ID: 1142357989

View in Genome Browser
Species Human (GRCh38)
Location 16:89612940-89612962
Sequence AACAGATGGTGAGAATATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142357985_1142357989 8 Left 1142357985 16:89612909-89612931 CCCACGGTATTTATTGGTAATGC No data
Right 1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG No data
1142357983_1142357989 22 Left 1142357983 16:89612895-89612917 CCGAGCTCTGGGAGCCCACGGTA No data
Right 1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG No data
1142357986_1142357989 7 Left 1142357986 16:89612910-89612932 CCACGGTATTTATTGGTAATGCA No data
Right 1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG No data
1142357982_1142357989 23 Left 1142357982 16:89612894-89612916 CCCGAGCTCTGGGAGCCCACGGT 0: 6
1: 31
2: 108
3: 287
4: 3724
Right 1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142357989 Original CRISPR AACAGATGGTGAGAATATGG AGG Intergenic
No off target data available for this crispr