ID: 1142364845

View in Genome Browser
Species Human (GRCh38)
Location 16:89644792-89644814
Sequence GGGGTGGGCAGGACTGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1262
Summary {0: 1, 1: 0, 2: 12, 3: 106, 4: 1143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142364832_1142364845 12 Left 1142364832 16:89644757-89644779 CCACGACACCACTGCAGCCTCAG 0: 1
1: 2
2: 1
3: 27
4: 309
Right 1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 106
4: 1143
1142364839_1142364845 -5 Left 1142364839 16:89644774-89644796 CCTCAGCATGGGCTGCACGGGGT 0: 1
1: 0
2: 2
3: 9
4: 165
Right 1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 106
4: 1143
1142364831_1142364845 13 Left 1142364831 16:89644756-89644778 CCCACGACACCACTGCAGCCTCA 0: 1
1: 2
2: 2
3: 17
4: 200
Right 1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 106
4: 1143
1142364830_1142364845 26 Left 1142364830 16:89644743-89644765 CCTGCACGTAACACCCACGACAC 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 106
4: 1143
1142364835_1142364845 4 Left 1142364835 16:89644765-89644787 CCACTGCAGCCTCAGCATGGGCT 0: 1
1: 0
2: 5
3: 61
4: 753
Right 1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG 0: 1
1: 0
2: 12
3: 106
4: 1143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142364845 Original CRISPR GGGGTGGGCAGGACTGAGGA GGG Exonic
900139233 1:1132532-1132554 AGGGTGCCCAGGGCTGAGGAGGG + Intergenic
900191768 1:1355140-1355162 GGGGTGGCCGGGGCTGCGGAGGG + Exonic
900284955 1:1894607-1894629 AGGGAGGGCAGGTCTGAGGCCGG - Intergenic
900291961 1:1927428-1927450 GGGGTGGGTAGGTCCCAGGAAGG + Intronic
900299319 1:1969181-1969203 GGGCTGGGCAGGGCTGGGCAGGG - Intronic
900299342 1:1969241-1969263 GGGTTGGGCAGGGCTGGGCAGGG - Intronic
900386586 1:2413482-2413504 GGGGTGGGAAGGGCTGGGGCGGG + Intronic
900547835 1:3238228-3238250 GCGGAGGGCAGGAGTGAGGGAGG + Intronic
900591454 1:3462079-3462101 GGGGCGGGCAGGAGTGTGGCGGG + Intronic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
900830142 1:4959937-4959959 GGGGAGGGGAGGACAGAGGAAGG + Intergenic
900859074 1:5212230-5212252 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
901011993 1:6207321-6207343 GGGGTGGGGAGCCCTGGGGAAGG + Intronic
901018488 1:6244635-6244657 GGGGAGGGCTGGAGGGAGGAGGG + Intronic
901185001 1:7367344-7367366 GGAGTGAGCAGGGCTGGGGACGG - Intronic
901264742 1:7902102-7902124 TGGGTAGGGAGGACTGCGGAGGG + Intergenic
901647777 1:10725893-10725915 AGGATGGGCCGGACTTAGGAGGG + Intronic
901653375 1:10755644-10755666 GGTGTGGGGAGAACGGAGGAAGG + Intronic
901752848 1:11422112-11422134 GTGGGAGGCAGGAGTGAGGAAGG - Intergenic
902178557 1:14670099-14670121 GGGGAGGGGAGGGCTGGGGAGGG - Intronic
902251342 1:15155662-15155684 GGGGTGTGCTGGGCTGGGGAAGG + Intronic
902261257 1:15226541-15226563 GGGGTGGGGTGGACACAGGAAGG - Intergenic
902344037 1:15802789-15802811 GGGGTTGGCAGAAGTGAGCAGGG + Intergenic
902387382 1:16083603-16083625 GGGCTGGGCAGGGCTGGGCAGGG - Intergenic
902387386 1:16083613-16083635 GGGCTGGGCAGGGCTGGGCAGGG - Intergenic
902387390 1:16083623-16083645 GGGCTGGGCAGGGCTGGGCAGGG - Intergenic
902620187 1:17646288-17646310 GGGCTGGACATGAGTGAGGAAGG - Intronic
902630215 1:17700391-17700413 GGGATGGGAAGGGCTGGGGAGGG + Intergenic
902773208 1:18658231-18658253 GGGGAGGGCAGGAGCGAGGAGGG - Intronic
902803945 1:18849300-18849322 TGGGTGGGCAGGCCTGGGGCGGG - Exonic
902808764 1:18876470-18876492 GGGGTGGGCAGGGAGGAGGGAGG + Intronic
902986994 1:20160935-20160957 GGAGAGGGCAGGACTGAATAGGG + Intergenic
903125676 1:21245890-21245912 GGGGAGGGCAGGAGAGAGGAGGG - Intronic
903225175 1:21890528-21890550 TGGCGGGGCAGGACCGAGGATGG - Intronic
903282558 1:22258161-22258183 GGGCTGGGCTGGGCTGGGGATGG + Intergenic
903366923 1:22810905-22810927 GGGCTGGGTGGCACTGAGGAGGG - Intronic
903450818 1:23452608-23452630 GGGCAGGGCTGGACTGAGGGTGG - Intronic
903650141 1:24917070-24917092 GGGGTGGGCTGGGCTGAGCATGG + Intronic
904211303 1:28888094-28888116 GGAGTGGGGAGGAGAGAGGAGGG + Intronic
904437076 1:30506050-30506072 TGGGTGGGCAGCGCTGGGGAGGG - Intergenic
904626681 1:31810067-31810089 GGGGAGGGGAGGGCAGAGGAGGG - Intronic
905304735 1:37009777-37009799 GGGCTGGGCTGGACTGAAGTAGG + Intronic
905370971 1:37482568-37482590 AGGAAGGGCAGGAGTGAGGAGGG - Intronic
905931709 1:41792565-41792587 GGGGAGGGCAGGTTTCAGGATGG - Intronic
906073761 1:43036407-43036429 TGAGTGGGCCAGACTGAGGAGGG - Intergenic
906459034 1:46023336-46023358 GGTGTGGCCAGGACTGAAGCCGG + Intronic
906500621 1:46339771-46339793 AGGGTGGGTAGGAGTGAGGCAGG + Intergenic
906648027 1:47490185-47490207 GGAGTGGGCAGGTCTGAAGCAGG + Intergenic
906783954 1:48597700-48597722 GGGGAGGGGAGGAGAGAGGAGGG + Intronic
907274600 1:53310252-53310274 GGAGGGGGCAAGGCTGAGGAGGG - Intronic
907381601 1:54095397-54095419 GGTGTGGTCAGGATTGGGGAGGG + Intronic
907532604 1:55116018-55116040 GGGGTGGGCAGGCTAGGGGAGGG + Intronic
908081824 1:60589088-60589110 GTGATGGGAAGGACTGTGGATGG - Intergenic
908482719 1:64558117-64558139 GGGATGGGTAGGACTGAAGTAGG - Intronic
908728249 1:67199357-67199379 GTGGTGGGGAGGAGTCAGGATGG - Intronic
909020773 1:70428240-70428262 GAGGTGGGGAGGACAGAGGATGG + Intronic
909344537 1:74570921-74570943 GGGCTGGGAAAGACGGAGGAGGG - Intronic
909550371 1:76893236-76893258 AGGGTGTGCAGGAGGGAGGAAGG + Intronic
909583342 1:77262820-77262842 GGGGAGGGCAGGAGATAGGAGGG - Intergenic
909931595 1:81504283-81504305 AGGCTGGGGAGGACTGGGGAGGG - Intronic
910394070 1:86774332-86774354 GGGGTGGCCAGGACTGAAGAAGG + Intergenic
910597247 1:88992961-88992983 GGGTTGGGCTTGAGTGAGGAAGG + Intergenic
910803771 1:91170585-91170607 GGGCAAGGCAGGTCTGAGGATGG + Intergenic
911305515 1:96227222-96227244 TTGGAGGGCAGGAATGAGGAAGG - Intergenic
912513250 1:110202300-110202322 TGGGTGGACAGGACTGCTGAGGG + Intergenic
912619536 1:111140612-111140634 GGGGTGGGAAGAACCGTGGAGGG + Intronic
912798074 1:112704919-112704941 CGGGTGAGCTGGACTGAGGGAGG - Intronic
912812012 1:112802027-112802049 GGGGTGGGCTGGGAAGAGGAGGG - Intergenic
912822765 1:112881043-112881065 GGGGTGGGCAGCCTGGAGGAGGG + Intergenic
913061698 1:115214465-115214487 GGGGTGGGGAGGACCAAGTAGGG - Intergenic
913474270 1:119221842-119221864 GGGGTTGGGTGGAGTGAGGAGGG - Intergenic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
913957528 1:143318909-143318931 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
914899632 1:151704916-151704938 GGGGTGGGCATCCCTGAGGGTGG + Intronic
914959591 1:152194658-152194680 GGGATGGGGAGGGGTGAGGAGGG - Intergenic
915287390 1:154861667-154861689 GTGCTTGGGAGGACTGAGGAAGG - Intronic
915319396 1:155047936-155047958 GGGGTGGAGAGGTCTGGGGAGGG - Intronic
915322342 1:155062699-155062721 GGGTTGGACGGGATTGAGGAAGG + Exonic
915458119 1:156053831-156053853 GGGGAGGGGAGGAGAGAGGAGGG - Intergenic
915460998 1:156070600-156070622 ATGGTGGGGAGGACAGAGGAAGG - Intergenic
915545282 1:156593599-156593621 GGTGTGGGCAAGAGTCAGGAGGG - Intronic
915583324 1:156829371-156829393 GGGCAGAGCAGGACTGAAGATGG + Intronic
915599395 1:156913071-156913093 GGAGTGGGGAGGAGGGAGGAAGG + Intronic
915720163 1:157978866-157978888 GGGGTGGGCGGCTCTGAGGCTGG + Intergenic
915934939 1:160084918-160084940 AGGGTGGGCGGGACCGAGGAAGG + Intronic
915979031 1:160408717-160408739 GGGGTGGGAAGGGCAGAGCAGGG - Intronic
916371289 1:164098062-164098084 GAGGTGGGCTGGACTGAATAAGG + Intergenic
916484812 1:165249374-165249396 GTGGTGGGCAGGGCTGCGGTGGG - Intronic
916793651 1:168146115-168146137 GGGGTGGGAAGGGGTGGGGAAGG + Intergenic
917300694 1:173570899-173570921 GTGGTGGGGAGGACTGGGGAGGG + Intronic
