ID: 1142363048

View in Genome Browser
Species Human (GRCh38)
Location 16:89636257-89636279
Sequence TGTACACGGACCAGAACTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142363048_1142363056 15 Left 1142363048 16:89636257-89636279 CCCACAGTTCTGGTCCGTGTACA 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1142363056 16:89636295-89636317 AGAACAAAGACGCCGTGCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 39
1142363048_1142363054 12 Left 1142363048 16:89636257-89636279 CCCACAGTTCTGGTCCGTGTACA 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1142363054 16:89636292-89636314 CCCAGAACAAAGACGCCGTGCGG 0: 1
1: 0
2: 0
3: 7
4: 69
1142363048_1142363057 22 Left 1142363048 16:89636257-89636279 CCCACAGTTCTGGTCCGTGTACA 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1142363057 16:89636302-89636324 AGACGCCGTGCGGAGGACGCTGG 0: 1
1: 0
2: 1
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142363048 Original CRISPR TGTACACGGACCAGAACTGT GGG (reversed) Exonic
900250921 1:1669053-1669075 TATACACGCACAAGAACTGATGG + Intronic
901567788 1:10133036-10133058 TGTAGACGGACCAAAACAGAAGG + Intronic
903070308 1:20723877-20723899 CGTGTATGGACCAGAACTGTCGG - Intronic
904864172 1:33563418-33563440 TGTACACAGAGCAGATGTGTGGG + Intronic
906056682 1:42923607-42923629 GACAGACGGACCAGAACTGTAGG + Intergenic
920044448 1:203124456-203124478 TGCACAAGGAGGAGAACTGTTGG - Intronic
920273814 1:204788617-204788639 TTGACACTGACCAGCACTGTAGG - Intergenic
921350114 1:214226028-214226050 TGTACTCTGGCCAGAACTTTAGG - Intergenic
924391347 1:243562718-243562740 TGGACAGGCAGCAGAACTGTCGG + Intronic
1084370624 11:68740240-68740262 GGTCCATGGACCAGAACTGTTGG - Intronic
1084876010 11:72134222-72134244 TGTCCAGGGACCAGAACTCTTGG + Intronic
1085560548 11:77469192-77469214 TGCACATGGACTAGAATTGTTGG + Intronic
1086110380 11:83192777-83192799 TGTTCACAGACCAAAACTGGGGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1095662186 12:44749880-44749902 TATACAAGGAACAGAAATGTTGG + Intronic
1096867036 12:54570754-54570776 TGCACAGAGACCAGAACTGGGGG - Intronic
1100209691 12:92388278-92388300 TGGAAACAGACCAAAACTGTGGG + Intergenic
1102256000 12:111415364-111415386 TGTCCACGGTGCAGAACAGTTGG - Intronic
1110635970 13:77767388-77767410 TGTACACTCTGCAGAACTGTGGG - Intergenic
1120077631 14:80177528-80177550 TGTTCACTGACCAGAAAAGTAGG + Intergenic
1128843066 15:70866091-70866113 TTTACATGTACCAGAACTATGGG - Intronic
1129171280 15:73809715-73809737 TGTGCAGAGCCCAGAACTGTAGG + Intergenic
1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG + Intronic
1135487884 16:22881760-22881782 TTCACAAGGACAAGAACTGTGGG + Intronic
1142363048 16:89636257-89636279 TGTACACGGACCAGAACTGTGGG - Exonic
1148213335 17:45821082-45821104 TGTCCACGGGCCAGTCCTGTGGG + Intronic
1150211208 17:63442536-63442558 TGTTCTCAGAGCAGAACTGTGGG + Intronic
1155454062 18:25992239-25992261 TATACCTGGACCAGAACTTTGGG - Intergenic
1159848205 18:73492217-73492239 TTTTCACAGACCAGGACTGTTGG + Intergenic
1162183435 19:8886494-8886516 TGAACAGGGACCTGAGCTGTGGG + Exonic
932061028 2:68497548-68497570 TGTACAGGCTACAGAACTGTGGG + Intronic
938119067 2:128621096-128621118 TGTCCAGGGGCCAGAACTCTGGG - Intergenic
942830975 2:180237292-180237314 TGCTCACGGCCCAGAACTCTTGG - Intergenic
947179339 2:227398340-227398362 AGTGCAGGGACCAGAGCTGTTGG - Intergenic
1175420020 20:58825796-58825818 TGTTCAAGGCCCAGAGCTGTGGG + Intergenic
1178712314 21:34928801-34928823 TGGACACTGACCACAGCTGTGGG - Intronic
1179090274 21:38258764-38258786 TGTAAAATGACCACAACTGTTGG - Intronic
1180673978 22:17574418-17574440 GGTTCAGGGAACAGAACTGTGGG - Intronic
1182450455 22:30417224-30417246 TGTACACAGAAAAGAACTCTGGG + Intronic
951118190 3:18890516-18890538 TGTTCACGGACCAAAACTGAAGG + Intergenic
957613040 3:82493470-82493492 TGTACACCCACCAGAAATGACGG - Intergenic
962921063 3:139951111-139951133 GGTACAGGGAAGAGAACTGTGGG + Intronic
970099817 4:12508294-12508316 TGTTAATGGACTAGAACTGTAGG + Intergenic
981117208 4:141005530-141005552 TTTTCAGGGACCAGAACTGTAGG + Intronic
982607694 4:157535895-157535917 TGTACAGGGTGCAGAACTGTGGG + Intergenic
985012475 4:185597987-185598009 TGGACACGGACCAAAAATGCTGG - Intronic
985365764 4:189231007-189231029 TGTACAGCAAACAGAACTGTGGG - Intergenic
985902215 5:2805344-2805366 TTTCCAGGGTCCAGAACTGTGGG + Intergenic
990566367 5:57033333-57033355 TGAACAGGGAGCAGCACTGTGGG + Intergenic
995346610 5:111127643-111127665 TGTTCATGGATCAGAAATGTGGG + Exonic
1001831829 5:174795223-174795245 TCTACAGGCAGCAGAACTGTGGG - Intergenic
1003339998 6:5211174-5211196 TGTAAAAGGATGAGAACTGTGGG + Intronic
1021454920 7:20819416-20819438 TGCACTCGGACCAGAACTTTTGG + Intergenic
1021568306 7:22036724-22036746 TGTTCATGGAACAGAACTCTGGG + Intergenic
1028192246 7:87866930-87866952 TGCTCACGGCCCAGAACTCTTGG - Intronic
1028868976 7:95745194-95745216 TGTATACGTAACAGAAATGTAGG - Intergenic
1034811354 7:154134785-154134807 TGTACACTCACAAGAAGTGTGGG - Intronic
1036826108 8:11977364-11977386 TGTACAAGGACCAGAGATGGTGG + Intergenic
1041512905 8:58671199-58671221 TGTCCCAGGACCAGTACTGTGGG - Intergenic
1041693263 8:60711092-60711114 TGTACATGGAGCAGAAATGTAGG - Intronic
1042062579 8:64837055-64837077 TGGACAGGGAGCAGAAGTGTAGG + Intergenic
1046393039 8:113602003-113602025 AGTGCACAGCCCAGAACTGTTGG + Intronic
1049748316 8:144272328-144272350 TGTGCACGGATCAGGACTGGGGG - Intronic
1061682867 9:132251712-132251734 TGTACTAGGAGCAGAACTGCTGG - Intergenic
1061720611 9:132548735-132548757 TGTACAGAGACAAGGACTGTGGG - Intronic