ID: 1142356225

View in Genome Browser
Species Human (GRCh38)
Location 16:89603473-89603495
Sequence GGGGCTGGAGGGAGGCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142356213_1142356225 -1 Left 1142356213 16:89603451-89603473 CCCACTGTGCAGAGAAGCACTGG No data
Right 1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG No data
1142356215_1142356225 -2 Left 1142356215 16:89603452-89603474 CCACTGTGCAGAGAAGCACTGGG No data
Right 1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG No data
1142356211_1142356225 22 Left 1142356211 16:89603428-89603450 CCACCAGGACAGTACATTATCAT No data
Right 1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG No data
1142356212_1142356225 19 Left 1142356212 16:89603431-89603453 CCAGGACAGTACATTATCATCCC No data
Right 1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG No data
1142356210_1142356225 30 Left 1142356210 16:89603420-89603442 CCATTACTCCACCAGGACAGTAC No data
Right 1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142356225 Original CRISPR GGGGCTGGAGGGAGGCACTG GGG Intergenic
No off target data available for this crispr