917501581 1:175590649-175590671 TGGGTGGCCAGCAGTGAGGAGGG + Intronic
918079113 1:181192134-181192156 AGGGCTGGCAGGACCGAGGATGG - Intergenic
918238296 1:182600553-182600575 AGGGTGGGCATGGCTGAGGGAGG + Intronic
919249200 1:195030738-195030760 GGGGTGGGTGGCACTGAGGGTGG - Intergenic
920059087 1:203215259-203215281 GGGGTGGGCAGGAAGCAGGGAGG + Intronic
920209774 1:204319851-204319873 AGGGCGGGCAGGGATGAGGAGGG + Intronic
920279421 1:204831437-204831459 GGGGTGGGTGGGCCAGAGGAGGG + Intronic
920536395 1:206739433-206739455 GGGTGGGGGAGGACTTAGGAAGG - Intergenic
920553971 1:206890320-206890342 GGGGTGGGGTGGAGTGAGTAGGG + Intergenic
920769544 1:208868372-208868394 AGGGAGGGCAGAACTGATGAGGG + Intergenic
920947499 1:210543586-210543608 GGGGTGGGGAGGGTTGAGGCAGG - Intronic
922189944 1:223309494-223309516 GTGGTGCTCAGGACTGGGGAGGG + Intronic
922471342 1:225879229-225879251 GGGGAAGGAAGGACTGTGGATGG + Exonic
922618855 1:226978650-226978672 GAGGTGGGCAGGTGTGTGGAGGG - Intronic
922740254 1:228010460-228010482 GGGAGGGCCAGGACTGAGAACGG - Intronic
922864637 1:228849033-228849055 GGGGTGTGGAGGCCTGAGGTGGG + Intergenic
923039326 1:230308597-230308619 GGGGTGGGGAGGCGGGAGGAAGG + Intergenic
923103830 1:230838866-230838888 GTGGTGGTCAGGGCTGGGGAAGG + Exonic
923521973 1:234741966-234741988 GGGATGGGCAGGAGAAAGGAGGG + Intergenic
924007748 1:239630897-239630919 GGGGAGGGCAGCAGTGGGGAAGG + Intronic
924204701 1:241699584-241699606 TGGGTGGGGGGAACTGAGGAAGG + Intronic
1062824431 10:557709-557731 GGGATGGGCAGGGCAGGGGAGGG + Intronic
1062826061 10:569774-569796 GGGGTAGGGAGGAGAGAGGATGG + Intronic
1063143165 10:3273996-3274018 GGGCTGGGAAGAACTTAGGAAGG + Intergenic
1063936302 10:11082105-11082127 GTGGAGGGCAGGAATGAGGAAGG + Intronic
1064551134 10:16502190-16502212 GGGGAGGGCAGGAGTCAGCACGG - Intronic
1064587686 10:16855058-16855080 GGGGAGGGGAGGAGAGAGGAGGG - Intronic
1065693004 10:28354501-28354523 AGGATGGGAAGGACTGGGGAGGG - Intergenic
1065732417 10:28721698-28721720 GCGGTGGGCAAGGCTGAGGATGG + Intergenic
1065797239 10:29318863-29318885 GGGGTGGGAAGGACAGAGGAGGG + Intergenic
1065945917 10:30605470-30605492 GGGGTGGGAAGGACAGAGGAGGG - Intergenic
1066281773 10:33924713-33924735 GTGGGGGGCAGGGCTGAGGTGGG - Intergenic
1066305264 10:34134192-34134214 GGTGTAGGCATGAGTGAGGATGG + Intronic
1066328397 10:34390617-34390639 GGGATTGTCAGGACTGGGGAAGG - Intronic
1066759745 10:38739879-38739901 GGTCTGGGCAGGACCAAGGAGGG - Intergenic
1066760138 10:38741674-38741696 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1066985516 10:42462919-42462941 AGGGTGGGGAGCACTGAGGTGGG + Intergenic
1067027935 10:42860018-42860040 GGGGCTGATAGGACTGAGGATGG - Intergenic
1067147594 10:43704421-43704443 GTGGTTGGCTGGGCTGAGGAAGG - Intergenic
1067170587 10:43902946-43902968 GGGATGGGCAGGACTGTTGCCGG + Intergenic
1067217675 10:44316533-44316555 GTGGTGGGAAGGGCCGAGGATGG - Intergenic
1067390046 10:45855431-45855453 AGGGTGGGGAGCACTGAGGTGGG + Intergenic
1067501422 10:46808428-46808450 AGGGTGGGGAGCACTGAGGTGGG - Intergenic
1067593156 10:47531478-47531500 AGGGTGGGGAGCACTGAGGTGGG + Intronic
1067640268 10:48039588-48039610 AGGGTGGGGAGCACTGAGGTGGG + Intergenic
1067873220 10:49980628-49980650 AGGGTGGGGAGCACTGAGGTGGG - Intergenic
1068611781 10:59068288-59068310 GGGGTTGGGTGGATTGAGGATGG - Intergenic
1068611912 10:59069641-59069663 GGGGTTGGGTGGATTGAGGATGG - Intergenic
1068910554 10:62374513-62374535 GGGGTGGCCGGGGCTGGGGAGGG + Intronic
1069659654 10:70115233-70115255 GGGGTGGTCATGCCTCAGGAGGG - Intronic
1069761222 10:70812866-70812888 GGTGTGGGCAGATCTTAGGAGGG - Intergenic
1069959285 10:72070201-72070223 GGGGTTTCCAGGACTGAGGTGGG - Intronic
1069973083 10:72190044-72190066 GGGGTGGGGAGCACTGTGGAGGG - Intronic
1070137235 10:73705624-73705646 AGGGTGGGGAGCACTGAGGTGGG + Intergenic
1070289189 10:75103799-75103821 GGGGAGGGGAGGAGAGAGGAAGG - Intronic
1070672897 10:78390373-78390395 GGGATGGGCAGCACTGAGCCTGG - Intergenic
1070734584 10:78854796-78854818 GGAGTGGGGAGGAATGGGGAAGG - Intergenic
1071481603 10:86069080-86069102 TAGGTTGGGAGGACTGAGGATGG + Intronic
1071507326 10:86240598-86240620 GGGGTGGGCAGGGCAGAGCTGGG + Intronic
1071983180 10:91024223-91024245 GGGGCGGGGAGGAGTGAGGATGG - Intergenic
1072768387 10:98115280-98115302 GGGCTGGGCAGGGCTCCGGATGG - Intergenic
1073002822 10:100298120-100298142 AGGGTGGACAGGACAGAAGAGGG - Intronic
1073056657 10:100707490-100707512 GGGCTGGGCTGCACTGAGGTGGG - Intergenic
1073458657 10:103652940-103652962 TGGGAGGGCAGGAGTGAGCAAGG - Intronic
1073579960 10:104656321-104656343 GGCATGGGCAGGACTAAGCAAGG + Intronic
1074164743 10:110865314-110865336 GGGTAAGGCAGGGCTGAGGAAGG - Intergenic
1074364851 10:112849578-112849600 GGAGGGGGCAGCCCTGAGGAAGG + Intergenic
1074429549 10:113382178-113382200 AGGGAGGGAAGGACAGAGGAAGG - Intergenic
1074770507 10:116730682-116730704 GGGGTGGGCATGGCTGGGGAAGG - Intronic
1074859313 10:117498249-117498271 GGGGTGGGGAGTGCTGAGGAGGG - Intergenic
1074869251 10:117564087-117564109 GGGGAAGGCAGGACTGAGAGAGG - Intergenic
1074962460 10:118459706-118459728 GCGGTGGTCAGAACTGATGAGGG + Intergenic
1075112172 10:119596497-119596519 GGGGAGGGCAGGGTTGGGGAGGG + Intronic
1075418960 10:122286807-122286829 GGGGTGGTCAGGACTGGAAAAGG - Intronic
1075455898 10:122584780-122584802 GGTGTTGGAAGGAGTGAGGAAGG - Intronic
1075458019 10:122597483-122597505 GGTGTTGGAAGGAGTGAGGAAGG - Intronic
1075495652 10:122916531-122916553 GGGGTGGGGAGGACATATGAGGG - Intergenic
1075609509 10:123841021-123841043 GGGTTGGGGAGGACTGCAGACGG + Intronic
1076035291 10:127195265-127195287 GGCGAGGGCAGGAGGGAGGAGGG - Intronic
1076228427 10:128799778-128799800 GTGGTGGTCAGAACTGGGGAGGG + Intergenic
1076407668 10:130223666-130223688 GGGGCAGGCAGGGCTGAGGAGGG + Intergenic
1076618226 10:131770851-131770873 GGGGCGGGGAGGGGTGAGGAGGG + Intergenic
1076732077 10:132444127-132444149 GGGGTGGGGAGCCCTGAGGAAGG - Intergenic
1076806984 10:132863734-132863756 GGTGTGTGCAGGGCTCAGGAAGG - Intronic
1076859261 10:133132853-133132875 TGCCTGAGCAGGACTGAGGAGGG + Intergenic
1076881168 10:133239858-133239880 GGGGTGGGCAGGGGTGGGCAAGG + Intronic
1076888277 10:133272374-133272396 AGGGTGGGGAGGGCTGGGGAGGG - Intronic
1076915883 10:133423059-133423081 GGCGTGGGCAGGACGGTGGATGG + Exonic
1077018049 11:405617-405639 GGGGTGGGGATGAGAGAGGAGGG + Intergenic
1077024125 11:431821-431843 GGGGTGGGCTGGCCTGGAGAGGG - Intronic
1077073724 11:690258-690280 GGGGAGGGCAGGGCAGGGGAGGG + Intronic
1077080568 11:722926-722948 GGGGAGGGGAGCACTGGGGAGGG - Intronic
1077162110 11:1118396-1118418 GGGCTGGGTAGGGCTGGGGAGGG + Intergenic
1077191173 11:1256480-1256502 GGGGTGGGCGGGGCTAAGTATGG - Intronic
1077248845 11:1551797-1551819 GGGGTGGGCAGGTGGGTGGACGG - Intergenic
1077252935 11:1568617-1568639 GGGGTGGGTAGGAGAGAGCAGGG - Intronic
1077264410 11:1641914-1641936 GGGGTGGGATGGTCTGAGGGTGG - Intergenic
1077264487 11:1642151-1642173 GGGGTGGGATGGTCTGAGGTTGG - Intergenic
1077286530 11:1768438-1768460 GGGGTGGGGAGGTGTGTGGAGGG + Intergenic
1077331802 11:1987243-1987265 GGGGTGGGCAGGGCTGAGCTGGG + Intergenic
1077331818 11:1987283-1987305 GGGCTGGGCAGGGCTGGGCAGGG + Intergenic
1077331882 11:1987463-1987485 GGGCTGGGCAGGGCTGGGAAGGG + Intergenic
1077390899 11:2300244-2300266 GGGGTGGGCAGGGGTGTGTAAGG + Intronic
1077414429 11:2418132-2418154 GGGGTCGGGAGGACAGGGGAGGG + Intronic
1077484506 11:2832635-2832657 GAGGCGGGCAGACCTGAGGAGGG - Intronic
1077493311 11:2872124-2872146 GGGGTGAGCAGGAAGGAAGATGG - Intergenic
