895 GGATCAGGCTGTGCTGGGACTGG - Intergenic
1049385911 8:142342889-142342911 AGCTCCTGATGTGGTGGGCCCGG - Intronic
1049385938 8:142343018-142343040 AGCTCCTGCTGTGGTGGGCCCGG - Intronic
1049470950 8:142774780-142774802 TGCCCCTGGTGTGCTGGGGCAGG - Intronic
1049745246 8:144260510-144260532 GGCTGCTGCTTTGCTGGGCCTGG + Intronic
1053368560 9:37541670-37541692 GCAGCCTGGTATGCAGGGCCTGG - Exonic
1055513688 9:77017734-77017756 GGATCCTGGTGTGATCTGCGAGG - Intergenic
1055734419 9:79312329-79312351 GGATGGGGGTGTGGTGGGCCAGG - Intergenic
1060281240 9:122216992-122217014 GGTTCCTGGGGTGCTGGGGTGGG + Intronic
1060529455 9:124339834-124339856 GGGGCCTGGTCTGCAGGGCCAGG + Intronic
1060651582 9:125332025-125332047 GAGGCCTGGTGTGCTGGGGCGGG - Exonic
1060994996 9:127870856-127870878 GCATCCTGGTGGGCTGGGGCAGG - Intronic
1060995171 9:127871779-127871801 GGATCCTGGTGGGCTGGGGCAGG - Intronic
1061869202 9:133511204-133511226 GGATCCTGCAGTGGTGGGCAGGG + Intergenic
1062320222 9:135986979-135987001 GGATCCCGGCTTGCTGGGCCTGG - Intergenic
1062434422 9:136540418-136540440 GCTGCCTGGTGGGCTGGGCCTGG - Intronic
1062526420 9:136979717-136979739 GAATCCTGGTTTTCTGAGCCTGG + Intronic
1062627277 9:137448963-137448985 GGCTGCTGGGCTGCTGGGCCGGG + Exonic
1186510591 X:10127121-10127143 GCAACCTGGAGTGCTGGGCCAGG - Intronic
1186782015 X:12922318-12922340 GGACCCAGTTATGCTGGGCCTGG - Exonic
1189048281 X:37616805-37616827 TGATACTGATGTGCTGGCCCAGG - Intronic
1189712504 X:43827765-43827787 GGACCAGGGTGAGCTGGGCCAGG + Intronic
1190213635 X:48466642-48466664 GGGTTCTGGGGTGCTGGGTCCGG + Intronic
1190259434 X:48788735-48788757 GGAGCCTGGAATGCTGGCCCTGG - Intronic
1191766631 X:64705425-64705447 GGATGGGGGTGTGGTGGGCCAGG + Intergenic
1192796424 X:74427318-74427340 GGATCCTGCTGTGGTGGGGTTGG + Intronic
1194748633 X:97658616-97658638 GCTTACTGGCGTGCTGGGCCTGG - Intergenic
1195681205 X:107547901-107547923 GGATCCGGGGCCGCTGGGCCTGG + Intronic
1199942140 X:152637648-152637670 GGCTCCTTGGGGGCTGGGCCAGG - Intergenic
1200253008 X:154563821-154563843 GGCTCCTGGTGTTCTGGGTTAGG + Intronic
1200264759 X:154640594-154640616 GGCTCCTGGTGTTCTGGGTTAGG - Intergenic