ID: 1142356765

View in Genome Browser
Species Human (GRCh38)
Location 16:89605041-89605063
Sequence GAAGGCTCTGCGGAGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142356761_1142356765 -10 Left 1142356761 16:89605028-89605050 CCAAGGAGACCATGAAGGCTCTG No data
Right 1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG No data
1142356757_1142356765 20 Left 1142356757 16:89604998-89605020 CCTAGGCGGCCAGGTTGGTGGGA No data
Right 1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG No data
1142356758_1142356765 11 Left 1142356758 16:89605007-89605029 CCAGGTTGGTGGGATGCATTGCC No data
Right 1142356765 16:89605041-89605063 GAAGGCTCTGCGGAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142356765 Original CRISPR GAAGGCTCTGCGGAGGCCCC AGG Intergenic
No off target data available for this crispr