1077533612 11:3108470-3108492 AGGGTGGGGAAGGCTGAGGAGGG + Intronic
1078128412 11:8591836-8591858 GGGGTGGGGGGGAGTGGGGAGGG + Intronic
1078153151 11:8776080-8776102 TGTGTGGGCAGGTCTGGGGAGGG - Intronic
1078402083 11:11037389-11037411 GGGCTGGGCTGGGCTGAGGCTGG + Intergenic
1079114723 11:17634029-17634051 AGGGTGCGAGGGACTGAGGAAGG - Intronic
1079151188 11:17901021-17901043 GGGGTGGGAAGGGATGAGGTGGG - Intronic
1080653819 11:34243002-34243024 GAGGTGGGCAGGGCTGTGGAGGG - Intronic
1081428010 11:42946178-42946200 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1083034961 11:59628522-59628544 CGGGTGGGCAGGAGGGAGGGAGG - Intergenic
1083228669 11:61300974-61300996 AAGGTGGGGATGACTGAGGAGGG - Intronic
1083282906 11:61638440-61638462 GGGGAGGACAGGAGGGAGGACGG + Intergenic
1083656494 11:64232289-64232311 GGAGTGGGCAGGCCTGAGTGAGG + Intronic
1083782126 11:64924149-64924171 GGGGACTGCAGGCCTGAGGATGG + Intronic
1084092003 11:66884947-66884969 GGGGTGGGGTGGCCTGAAGAGGG - Intronic
1084179724 11:67440309-67440331 GGGCTGGGCAGGGCTGGCGAGGG - Intronic
1084294688 11:68204520-68204542 GGCGTTGGCAGGGCTGTGGAGGG - Intronic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1084650330 11:70485854-70485876 GGGGGTGGCAGGAATGAGGCAGG + Intronic
1084673720 11:70622354-70622376 GGGGTGGAGAGGACTGAGGCTGG - Intronic
1084941351 11:72615019-72615041 AGGGTGGGCAGGAGGGTGGAGGG - Intronic
1085279599 11:75321247-75321269 GGGGTGAGCAGGAATGGGGTGGG - Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085474372 11:76780692-76780714 GGGGTGGCCAGAACTGATGCTGG + Intergenic
1086361956 11:86069003-86069025 GGGGTGGGCTGAACTGAGGCGGG - Intronic
1086850098 11:91798800-91798822 GGGGTGGGAAGGCCTGAGGGTGG + Intergenic
1087901635 11:103648091-103648113 AGGGTGGGCAGGACTAAGCTAGG + Intergenic
1088024943 11:105167926-105167948 GGCGTGGGCAGGGCAAAGGAAGG + Intergenic
1089339378 11:117747135-117747157 GGGGTGGTGAAGACTCAGGAAGG - Intronic
1089403004 11:118175645-118175667 GGGCTGGGCAGTTCTGAGGCTGG + Intronic
1089447533 11:118565489-118565511 GGGGTGGGGTGGGCTGAGGCGGG + Intronic
1089526815 11:119102295-119102317 GGGGTGGGGAGGAGGGACGAGGG + Exonic
1089562529 11:119351484-119351506 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
1089773239 11:120818096-120818118 TGGATGGGAAGGACTCAGGAAGG - Intronic
1090193881 11:124799464-124799486 GGCCGGGGCAGGATTGAGGAAGG - Intronic
1090373990 11:126276322-126276344 GGGGTGGACAGGGTTGGGGAGGG + Intronic
1090395700 11:126416659-126416681 GGGGCGGGCAGGGCAGGGGAGGG + Intronic
1090716941 11:129439419-129439441 GGGGTGGGGAGGATAGGGGAGGG - Intronic
1090794183 11:130120343-130120365 GGTGTGGGCAGGAATAAGGAAGG + Intronic
1090977408 11:131689359-131689381 GGGGCTGGAAGGACTGAGAAAGG + Intronic
1091068013 11:132535479-132535501 GGTGTGGGCAAGGCTGAGGTAGG - Intronic
1202814783 11_KI270721v1_random:42419-42441 GGGGTGGGCAGGGCTGAGCTGGG + Intergenic
1202814799 11_KI270721v1_random:42459-42481 GGGCTGGGCAGGGCTGGGCAGGG + Intergenic
1202814863 11_KI270721v1_random:42639-42661 GGGCTGGGCAGGGCTGGGAAGGG + Intergenic
1091387447 12:103815-103837 TGGGGAGGCAGGACTCAGGAGGG + Intronic
1091645137 12:2267453-2267475 GGTGTGGGCAGGACTGGGCAGGG + Intronic
1091650251 12:2304099-2304121 GGGGTGCACAGGACGGAGCAGGG + Intronic
1091686205 12:2564627-2564649 TGGGAGGGCAGCACAGAGGAGGG - Intronic
1091823052 12:3490863-3490885 GGGGTGGGCCGGGGTGGGGAGGG + Intronic
1091835651 12:3583818-3583840 GGGGTGGTGAGGAATGAGGCTGG - Intronic
1092046028 12:5432366-5432388 TGGGTGGGCAGGTTTGGGGATGG + Intronic
1092298195 12:7219320-7219342 TGGGTGGGGGGGAGTGAGGATGG - Intergenic
1092970606 12:13691120-13691142 GGAGTGGGAAGGAGTGAGAATGG - Intronic
1093017633 12:14170930-14170952 GGGGAGGGGAGGAGAGAGGAAGG + Intergenic
1093171050 12:15861013-15861035 AGGGTGGGCAGGATTAAGCAGGG - Intronic
1093252687 12:16827106-16827128 GGGGTGGGGAGGTGGGAGGAGGG - Intergenic
1093503625 12:19839133-19839155 GAGGTGGGCAGACCTGAGGTCGG + Intergenic
1093727281 12:22529082-22529104 GGGGTGGGCAGGAGTTAAAAAGG + Intronic
1093762931 12:22930457-22930479 TCGGCTGGCAGGACTGAGGAAGG - Intergenic
1094177120 12:27552505-27552527 GGAGAAGGCAGGGCTGAGGATGG + Intronic
1095137465 12:38622931-38622953 GGGGTGGGGGGGAGGGAGGAGGG + Intergenic
1095675446 12:44912072-44912094 GGGGAGGGTAGTACTGAGAATGG + Intronic
1095880997 12:47135860-47135882 GGTGTTGGCAGGAGTGAAGAGGG + Intronic
1096220559 12:49826137-49826159 GAGGTGGGCAGGGCTGGGGGTGG + Intronic
1096229260 12:49888316-49888338 GGGCTGGGCAGGATGGAGGTGGG + Intronic
1096369722 12:51058848-51058870 GGGGTGGGGAGGAGAGAGGCAGG + Intronic
1096524100 12:52200515-52200537 GGGTTGGGCTGGGCTGGGGAAGG + Intergenic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096817401 12:54210287-54210309 GGGGAGGGAAGAACGGAGGATGG - Intergenic
1096840840 12:54378642-54378664 GGGATGGGAAGACCTGAGGAAGG + Intronic
1096848797 12:54422204-54422226 GGGGTGGGGAGTACTGATAATGG + Intergenic
1097158696 12:57030354-57030376 TGGGAGGGCAGGGCTGGGGAGGG + Intronic
1097338042 12:58406695-58406717 GCGGAGGGCAGGAATGAGGTGGG + Intergenic
1097636473 12:62128582-62128604 GGAGAGGGCAGTACTGAGAATGG - Intronic
1097704572 12:62854477-62854499 GGGGTGGGCAGGAGTGACCTTGG + Intronic
1098358368 12:69631985-69632007 GGGGAGGGAAGGAAGGAGGAAGG - Intergenic
1099899741 12:88693101-88693123 GGGGAGGGAAGGACGGAGGGAGG + Intergenic
1099915930 12:88893101-88893123 GGGGTTGGCAGAACTAAGGCTGG + Intergenic
1100875220 12:98954919-98954941 AGGGTGGGCAGGAGGGAGGGAGG - Intronic
1100963029 12:99984582-99984604 AGGGTGGTGAGGACTGAGGTCGG + Intronic
1101580470 12:106037652-106037674 GGGGAGGGGAGGAGAGAGGAGGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102562099 12:113769563-113769585 GGGGTAGGTAGGGCTGAGGCTGG + Intergenic
1103204384 12:119117048-119117070 GGGGTGGGGAGGACAGTTGATGG + Intronic
1103246736 12:119464375-119464397 GGGGAGGGAAGGAAGGAGGAAGG - Intronic
1103568482 12:121829103-121829125 GGGGTGGGCAGGGCTGAGGGTGG + Intronic
1103905750 12:124326504-124326526 GGGGCGGGCAGCAGGGAGGAGGG - Intronic
1103963150 12:124621951-124621973 GGGGTGGAAGAGACTGAGGAAGG - Intergenic
1104045580 12:125160307-125160329 GGGGTGGGTAGGGATGGGGATGG + Intergenic
1104388532 12:128372066-128372088 GTGGTTGCCTGGACTGAGGATGG - Intronic
1104679486 12:130739666-130739688 GGGGTGGGCAGGGGAGCGGAGGG - Intergenic
1104862177 12:131929506-131929528 GGGGTCAGCAGGAGTGAGGCTGG + Exonic
1104982252 12:132578692-132578714 GGGGTTGGGAGCTCTGAGGAAGG - Intronic
1105492668 13:20903148-20903170 GCGGTGTGCAGGGCTGAGAACGG - Intergenic
1105704843 13:22962410-22962432 GGGTTGGGGAGGCCTGGGGAAGG - Intergenic
1105985422 13:25561514-25561536 GGGGTGGGCAGTAGGGAGGGTGG - Intronic
1106141165 13:27013281-27013303 GGGCTGGGAAGCACTGGGGATGG + Intergenic
1106300968 13:28465174-28465196 ATGGTAGGCAGGAATGAGGAAGG - Intronic
1106408942 13:29497625-29497647 GGGGTGGTCAGGCCAGCGGAGGG - Intronic
1106558598 13:30830564-30830586 GGTGTGGGCAGGATGCAGGAAGG + Intergenic
1106631814 13:31481936-31481958 GGGGAGGGGAGGACAGGGGAGGG + Intergenic
1106753327 13:32796919-32796941 GGGGTGGGCATGAAGGTGGAGGG + Intergenic
1106758424 13:32844867-32844889 GGGGAAGGCAGGACTGTGAAAGG - Intergenic
1107068410 13:36242896-36242918 GGGGTGGGGAGGAATGAGTTTGG + Intronic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1107624858 13:42272081-42272103 GGGGTGGGCAGGGCGGGGGCGGG + Intergenic
1107736083 13:43399899-43399921 TGGATGGGCAGAGCTGAGGATGG - Intronic
1108447867 13:50527289-50527311 GTGCTGGCCACGACTGAGGAGGG - Intronic
1108541969 13:51453298-51453320 GGGCGGGGCCGGACTGCGGAAGG + Intronic
1108998862 13:56769206-56769228 GGGGTGGGGGTGACAGAGGAGGG + Intergenic
1109463515 13:62695543-62695565 GGGGGTGGCAGGCATGAGGAGGG - Intergenic
1110369806 13:74727426-74727448 GGGCAGGGCAGGGCAGAGGAAGG + Intergenic
1110410843 13:75202620-75202642 AGGGTAGGCAGGAATGAAGAAGG - Intergenic
1110737688 13:78957001-78957023 GGGGAGAGAAGGTCTGAGGAAGG + Intergenic
1112492166 13:99876974-99876996 GGGCAGGGCAGCACTGAGCAGGG - Intronic
1112752595 13:102597319-102597341 GGGGTGGGCAGCACCGGGGTGGG + Intronic
1112859246 13:103809884-103809906 GGGATGGGCAAGACTTTGGAAGG + Intergenic
1113581971 13:111436454-111436476 GGGATGGGCAGGAGTGCGCAGGG - Intergenic
1113600210 13:111563246-111563268 GGGGAGGGAAGGAAAGAGGAGGG - Intergenic
1113600234 13:111563321-111563343 GGGGAGGGAAGGAAAGAGGAGGG - Intergenic
1113616536 13:111684677-111684699 GGGGGTGGCAGGACGAAGGAGGG - Intergenic
1113622066 13:111769948-111769970 GGGGGTGGCAGGACGAAGGAGGG - Intergenic
1113679637 13:112234401-112234423 GGGCTGGGCTGCACAGAGGAAGG - Intergenic
1113909814 13:113836563-113836585 GGGGTGGGGAGGGGTGAGGGAGG + Intronic
1113909826 13:113836585-113836607 GGGGTGGGGAGGGGTGAGGGAGG + Intronic
1114771467 14:25431834-25431856 GTGGTGGGCACGACTGTGGCGGG - Intergenic
1115797979 14:36960400-36960422 GGGGTGGCAAGAACTGAGGGAGG + Intronic
1116393966 14:44426000-44426022 GGAGTGGGGAGGACTGGAGATGG + Intergenic
1116614632 14:47119160-47119182 GGGGGGGGCGGGGCTGAGGCAGG - Intronic
1117376929 14:55125740-55125762 GAGGTGGCCAGGGCTGAGGTTGG + Intronic
1117401108 14:55358966-55358988 GGGATGGGAAGGAGGGAGGAAGG + Intronic
1117613621 14:57509538-57509560 GGAATGGGAAGGACTGTGGAAGG - Intergenic
1118073388 14:62271094-62271116 GGGGAGGGAAGGATGGAGGATGG - Intergenic
1118467607 14:66045151-66045173 GGGGTGGGGAGGAGTGGGGTGGG + Intergenic
1118592374 14:67411284-67411306 TGGTGGGGAAGGACTGAGGAGGG + Intronic
1118614955 14:67569027-67569049 GGGGTGGGCAGACCTGTGGGGGG - Intronic
1118824095 14:69364788-69364810 GGAGTGGGCAGGAGGGTGGAAGG + Intergenic
1118967396 14:70600761-70600783 GGGGCGGGCAGGAGAGAGGCAGG + Intergenic
1119390829 14:74289976-74289998 TGGGTGGGCGGGGTTGAGGAGGG + Intronic
1119418706 14:74493527-74493549 GGGGCGGGGAGGAGTGAGGCGGG - Intronic
1119474848 14:74921244-74921266 GGGCTGGGCAGGGCTGGGGTGGG - Intronic
1119582126 14:75794726-75794748 AGGGTGGTCAGTACTGAGGGAGG + Intronic
1119726505 14:76924806-76924828 GGGGTGGGCAGCAGAGAGGGCGG - Intergenic
1120074930 14:80145428-80145450 GGGGTAGGCAGGAAGGAGGTAGG - Intergenic
1120823675 14:88935846-88935868 GGGGTGTGTAGTACTGAGGGTGG - Intergenic
1120823693 14:88935924-88935946 GGGGTGTGTAGTACTGAGGGTGG - Intergenic
1120823704 14:88935976-88935998 GGGGTGTGTAGTACTGAGGGTGG - Intergenic
1120823710 14:88936002-88936024 GGGGTGTGTAGTACTGAGGGTGG - Intergenic
1120840738 14:89082899-89082921 GGGGTTAGCAGGGCTGAGAAGGG + Intergenic
1121201542 14:92122085-92122107 GGGTTGGGAAGGGCTGTGGACGG + Exonic
1121253776 14:92517167-92517189 TGGGTGGGCAGCTCGGAGGAGGG + Intronic
1121330961 14:93049637-93049659 GGTGGGGGCTGGACTGAGGGTGG + Intronic
1121469209 14:94138885-94138907 GGGGTGAGCAGGGCTGACGGGGG + Intergenic
1121534801 14:94684048-94684070 TGGGTGGGGAGGACAGGGGATGG + Intergenic
1121602687 14:95217849-95217871 GGGAAGGGCAGGGCTGAGCAGGG + Intronic
1122080811 14:99266345-99266367 GGGCTGGGGAGGTCTGGGGAAGG - Intronic
1122112029 14:99509909-99509931 GGTGTGGTCAGGGCTGAGGGAGG + Exonic
1122133858 14:99621363-99621385 GGGGTGGTAAGGACAGAGGGCGG - Intergenic
1122273626 14:100579845-100579867 GAGGTGGCCAGGCCTGAGAAAGG - Intronic
1122297697 14:100714514-100714536 GGGGTGGAGTGGAGTGAGGAGGG - Intergenic
1122374931 14:101251281-101251303 AGGGTGGGCAGCAATGAGGCTGG + Intergenic
1122517994 14:102321977-102321999 GGGGTGGGGAAGAGGGAGGATGG - Intronic
1122695890 14:103551905-103551927 GGGGTGAGGAGGACTGAGGGAGG - Intergenic
1122819759 14:104335512-104335534 GGGCTGGGCTGGGCTGGGGAGGG - Intergenic
1122835088 14:104426943-104426965 GGGGTGGGCGGGGAGGAGGAGGG - Intergenic
1122858459 14:104571516-104571538 GGGCTGGGGAGGGCTGGGGAGGG - Intronic
1123010648 14:105348058-105348080 GGGGTGGGCAGGATTTGGGGCGG + Intronic
1123036531 14:105474157-105474179 GTGGAGGGCAGGGCTCAGGAAGG - Intronic
1123059770 14:105589258-105589280 GGGGTGGGCTGGGCTGAGCTGGG - Intergenic
1123084745 14:105712249-105712271 GGGCTGGGCTGGGCTGAGCAAGG - Intergenic
1123115470 14:105892352-105892374 GGTGTAGGTAGGACTCAGGATGG + Intergenic
1123119693 14:105910986-105911008 GGGGAGGGAAGGATGGAGGAAGG - Intergenic
1202930449 14_KI270725v1_random:29353-29375 GGTGTGGGCAGGACCAAGGCAGG - Intergenic
1202930856 14_KI270725v1_random:31181-31203 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1123421503 15:20140231-20140253 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
1123427589 15:20184850-20184872 GGGGCTGATAGGACTGAGGATGG - Intergenic
1123443552 15:20306284-20306306 GGGGAGGGCAGGACCAAGGAAGG - Intergenic
1123473754 15:20572491-20572513 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1123530729 15:21146771-21146793 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
1123536826 15:21191400-21191422 GGGGCTGATAGGACTGAGGATGG - Intergenic
1123644255 15:22427862-22427884 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1123665564 15:22607758-22607780 GGGGTGGGCAGGCAGGAAGAGGG - Intergenic
1123723928 15:23083754-23083776 GAGGTGTGCGGAACTGAGGAGGG - Intergenic
1123734054 15:23167502-23167524 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1123752192 15:23364894-23364916 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124102902 15:26712454-26712476 GGGGTGGGCAGGAGTGGTGAGGG + Intronic
1124155251 15:27219586-27219608 CAGGTGGGGAGGACTAAGGAGGG - Intronic
1124284557 15:28388813-28388835 GGGGTGGGCAGGCAGGAGCAGGG + Intronic
1124298140 15:28522801-28522823 GGGGTGGGCAGGCAGGAGCAGGG - Intronic
1124420482 15:29516828-29516850 TGGGCGGGCAGCACAGAGGAGGG + Intronic
1124453653 15:29821863-29821885 GGGGTGGGCAGGGCTGGCGCGGG - Intronic
1124483124 15:30093259-30093281 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124489573 15:30145327-30145349 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124544665 15:30614321-30614343 GGGGTGGGCAGGCAGGAAGAGGG + Intronic
1124564624 15:30801750-30801772 GGGGTGGGCAGGCTGGAAGAGGG + Intergenic
1124753954 15:32393000-32393022 GGGGTGGGCAGGCAGGAAGAGGG - Intronic
1125030280 15:35069112-35069134 GGCTTGGGCAGGAAGGAGGAAGG + Intergenic
1125368857 15:38948298-38948320 GGGGAGGGGAGGAAGGAGGAGGG + Intergenic
1125511637 15:40295331-40295353 GGGGAGGCCAAGACTGAGGGAGG - Intronic
1125550607 15:40541726-40541748 GGGGTGAGCAGGAGTGAGGGAGG - Intronic
1125968252 15:43891480-43891502 AGGGAGGGCTGGTCTGAGGAGGG + Intronic
1126101319 15:45119897-45119919 GGAGTGGGCATCTCTGAGGAGGG + Intronic
1126110954 15:45174450-45174472 AGGGTGGGGAGGGCAGAGGAGGG + Intronic
1126547134 15:49885973-49885995 GGAGTGGCCAGGACTCAGAAAGG - Intronic
1126897507 15:53274948-53274970 AGGGTGGGAAGGAGGGAGGAAGG - Intergenic
1127657771 15:61071606-61071628 GGGGTGGGGAGGGGAGAGGAGGG + Intronic
1127657795 15:61071650-61071672 GGGGTGGGGAGGGGTGGGGAGGG + Intronic
1127703920 15:61528424-61528446 GGTCTGGGGAGGGCTGAGGAAGG + Intergenic
1127978870 15:64019186-64019208 GAGGTGGGCAGGTCTGAGACAGG - Intronic
1128042395 15:64586634-64586656 GGGGTTGGCGGGACGGGGGATGG - Intronic
1128325717 15:66722774-66722796 GGGGTCGGCAGGAGTGATGGGGG + Intronic
