ID: 1142363877

View in Genome Browser
Species Human (GRCh38)
Location 16:89639663-89639685
Sequence GAGAGTGGTTCTGCCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142363877_1142363882 27 Left 1142363877 16:89639663-89639685 CCTGCACTGGCAGAACCACTCTC No data
Right 1142363882 16:89639713-89639735 TCTCGCTCCGTCACCCAGGCTGG 0: 256
1: 21951
2: 114856
3: 160152
4: 164694
1142363877_1142363879 2 Left 1142363877 16:89639663-89639685 CCTGCACTGGCAGAACCACTCTC No data
Right 1142363879 16:89639688-89639710 CATCCAGCATTTTTTTGAGATGG No data
1142363877_1142363881 23 Left 1142363877 16:89639663-89639685 CCTGCACTGGCAGAACCACTCTC No data
Right 1142363881 16:89639709-89639731 GGAATCTCGCTCCGTCACCCAGG 0: 6
1: 672
2: 15496
3: 71722
4: 120578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142363877 Original CRISPR GAGAGTGGTTCTGCCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr