ID: 1142358323

View in Genome Browser
Species Human (GRCh38)
Location 16:89614378-89614400
Sequence CCCGGACTTACTCTCTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142358315_1142358323 21 Left 1142358315 16:89614334-89614356 CCTCCAGGAAGAGTTCTCAGAGG 0: 1
1: 0
2: 4
3: 22
4: 249
Right 1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1142358317_1142358323 18 Left 1142358317 16:89614337-89614359 CCAGGAAGAGTTCTCAGAGGCTG 0: 1
1: 0
2: 1
3: 18
4: 252
Right 1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1142358313_1142358323 26 Left 1142358313 16:89614329-89614351 CCCTTCCTCCAGGAAGAGTTCTC 0: 1
1: 0
2: 11
3: 67
4: 379
Right 1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1142358314_1142358323 25 Left 1142358314 16:89614330-89614352 CCTTCCTCCAGGAAGAGTTCTCA 0: 1
1: 0
2: 3
3: 50
4: 348
Right 1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 69
1142358312_1142358323 27 Left 1142358312 16:89614328-89614350 CCCCTTCCTCCAGGAAGAGTTCT 0: 1
1: 0
2: 21
3: 162
4: 757
Right 1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG 0: 1
1: 0
2: 0
3: 1
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142358323 Original CRISPR CCCGGACTTACTCTCTGTTC TGG Intronic
900399808 1:2468266-2468288 CCTGGAGTTACACTCTGGTCTGG + Intronic
902310057 1:15575262-15575284 CCCTCACTTACTCTGTCTTCTGG - Intronic
903957598 1:27035921-27035943 CCCGGGCTTCCTCTCTGAGCAGG + Intergenic
909960868 1:81840462-81840484 TAAGGACTTACTCTGTGTTCAGG + Intronic
922709878 1:227818917-227818939 CTCTGTCTTACTCTCTGTTATGG + Intronic
1065630726 10:27678223-27678245 CCTTGACTTGTTCTCTGTTCTGG - Intronic
1073054140 10:100688376-100688398 CCCTGGCTGACTCTCAGTTCCGG - Intergenic
1074034199 10:109721551-109721573 TCTGGACTGACTCTCTGTCCTGG + Intergenic
1080340662 11:31259843-31259865 CCCTCACTTAGTCTCTGTTATGG + Intronic
1080895863 11:36448399-36448421 ACCTGACTTACTCACTTTTCTGG + Intronic
1089749479 11:120640259-120640281 TCCCAACTTACTCTATGTTCAGG + Intronic
1091172643 11:133532041-133532063 ACGGGATTTGCTCTCTGTTCCGG - Intronic
1093321241 12:17718170-17718192 CCAGGCCTGAGTCTCTGTTCAGG + Intergenic
1112921520 13:104618594-104618616 CCAGGACACACTCTCTTTTCAGG + Intergenic
1113898245 13:113779453-113779475 CCCGGAAGCACTCTCTGTTTTGG + Intronic
1113898260 13:113779531-113779553 CCCGGAAGTGCTCTCTGTTTTGG + Intronic
1117780758 14:59229545-59229567 CACTGACTTACTATCTGTCCTGG + Intronic
1122061342 14:99138625-99138647 CCCCGACTGAATCTGTGTTCAGG - Intergenic
1122574402 14:102732619-102732641 CCCTGACTTATTCTTTGTTTTGG + Intergenic
1125170493 15:36761509-36761531 CCCTGATTTCCTCTCTTTTCTGG - Intronic
1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG + Intronic
1144625138 17:16840588-16840610 CCCAGACTTACTCTTTATGCTGG + Intergenic
1144881293 17:18432133-18432155 CCCAGACTTACTCTTTATGCTGG - Intergenic
1145150939 17:20512253-20512275 CCCAGACTTACTCTTTATGCTGG + Intergenic
1145868000 17:28253094-28253116 CCCCCACCTTCTCTCTGTTCCGG - Intergenic
1147579288 17:41619285-41619307 CCCAGACTTACTCTTTATGCCGG + Intergenic