1129041065 15:72686478-72686500 GGGGTGCGCTGGACGGAGAAGGG + Intronic
1129187012 15:73914401-73914423 GGTATGGGCAGGAGTGTGGAAGG + Intergenic
1129252766 15:74318087-74318109 GGGGTGGGGAGGACTCCTGAGGG + Intronic
1129295257 15:74596590-74596612 AGGCTGGGGAGGACTGGGGAGGG - Exonic
1129476370 15:75786702-75786724 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1129592628 15:76931406-76931428 GGAGTGGGCAGGAGTGGGGTGGG + Intergenic
1129717906 15:77862638-77862660 GGGGTGGCCAGGAGAGAGGCAGG + Intergenic
1129728304 15:77915356-77915378 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1129936097 15:79451437-79451459 TGGGTGAGCAGGACTGCGGGAGG + Intronic
1130259269 15:82343076-82343098 GGGGTGGGCAGGCAGGAGCAGGG - Intronic
1130269407 15:82436089-82436111 GGGGTGGGCAGGCAGGAGCAGGG + Intronic
1130276016 15:82476744-82476766 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1130281995 15:82526106-82526128 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1130468376 15:84204135-84204157 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1130473362 15:84242269-84242291 GGGGTGGGCAGGCAGGAGCAGGG + Intronic
1130480776 15:84356333-84356355 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1130485374 15:84395615-84395637 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1130490936 15:84431426-84431448 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1130495890 15:84469407-84469429 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1130502520 15:84510225-84510247 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1130590669 15:85208733-85208755 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1130595642 15:85246848-85246870 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1130886395 15:88096223-88096245 GGGCTGGTCAGGATTGGGGATGG - Intronic
1130983786 15:88831443-88831465 GGGGGGCGGAGGGCTGAGGATGG - Intronic
1131540033 15:93268165-93268187 AGGATGAGCAGGAGTGAGGAAGG + Intergenic
1131772712 15:95757619-95757641 GGGGTGGGTAGGAGAGGGGAGGG + Intergenic
1131938066 15:97529148-97529170 GGGGAGGGCAGGAAGGAGGGAGG - Intergenic
1132055430 15:98648128-98648150 GGGGTGGGCAGGAGAGGGGAGGG - Intergenic
1132300210 15:100770612-100770634 AGGGTGGGAAGGAGTGAGGGAGG - Intergenic
1132318557 15:100908643-100908665 AGGGTGGGCTGGAGAGAGGAAGG - Intronic
1132615765 16:840496-840518 GGGCTGGGCTGGGCTGGGGAGGG + Intergenic
1132623353 16:878721-878743 GGGGTGGGCAGGGCAGGGGAAGG + Intronic
1132623369 16:878753-878775 GGGGCGGGCAGGGCAGGGGAAGG + Intronic
1132700142 16:1218781-1218803 GGGGCAGGCAGGAGGGAGGATGG + Intronic
1132700164 16:1218860-1218882 GGGCTGGCCAGGAAGGAGGATGG + Intronic
1132709163 16:1258853-1258875 GGAGGGGGCAGGATGGAGGAGGG - Exonic
1132831959 16:1932813-1932835 GGGGTGGGCAGGCCACAGGCTGG + Intergenic
1132855541 16:2043021-2043043 GGGGAGGTAAGGACTGAGGAGGG - Intronic
1132882296 16:2167801-2167823 GGGGTAGGCAGGGCTGGGGCAGG + Intronic
1133005966 16:2882243-2882265 GGGAGGGGCAGGGCAGAGGAAGG + Intergenic
1133045660 16:3087091-3087113 GGGCTGAGCAGGAAGGAGGAAGG + Intergenic
1133071422 16:3249132-3249154 GGGGTGCTCAGGAAAGAGGAGGG + Intronic
1133164798 16:3938953-3938975 GGTGCCGGGAGGACTGAGGAGGG + Intergenic
1133269841 16:4605500-4605522 GGGGAGGGCAGGGCTGGGGCTGG - Intergenic
1133587711 16:7211950-7211972 GGGGTGGGTAGGAGGGAGTAGGG - Intronic
1133801968 16:9091823-9091845 GGGGTGGGAAGGCCTGGGGCGGG + Exonic
1134045344 16:11097070-11097092 GGGGTGGGGAGGACTTAAAAAGG - Intronic
1134061498 16:11202214-11202236 GCTGTGGGCAGGACTCAGGAAGG + Intergenic
1134394689 16:13852231-13852253 TGGGTGGGCAGGGCTGGGGAGGG + Intergenic
1134799489 16:17071467-17071489 GGGGAGGGAAGGGCAGAGGAGGG - Intergenic
1135221777 16:20620796-20620818 GAGGTGGCCAGGACAGAGGTGGG + Intronic
1135302872 16:21345830-21345852 GGGGAGGGCAAGAGAGAGGAAGG - Intergenic
1135392138 16:22102815-22102837 GGTGAGGGCAGGTCTGTGGAGGG - Intronic
1135752857 16:25070785-25070807 AGGGTGGGCAGGATTGCCGAGGG - Intergenic
1136299618 16:29325024-29325046 GGGGAGGGCAAGAGAGAGGAAGG - Intergenic
1136346801 16:29680978-29681000 GTTGTGGGGAGGACAGAGGATGG + Intronic
1136428874 16:30185848-30185870 GGGGAGGGCAGGGCTGCGGGTGG - Intronic
1136722663 16:32337602-32337624 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
1136840985 16:33543601-33543623 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
1136856705 16:33664959-33664981 GGGGCTGATAGGACTGAGGATGG + Intergenic
1137551646 16:49441540-49441562 GGGGAGGGCAGGATGGAGGGCGG - Intergenic
1138110697 16:54321461-54321483 GGGGTGGGAAGAGCAGAGGATGG + Intergenic
1138439205 16:57024201-57024223 GGGGTGAGCAGGGATGGGGAGGG + Intronic
1138514245 16:57527154-57527176 GGGCTGGGCAGAATAGAGGAGGG + Intronic
1138605803 16:58088115-58088137 GGGTTGGGCAGTGCTAAGGATGG + Intergenic
1139519877 16:67475217-67475239 GGGGTGGTTAGGACTGTGGCTGG - Intronic
1139666999 16:68464267-68464289 TGAGTGGGCAGCAGTGAGGAAGG - Intergenic
1139734072 16:68972246-68972268 GGGGAGGGCAGAAAGGAGGATGG + Intronic
1139905848 16:70365444-70365466 GGGATTAACAGGACTGAGGATGG + Intronic
1140252353 16:73305172-73305194 GGGGTGGCCAGGTGGGAGGAAGG + Intergenic
1141136640 16:81469876-81469898 GGGATGGGGAGGGATGAGGAGGG + Intronic
1141198962 16:81882736-81882758 GGGGTGAGCAAGAATGAGGTGGG - Intronic
1141480516 16:84303350-84303372 GGGGTGGTGAGCACTGAGGGAGG + Intronic
1141581602 16:85003229-85003251 GTGAGGGGCAGGACTGAGGCTGG + Intronic
1141693009 16:85607066-85607088 GGGGGGGGCGGGAGGGAGGAGGG + Intergenic
1141724041 16:85774542-85774564 GGGGTGAGCAAGAATGGGGAAGG + Intronic
1141861277 16:86718122-86718144 GAGGTGGGGCTGACTGAGGATGG + Intergenic
1142243494 16:88957826-88957848 GTGGTGGGCAGGGCAGAGGGAGG + Intronic
1142256073 16:89014449-89014471 GGGGAGGGCAGGGGAGAGGAGGG + Intergenic
1142364845 16:89644792-89644814 GGGGTGGGCAGGACTGAGGAGGG + Exonic
1142364851 16:89644812-89644834 GGGGAGGGCAGGACTGAAGAGGG + Exonic
1203003768 16_KI270728v1_random:180162-180184 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1203118282 16_KI270728v1_random:1513434-1513456 GGGGCTGATAGGACTGAGGATGG + Intergenic
1203135376 16_KI270728v1_random:1716569-1716591 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1203151150 16_KI270728v1_random:1843898-1843920 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
1142936394 17:3336875-3336897 GGGTTAGGTAGGAGTGAGGAGGG - Intergenic
1143251650 17:5527457-5527479 GGCTTGGGCAGGACTGGGGAGGG + Intronic
1143372922 17:6451611-6451633 AGGGGGGGCAGGCCAGAGGAGGG - Exonic
1143380286 17:6491553-6491575 GGGATGTGCTGGAGTGAGGAAGG - Intronic
1143627349 17:8118107-8118129 GGGCTGGGTAGGGCTGAGGATGG + Exonic
1143765776 17:9136865-9136887 GAGCTGGGCAGGAGTGAGGAAGG - Intronic
1143833431 17:9670705-9670727 GGGGTGGGGAGGACTTCCGAGGG + Intronic
1143858682 17:9872136-9872158 GAGGTGGGCACGAGTGAAGATGG + Intronic
1143974754 17:10821604-10821626 GGGGAGGGGAGGACAGAAGAAGG - Intergenic
1144014821 17:11183832-11183854 GGGGGGGGGAGGAGTGGGGAGGG + Intergenic
1144418173 17:15071232-15071254 GGGGTGGGCTGGATTGGGAAGGG + Intergenic
1144776641 17:17788135-17788157 GGGGGGGCCATGAATGAGGAGGG + Intronic
1144783237 17:17818134-17818156 GAGGTGGGCAGGGCAGAGGGTGG + Intronic
1145948066 17:28793024-28793046 GGGTTGGGGAAGACTGAGGTGGG - Intronic
1145980824 17:29010415-29010437 CGGCTGGGCAGGAATGAGGCAGG + Intronic
1146054632 17:29574917-29574939 GGAGGGGGCAGGAGTGAGGCTGG + Intronic
1146178032 17:30679398-30679420 GAGTTGGGGAGGACAGAGGAGGG + Intergenic
1146178044 17:30679432-30679454 GGAGAGGGGAGGACAGAGGAGGG + Intergenic
1146178090 17:30679544-30679566 GAGGGGGGGAGGACAGAGGAGGG + Intergenic
1146178143 17:30679685-30679707 GAGGGGGGGAGGACAGAGGAGGG + Intergenic
1146178160 17:30679732-30679754 GGAGCGGGGAGGACAGAGGAGGG + Intergenic
1146263032 17:31433928-31433950 AGGGTGGGAAGGGCTGAGGTGGG - Intronic
1146688355 17:34856700-34856722 AGGGTGGGGAGGATGGAGGATGG + Intergenic
1146688407 17:34856859-34856881 GGGGTGGGGAGGATGGAGGGTGG + Intergenic
1146688481 17:34857110-34857132 GGGGTGGGGAGGAACGAGGGTGG + Intergenic
1146736447 17:35242886-35242908 GGACTGGGGAGAACTGAGGAGGG - Intergenic
1147134858 17:38428748-38428770 GGGGTGGGAAGGACGGAAGCAGG + Intronic
1147204222 17:38825125-38825147 GGGCGGGGGAGGACTGAGGCCGG - Intronic
1147228071 17:38996363-38996385 GGAGTGGGAAGGACTGAGCAGGG - Intergenic
1147264107 17:39224875-39224897 GGGGAATGCAGGACTGCGGAGGG + Intronic
1147338330 17:39739878-39739900 GGGGTGAGCAGGGAGGAGGAAGG - Intronic
1147387018 17:40088901-40088923 GGAGTGGGGAGGACTGAGGTTGG - Intronic
1147568574 17:41552773-41552795 GGGGTGGGCAGTTCTGGGTAGGG - Intergenic
1147608001 17:41785294-41785316 GGGCTGGGCCAAACTGAGGAAGG - Intronic
1147645148 17:42028851-42028873 GGGGAAGGCAGGAGTGAGAAGGG - Exonic
1147768260 17:42851175-42851197 AGGGTGGGAAGGACACAGGAAGG - Exonic
1147914498 17:43878467-43878489 TGGATGGGCAGGGGTGAGGAAGG + Intronic
1148073229 17:44920903-44920925 GGGATGGGGAGGGGTGAGGATGG - Intergenic
1148136049 17:45292655-45292677 GGGGTGGGGAGGTGTGAGGTGGG - Intronic
1148232766 17:45947221-45947243 GTGGTGGGCAGGAGAGAGGAGGG + Intronic
1148328044 17:46795298-46795320 GGTGTGGCCAGAACTGGGGATGG + Intronic
1148463528 17:47851287-47851309 GGGGTGGGCGGGAGTGGGGGAGG + Intronic
1148495095 17:48048646-48048668 GGGGTGGGATGGACTGGGCAGGG + Intronic
1148601213 17:48895585-48895607 GGGGAGGGGAGGACACAGGAGGG - Intronic
1148771974 17:50072545-50072567 GGGGTGGGGTGGGGTGAGGATGG + Intronic
1149529046 17:57380335-57380357 GGCCTGGGCAGGACCGTGGAAGG + Intronic
1149559353 17:57597042-57597064 GGAGTGGGCAGGGGTGGGGAGGG + Intronic
1150201307 17:63360783-63360805 AGGGTAGTCAGGACTGGGGAGGG - Intronic
1150343659 17:64387962-64387984 GGGGTGGGCAGGGCGGCGGCTGG - Intronic
1150416916 17:64995426-64995448 GGCAAGGGCAGGGCTGAGGAAGG + Intergenic
1150947607 17:69765384-69765406 GGGGAGGGGAGCACAGAGGAAGG - Intergenic
1151215772 17:72575486-72575508 GGGGTGGGCTGGGCTGAGGGTGG - Intergenic
1151293906 17:73169665-73169687 CGGGTGGTCATGACTGTGGATGG + Exonic
1151360481 17:73585642-73585664 GGGGTAGTCAGGCCTGAGGGAGG - Intronic
1151562277 17:74877068-74877090 GGGCTGGGCAGGGCTGTGGAAGG - Intergenic
1151573946 17:74941830-74941852 GGGCTGGGCAGGGGTGGGGAGGG + Intronic
1151585623 17:75006686-75006708 GGGGTGGCCAGAACAGAGGGTGG + Intergenic
1151627523 17:75286492-75286514 GGGGTGGGCTGGAATGTGAAGGG + Intronic
1151714641 17:75825187-75825209 GCGGGGGGAAGGACTGAGGGTGG - Exonic
1151729853 17:75904782-75904804 GGGGTGGGCAGCTCTGCGGGGGG - Intronic
1151743121 17:75997331-75997353 GGTGTGGCCAGGACACAGGAAGG - Intronic
1151814049 17:76462383-76462405 GCAGTGGGCAGGACTGCTGACGG + Exonic
1151889958 17:76946129-76946151 GGGGTGGGGAGGGATGAGGCTGG + Intronic
1152300241 17:79491176-79491198 GGGGAGGGGAGGAGAGAGGAGGG + Intronic
1152308230 17:79533562-79533584 GGGCTGGGCAGAACTGATGCTGG - Intergenic
1152343436 17:79737733-79737755 GGGGTGGGCTCTACTGAGCAGGG + Intronic
1152460796 17:80441394-80441416 GGGGTCGGCAGTCTTGAGGAGGG - Intergenic
1152710509 17:81868689-81868711 GGGTGGGGGAGGGCTGAGGAGGG + Exonic
1152859086 17:82685222-82685244 GGGGGAGGGAGGACGGAGGAGGG + Intronic
1152875994 17:82786520-82786542 GGGGTGGGGACGGCAGAGGAGGG - Intronic
1152883147 17:82831837-82831859 GGGGTAGCCAGGAGTGTGGAAGG + Exonic
1153259493 18:3209539-3209561 GGGTTGGGCAGGACTGATCATGG - Intronic
1153584340 18:6605781-6605803 GGGGTAAGCAGAACTGAGGATGG + Intergenic
1153915750 18:9742618-9742640 GGGTTGGGGAAGGCTGAGGAAGG + Intronic
1154501754 18:15000919-15000941 GGGGTGGGCAGGGCGGAGGGTGG + Intergenic
1155836171 18:30587590-30587612 GGGGTGGGGAGGAAAGAGAATGG - Intergenic
1155988426 18:32254827-32254849 GGGAGGAGCAGGAGTGAGGATGG - Intronic
1156369634 18:36461095-36461117 AGGGAGGGCAGGGCTGAGAAGGG + Intronic
1156454459 18:37285189-37285211 GGGATGGGCAGGACTGGGGAGGG - Intronic
1156475441 18:37402906-37402928 AGGGTGGGGAGGGCAGAGGAAGG - Intronic
1156967754 18:43115860-43115882 GGGGTAGGCAGGAAAGAGAAAGG - Intergenic
1157620801 18:49016595-49016617 GGGTGGGGGAAGACTGAGGAGGG + Intergenic
1157844854 18:50993770-50993792 GTGGTGTGCAGGGCTGGGGAGGG - Intronic
1158270763 18:55713295-55713317 GGGCTGAGCAGGAAGGAGGAAGG - Intergenic
1158571266 18:58598595-58598617 CGAGAGGGCAGGACTGAGAAAGG - Intronic
1159669834 18:71209757-71209779 GGTGTGCATAGGACTGAGGAAGG - Intergenic
1160358422 18:78248288-78248310 GAGGGGGGCAGCACTGGGGAGGG + Intergenic
1160376283 18:78415042-78415064 GGGGTCTGCAGGACTGTGGAGGG - Intergenic
1160535097 18:79587381-79587403 TGGGTGGGCAGGAGTGGGGCAGG - Intergenic
1160797567 19:953000-953022 GGGTTGGCCAGGACAGAAGAGGG - Intronic
1160943330 19:1630143-1630165 AGGGTGGGCAGGGCTGACGTGGG - Intronic
1160955424 19:1689176-1689198 GGGGTGCTGAGGACTGCGGAGGG + Intergenic
1160984903 19:1833992-1834014 GGGGTGGGCAGCAGTGAGACTGG + Intronic
1161006904 19:1941523-1941545 GGGGTCGGCAGGGCGCAGGAGGG - Intronic
1161018001 19:1992941-1992963 GGGGTGGGGCGGACCGAGGCTGG - Intronic
1161021614 19:2014000-2014022 GAGGTGGTGAGGACTGGGGACGG + Intronic
1161204536 19:3034197-3034219 GGGGTGGGGAGAACGGAGGAGGG - Intronic
1161241521 19:3225896-3225918 GGGGTGGACAGGGAGGAGGAGGG + Intronic
1161281020 19:3445787-3445809 GGTGGGGACAGGACTGGGGAGGG + Intronic
1161329363 19:3678890-3678912 CGGGATGGCAGGACGGAGGAAGG + Intronic
1161370332 19:3907790-3907812 GGGGACGGCACGACGGAGGACGG + Exonic
1161374656 19:3933322-3933344 GGGGTGGAGAGGAGGGAGGAGGG + Intronic
1161484068 19:4525318-4525340 GGGGAGGGAAGAGCTGAGGATGG + Intronic
1161767880 19:6216935-6216957 GGGGTGGGCAGGCCGGCGTAGGG - Intronic
1161999200 19:7732263-7732285 GGGCTGGGCTGGAGTGAGGCCGG + Intronic
1162105450 19:8367187-8367209 GGGGCGGGCAGCACGGAGGTGGG - Intronic
1162110367 19:8396712-8396734 GGGGGGGGCGGGAGGGAGGAGGG + Intronic
1162111133 19:8400362-8400384 GGTGTGGGCACCAGTGAGGAGGG - Intronic
1162140057 19:8580361-8580383 GGGGCGGGCAGGGCAGAGGTTGG + Exonic
1162183917 19:8889708-8889730 GAGGTGGGCAGGACTAAACATGG + Intronic
1162185574 19:8902063-8902085 GGGGTGGGGCGGAGTGAGGAGGG + Intronic
1162301395 19:9847072-9847094 GGGGTGGCCTGGAGTCAGGAAGG + Intronic
1162326793 19:10004214-10004236 GAGGTGGGCAGGACTGCTGGGGG - Intronic
1162418358 19:10551987-10552009 GGGGGTGGGAGGAGTGAGGAGGG - Intronic
1162435423 19:10654944-10654966 GGGTAGGGAAGGAGTGAGGAAGG - Intronic
1162682923 19:12360479-12360501 GGGGTGGAGAGGCCTGAGGCCGG - Intronic
1162893014 19:13747710-13747732 GTAGTGGGCTGGACAGAGGATGG + Intronic
1162921580 19:13906334-13906356 GAGGAGTGCAGGACTCAGGAAGG + Exonic
1162980434 19:14235756-14235778 GGGGCGGGGAGGACAGAGGAGGG - Intergenic
1162980448 19:14235790-14235812 GGAGGGGGGAGGACAGAGGAGGG - Intergenic
1162980466 19:14235840-14235862 GGAGGGGGGAGGACAGAGGAGGG - Intergenic
1163039905 19:14594475-14594497 GGTGAGGGCTGGGCTGAGGATGG - Intronic
1163187509 19:15649340-15649362 GGGCTGGGGAGGACTGAGCAGGG + Intronic
1163405096 19:17117091-17117113 GGGGAGGGCAGGGCTGTGGCAGG - Intronic
1163600909 19:18248432-18248454 GGGGCGGGGAGGGCAGAGGAAGG + Intronic