1168700775 19:58438200-58438222 CCTAGACCTACTCTCTGCTCAGG + Intronic
929412094 2:41708295-41708317 CCCAGACTTACCCTGTGTCCTGG - Intergenic
929819761 2:45263705-45263727 CCCGAACTTGCTCTATGCTCAGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
939070645 2:137537018-137537040 ACCCTACTAACTCTCTGTTCTGG + Intronic
939484525 2:142793675-142793697 CCCGTGCTTACTCTCTCCTCAGG - Intergenic
943920676 2:193703565-193703587 CCCTGACTAACTCTATGTTAGGG + Intergenic
947731669 2:232434775-232434797 CCCTGACTGACTGTCTGATCTGG + Intergenic
948884139 2:240874566-240874588 CCCCGAAGTCCTCTCTGTTCTGG - Intronic
1174144662 20:48443341-48443363 CCAGGACATGCTCTTTGTTCTGG - Intergenic
1174489158 20:50880037-50880059 CCCTGAGTCACTCGCTGTTCAGG - Intronic
1181625575 22:24120104-24120126 GCCCTGCTTACTCTCTGTTCTGG + Intronic
1182428745 22:30288322-30288344 CCTGGTCTTACTCTCTGGTTTGG - Intronic
950074566 3:10178013-10178035 CCCTGAGTTACTCACAGTTCAGG - Exonic
952841783 3:37652635-37652657 CCTGGACTTATTCTCTGGGCAGG + Intronic
962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG + Intronic
963836354 3:150061721-150061743 CCCTGACCTACTCTCTGAGCCGG + Intergenic
966438697 3:179919395-179919417 CCCAGACTTACTCCTTGTTAGGG + Intronic
977857728 4:101914239-101914261 CCCGGGCTATCTCTGTGTTCTGG - Intronic
979416374 4:120445344-120445366 GCCTGACATTCTCTCTGTTCTGG + Intergenic
984151849 4:176143172-176143194 CCCGGCCTTACACGCTGTTAAGG + Intronic
987967147 5:24892051-24892073 CCCGGAATTAATGTCAGTTCAGG - Intergenic
989565783 5:42899429-42899451 CCCAGACTTGCTCTCGGTTCAGG + Intergenic
989573818 5:42971015-42971037 CCCAGGCTTGCTCTCGGTTCAGG - Intergenic
990938674 5:61177815-61177837 CCCGGAATGACTCCCAGTTCTGG + Intergenic
992323584 5:75638101-75638123 ACAGGACTTGATCTCTGTTCTGG - Intronic
992645458 5:78807480-78807502 CCCGGGCTTAGGCTCTGTTGAGG - Intronic
1003163465 6:3655869-3655891 CCCGGGCTTTCTCCCTGTCCAGG + Intergenic
1004498080 6:16183452-16183474 CCTTGACTTACTCTATGTTTGGG - Intergenic
1009614277 6:65985091-65985113 CCAGAACTTACCCTCTGTTGAGG + Intergenic
1014198033 6:118580883-118580905 CCCGGAGGAACCCTCTGTTCAGG - Intronic
1016452381 6:144196389-144196411 CCCTGACTTACTTTCTGTCTAGG - Intergenic
1024228541 7:47346636-47346658 CCCAGACTCACTCTCAGTGCTGG + Intronic
1025087304 7:56033950-56033972 CCGGGACTTACCCTGTGTCCTGG + Exonic
1034672291 7:152867968-152867990 CCCTGACGTGCTCTCTGGTCTGG + Intergenic
1038395948 8:27245558-27245580 CCAGGCCTGCCTCTCTGTTCAGG - Intronic
1040707044 8:50141216-50141238 CCTGCACTTACTATCTGATCTGG - Intronic
1041425015 8:57710932-57710954 CACAGTTTTACTCTCTGTTCTGG - Intergenic
1045512866 8:102827182-102827204 TCCTAACTTACTCTGTGTTCAGG - Exonic
1047888653 8:129281659-129281681 CTCGGCCTTCCTCTCTGTTTTGG + Intergenic
1052965159 9:34334996-34335018 CCTGTACTTTCTCTCTGATCTGG + Intronic
1058369555 9:104249446-104249468 GCTGGACTTTCTGTCTGTTCTGG + Intergenic
1061218966 9:129237834-129237856 CCAGGGCTTGCTCTCTGTACTGG + Intergenic
1185749228 X:2597293-2597315 CCCGGCCTTCCTCACTCTTCCGG - Intergenic
1199090052 X:143680929-143680951 CCCTAACCTACTCTCTGTCCAGG - Intergenic