1163667440 19:18609975-18609997 GGAGGGTGCAGGACTAAGGAGGG - Intronic
1163768955 19:19179210-19179232 GGTGTGGGCAGGGCTGCGTAGGG + Intronic
1163783351 19:19261794-19261816 GGGGTGGGGGGGAATGAGGCGGG - Intronic
1164579834 19:29428046-29428068 GTGGTGGGGAGGATAGAGGAAGG - Intergenic
1164630311 19:29757740-29757762 GGGAGGGGCTGGCCTGAGGAAGG - Intergenic
1164654552 19:29910742-29910764 AGGGTGGGAAGGACGGAGGGAGG - Intergenic
1164750954 19:30654368-30654390 GGGGTGGTGAGGAGTGAAGAGGG - Intronic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1164782733 19:30906549-30906571 GGGGAGGGCAGGGCAGGGGACGG + Intergenic
1164835823 19:31354476-31354498 GGTGTGGGGAGGCGTGAGGAAGG - Intergenic
1165700327 19:37932546-37932568 GGGGCGGGCACCACTGAGGTCGG + Intronic
1166226581 19:41399420-41399442 GAGGTGGGCAGGACTGGGGCAGG + Intronic
1166373019 19:42313038-42313060 GGGGAGGCCAGGACAGAGCATGG + Intergenic
1166503050 19:43355040-43355062 GGGGTGGGCAGGGTGGAGGAGGG - Intronic
1166507402 19:43379692-43379714 GGGGTGGGCAGGGTGGAGGAGGG + Intergenic
1167055050 19:47105134-47105156 GTGGTGGGAAGGAATGAGGAGGG - Intronic
1167097564 19:47382485-47382507 GGGGTAGGAGAGACTGAGGATGG - Exonic
1167148282 19:47695127-47695149 TGGGTGGGCGGGGCTGAGCAGGG + Intronic
1167161888 19:47773316-47773338 GAGATGGGGAAGACTGAGGAAGG + Intergenic
1167271635 19:48509501-48509523 GGGGTGGTCATGTCTGGGGAGGG + Exonic
1167611006 19:50507709-50507731 GGGGTGGCCAGAGCTGAGGTGGG + Intronic
1167644154 19:50696617-50696639 GGGGAGGGAAGGGCAGAGGAGGG - Intronic
1167697489 19:51023980-51024002 GGAGTGGTCAGGATTGTGGAAGG - Intronic
1167731857 19:51264154-51264176 GGTGTTGGCAGGGCAGAGGATGG + Intronic
1167838691 19:52095965-52095987 GGGGTGGGCGGGGCCGAGGCGGG + Intergenic
1168352943 19:55686829-55686851 GGGTTGGGGTGGACGGAGGAGGG + Intronic
1168541446 19:57214453-57214475 GGGGTGGTGAGGGCTGAGGTGGG - Exonic
1168562178 19:57393684-57393706 GGGGAGGGGAGGGCAGAGGAGGG + Intronic
1202691237 1_KI270712v1_random:96697-96719 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
925018865 2:553200-553222 GGTATGGGCAGGGCTGAGGGAGG + Intergenic
925146191 2:1584813-1584835 GGGGTGGGCAGGGCTCAGCTGGG - Intergenic
925919334 2:8628350-8628372 GGAGTGGCCAGAACTAAGGAGGG - Intergenic
926009996 2:9400144-9400166 CAGGTGGTCAGGACTGAGGGAGG + Intronic
926051034 2:9744983-9745005 GGGATGGGGAGGACTGTGGTGGG - Intergenic
926125236 2:10267860-10267882 GTGGAGGGCAGGGCTGGGGAGGG - Intergenic
926145881 2:10396951-10396973 GGGTGGGTGAGGACTGAGGATGG + Intronic
926303340 2:11619059-11619081 GGGGTGGACCGGAGGGAGGAGGG + Intronic
926706618 2:15842014-15842036 GGTGTGTGCAGCACTGAGCAGGG - Intergenic
926935326 2:18081615-18081637 GGGGTGGGCGGGTCTCAGGGAGG + Intronic
927088113 2:19690320-19690342 GAGGTGGGGAGGAAAGAGGAGGG + Intergenic
927195172 2:20541907-20541929 GTGGTGGGAAGAACTGAGGGAGG + Intergenic
927362816 2:22256178-22256200 GGGGTGGGCAGGAGGGAGCAAGG - Intergenic
928375412 2:30769532-30769554 GTTGTGTGCAGGACTGTGGATGG - Intronic
928702968 2:33917787-33917809 GGGAATGGCAGGACTGAGAATGG - Intergenic
929592775 2:43157920-43157942 GGAATGGGCAGGACCCAGGAAGG - Intergenic
930036100 2:47086120-47086142 GGGGTGGCCCGCACGGAGGAGGG - Intronic
930762399 2:55050378-55050400 GGGTTGGGGAGGACTGAGAGGGG + Exonic
931114614 2:59151169-59151191 GGTCTGGGCAGGACTGGGGGTGG - Intergenic
931456270 2:62411860-62411882 GGGGTGGGGAGGATGGAGTAAGG + Intergenic
931710646 2:64987347-64987369 GGGATGAGCAGGTTTGAGGAAGG + Intergenic
932357187 2:71076579-71076601 GGGGTAGGGAGGACGGAAGAAGG - Intronic
932419563 2:71593563-71593585 GGGGTGGGCAGGACGGAGCTAGG - Intronic
932583763 2:73009369-73009391 GGGGTGGGGAGGAGTGGTGACGG + Intronic
932732042 2:74228196-74228218 AAGCTGGGCAGGAATGAGGAGGG - Intronic
932831400 2:74993886-74993908 GGTGTGGGCAGAATTAAGGAAGG + Intergenic
932955343 2:76345293-76345315 GGGGTGGGGGGGAGGGAGGAGGG - Intergenic
933702180 2:85263346-85263368 AGGGTGGGCTGGCCTGGGGAGGG + Intronic
933955152 2:87357253-87357275 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
933969169 2:87456262-87456284 GGACTGGGGAGGACTGAGGAGGG + Intergenic
934273843 2:91563231-91563253 GGGCAGGGCAGGACCAAGGAAGG + Intergenic
934323454 2:91986015-91986037 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
934461785 2:94216821-94216843 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
934765711 2:96878990-96879012 GCAGTTGGCAGGAATGAGGATGG - Intronic
934797248 2:97112667-97112689 GTGATGGGCAGGTGTGAGGAGGG - Intergenic
934836160 2:97590772-97590794 GTGATGGGCAGGTGTGAGGAGGG + Intergenic
934921613 2:98348542-98348564 GGGGAGGGCGGGACGGAGAAGGG - Intronic
935198937 2:100839013-100839035 GGGGTGGGAGAGACGGAGGAAGG - Intronic
935314430 2:101817474-101817496 GGGGTGGGGAGGACTTCAGATGG - Intronic
935667521 2:105525479-105525501 GAGGTGGGGAGGGCTGAGGGTGG + Intergenic
935698571 2:105790677-105790699 GGGGTGCCCAGAACAGAGGAAGG - Intronic
935817379 2:106859505-106859527 GGGATGGGGAAGACTAAGGAAGG - Intronic
936324622 2:111494246-111494268 GGACTGGGGAGGACTGAGGAGGG - Intergenic
936808530 2:116367546-116367568 GGGGTGGGGAGGATAGGGGAGGG - Intergenic
937150935 2:119685199-119685221 GGGGGGGGGCGGGCTGAGGAGGG - Intronic
937274554 2:120675462-120675484 GGAGCGGGCATGACTGAGGGCGG - Intergenic
937283675 2:120736804-120736826 GGGGGAGGAAGGATTGAGGAAGG - Intronic
937921821 2:127136612-127136634 GGGGTGGGGAGGAATGAGGAAGG + Intergenic
938070290 2:128304860-128304882 GGGCTGGGCTGCACTGGGGAGGG + Intronic
938124863 2:128664405-128664427 GGGGAGGGGAGGAGAGAGGAGGG - Intergenic
938146270 2:128836953-128836975 GATGTGGGAAGAACTGAGGAGGG - Intergenic
938464548 2:131517543-131517565 AGGGAGGGCAGGACAGAGGCAGG - Intergenic
938500934 2:131831086-131831108 GGGGTGGGCAAGGCGGAGGGTGG + Intergenic
938943603 2:136190843-136190865 GGAGTGGGGAGGAGGGAGGAGGG + Intergenic
939559815 2:143719105-143719127 GGGGTGGGCAAGACATAGGTTGG + Intronic
939606739 2:144262991-144263013 GGGGAAGGGAGGACAGAGGAGGG + Intronic
940849074 2:158671376-158671398 GGGGTGGGGAGGGCTGGGAAGGG + Intronic
940894240 2:159064911-159064933 GGGGAGGGGAGGAATGAGGACGG - Intronic
940900815 2:159124840-159124862 GGGGTGGGGAGAGCTGAGGCGGG - Intronic
941901845 2:170686358-170686380 GGGGAGGGAAGGAGAGAGGAGGG + Intergenic
942331334 2:174827895-174827917 GAGGTGGGGAGGACTGTGGAAGG + Intronic
942640433 2:178055348-178055370 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
942833228 2:180262034-180262056 GGGGTGGGAAGGAATAAGGAAGG + Intergenic
943498364 2:188653346-188653368 GGGGTGGGAAGAAGTGGGGATGG - Intergenic
943811322 2:192193584-192193606 GGAGTGGGCATGACTGAGGCTGG - Intronic
944581502 2:201136898-201136920 GGAGAGGGCAGGAATGGGGACGG + Intronic
944663203 2:201938301-201938323 GGGGTGGACAGGACATGGGAAGG - Intergenic
944784380 2:203053618-203053640 GGGGTGGGGGGAACTGAAGAAGG - Intronic
945985840 2:216352770-216352792 TGGGAGGGCAGGCTTGAGGAGGG - Intronic
946062852 2:216959668-216959690 GGGGTGGAGAGGACTGAGGCTGG + Intergenic
946278437 2:218648360-218648382 GGGGTGGGCAGAACTGGACAAGG + Intronic
946326261 2:218985977-218985999 GGGGCGGGGAGGACAGAAGAGGG - Intergenic
946411423 2:219517099-219517121 GGGGTGGGCAGGAAAGGGGAAGG + Intronic
946716104 2:222556608-222556630 GGGATGGGGAGGAGTGAGGGGGG - Intronic
947636376 2:231682640-231682662 AGGGTGGGCAGTGGTGAGGATGG - Intergenic
947663183 2:231885240-231885262 GGTGTGGGGAGGACTCAAGATGG + Intergenic
948052970 2:234992270-234992292 GGGCTGGGCAGCAGCGAGGATGG + Intronic
948221299 2:236271930-236271952 AGGGTGGGCAGGCTTGAGGAAGG + Intergenic
948454205 2:238097174-238097196 GGGGTGGGCTGGGGTGGGGATGG + Intronic
948577658 2:238965023-238965045 GGGGGAGGCAGGAGGGAGGAGGG - Intergenic
948594978 2:239073984-239074006 GGGGGCCGCAGGACTGAGGGGGG + Intronic
948604162 2:239124004-239124026 GGGGTGGGGTGGAGTGAGGGGGG + Intronic
948696950 2:239737465-239737487 GGGCTGGGCTGGGCTGGGGATGG - Intergenic
948792465 2:240386072-240386094 GTGCTGGGCTGGACTGAGGTGGG + Intergenic
948840104 2:240644661-240644683 GGGGAGGGGAGGAGAGAGGAAGG - Intergenic
948874811 2:240820669-240820691 GGGGCGGGCGGGGCTGGGGAGGG + Intergenic
948965244 2:241374568-241374590 GGGGTGGGAAGGAGGGAAGAGGG + Intronic
1168848027 20:958684-958706 GTGGAGGGCAGGTCTGAGGGTGG + Exonic
1168893889 20:1310765-1310787 GGGGTGAGGAGGGGTGAGGAGGG + Intronic
1168901384 20:1367927-1367949 GGGGTGGGGTTGACTGGGGAAGG + Intronic
1169018000 20:2307331-2307353 GGTTGGGGCAGGACTGCGGAGGG - Intronic
1169278608 20:4249296-4249318 GCGGGGGGCGGGACCGAGGAGGG + Intergenic
1169753811 20:9022833-9022855 AGGGTGGACAGGACTGTGGATGG - Intergenic
1170041586 20:12045231-12045253 GGGGAGGGGAGGGCTTAGGAGGG - Intergenic
1170155553 20:13265950-13265972 GCGGCTGGCAGGCCTGAGGATGG - Intronic
1170525200 20:17229019-17229041 GGGGTGGGGGGGAGTGAAGAAGG - Intronic
1170597218 20:17815144-17815166 GAGGCAGACAGGACTGAGGATGG - Intergenic
1170770722 20:19330201-19330223 GGGCAGGGCTGGGCTGAGGAGGG + Intronic
1170889493 20:20366620-20366642 GGGCTGGGCTGGACAGAGGATGG + Intergenic
1171417363 20:24992281-24992303 GGGTGGGGCAGGAGTGAGGGAGG + Intronic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1171469994 20:25362605-25362627 GGGGAGGGAAGGACAGGGGAGGG + Intronic
1172622711 20:36330307-36330329 GGGGGCGGCAGGACTGGAGAAGG + Intronic
1172773392 20:37394149-37394171 GGGGGTGGGAGGACGGAGGATGG - Intronic
1172876812 20:38169483-38169505 GGGGTGGGCAGGAGTGTGCCAGG + Intergenic
1173228149 20:41174024-41174046 GGGGTGGGCTGGCCTGGGGTAGG + Intronic
1173248041 20:41349713-41349735 GGGGTGGGCAGCAGCGGGGATGG + Intronic
1173499020 20:43539065-43539087 GTGGTTGGTAGGGCTGAGGATGG + Intronic
1173793662 20:45843891-45843913 GGGGAGGGCAGGGGTGAGCAGGG + Intronic
1173878641 20:46393791-46393813 GAGGTGTGCAGAACTGAGGAGGG + Intronic
1173885765 20:46457655-46457677 GAGGTGAGCTGGGCTGAGGATGG - Intergenic
1173892167 20:46521055-46521077 GGGGAGGGCAGGGCAGAGGAGGG + Intergenic
1174088401 20:48026983-48027005 GGGGTGGGAAGGACAGAGAGAGG - Intergenic
1174136417 20:48383029-48383051 GAGATGGGGAAGACTGAGGAAGG + Intergenic
1174266988 20:49339100-49339122 GGGGAGGGAGGGACTGAGGGAGG - Intergenic
1174384429 20:50178695-50178717 GGGGAGAGCACAACTGAGGAGGG - Intergenic
1174564922 20:51457734-51457756 GGGCTGGGCAGGTCTGGGGTGGG - Intronic
1174606740 20:51767390-51767412 GGGGTGGGAAGGACGGGGGTGGG - Intronic
1174924511 20:54742789-54742811 GGGGTGGGGAGGGATGAGAAAGG + Intergenic
1175129666 20:56779893-56779915 GGGGAGGGGAGGAGAGAGGATGG - Intergenic
1175129686 20:56779937-56779959 GGGGAGGGGAGGAGAGAGGATGG - Intergenic
1175137411 20:56834713-56834735 GGGGTGGGTAGCACTGAGCCAGG + Intergenic
1175176875 20:57117751-57117773 GGGGTGGGCAGTGCTTAGGTGGG - Intergenic
1175176934 20:57117924-57117946 GGGGTGGGCAGTGCTTAGGTGGG - Intergenic
1175176973 20:57118046-57118068 GGGGTGGGCAGTGCTTAGGTGGG - Intergenic
1175222830 20:57427086-57427108 GGGGTGGGTAGCAGTGAGGTGGG - Intergenic
1175237806 20:57525833-57525855 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175237934 20:57526184-57526206 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175237996 20:57526353-57526375 GGGGAGGGGTGGAATGAGGAGGG + Intergenic
1175366053 20:58456995-58457017 GGGGTGGTCAGGGGTGAGGTGGG + Intergenic
1175903045 20:62367424-62367446 GGGGGGGGAAGGAGAGAGGAGGG + Intergenic
1175928621 20:62482800-62482822 GGAGCGGGCAGGCCAGAGGAGGG - Intergenic
1175956928 20:62616115-62616137 GTGGTGGGTAAGAGTGAGGAGGG + Intergenic
1175988631 20:62776751-62776773 GAGGAGGGCAGGGCGGAGGAGGG + Intergenic
1175990254 20:62785237-62785259 GGGGTGGGTGGGACAGAGGTGGG + Intergenic
1176010448 20:62890870-62890892 GGGCTGGTCAGGACTCAGCAGGG + Intronic
1176031379 20:63014685-63014707 GGGGTGGGCGGGTCTGGGGGAGG - Intergenic
1176102328 20:63370216-63370238 GGGGAGGGCAGGGCTGAGGAGGG - Intronic
1176238446 20:64064965-64064987 GGGCTGGGCAGAACTGATGGGGG + Intronic
1176289463 21:5036446-5036468 GGGATGGGCAGGAAAGAGGCAGG + Intronic
1176426605 21:6552514-6552536 AGGGTGGGCAGCGCTGGGGACGG - Intergenic
1176592461 21:8657949-8657971 GGTGTGGGCAGGACCAAGGCAGG - Intergenic
1176592876 21:8659804-8659826 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1177202710 21:17975753-17975775 GGGGTGGGGAGACATGAGGATGG - Intronic
1177779608 21:25607880-25607902 GGGGTGGGGGGGAATGGGGAAGG + Intergenic
1178369948 21:32018987-32019009 GGGATGGGCTGGCTTGAGGATGG + Intronic
1178427700 21:32492118-32492140 TGGGTGGGCAGGCCTGCAGAGGG + Intronic
1178537032 21:33418916-33418938 GGGCTGGGCAGGTCTGAGAGAGG - Intronic
1179447851 21:41445700-41445722 AGGGTGGACAGGGCTGAGGGAGG + Intronic
1179624550 21:42641396-42641418 GGGGTGAGCAGGACCCATGAAGG + Intergenic
1179629599 21:42668238-42668260 GGGGATGGCAGGAATGGGGAGGG - Intronic
1179647596 21:42784906-42784928 GGGGTGGGGTGGACTGGGGGTGG - Intergenic
1179702096 21:43160836-43160858 AGGGTGGGCAGCGCTGGGGACGG - Intronic
1179867767 21:44227141-44227163 GGGATGGGCAGGAAAGAGGCAGG - Intronic
1179901202 21:44395710-44395732 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901227 21:44395788-44395810 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901252 21:44395866-44395888 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901288 21:44395982-44396004 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901309 21:44396050-44396072 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901321 21:44396089-44396111 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901367 21:44396233-44396255 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901378 21:44396263-44396285 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901399 21:44396331-44396353 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901417 21:44396381-44396403 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901488 21:44396623-44396645 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901570 21:44396859-44396881 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1179901577 21:44396879-44396901 GGGGTGTGGAGGGCTGTGGAGGG + Intronic
1180109942 21:45643086-45643108 GTGGTGGGCAGGGCCGTGGATGG - Intergenic
1180275320 22:10635096-10635118 GGTGTGGGCAGGACCAAGGCAGG - Intergenic
1180275729 22:10636946-10636968 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1180371773 22:12044740-12044762 GGGGTGGGGGGGAGTGGGGAAGG + Intergenic
1180549822 22:16530124-16530146 GGTCTGGGCAGGACCAAGGAGGG - Intergenic
1180550211 22:16531886-16531908 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1180621817 22:17167530-17167552 AAGCTGGGCAGGACTGGGGATGG - Intergenic
1180709390 22:17829532-17829554 TGGATGCACAGGACTGAGGAAGG + Intronic
1180947413 22:19704127-19704149 GGGTGGGGCAGGAAGGAGGAAGG + Intergenic
1181045158 22:20210863-20210885 GGGGTGGCCAGGGCTGTGCATGG + Intergenic
1181480749 22:23197816-23197838 GCGGTGGGGAGGAATGGGGAGGG + Intronic
1181631839 22:24155764-24155786 GGGGTGGCCAGGAGTGCGGCAGG - Intronic
1181774247 22:25148221-25148243 GGGGGTGCCAGGACTGAGAAAGG - Intronic
1182351447 22:29702346-29702368 GGGGAGGGCCGGCCTGAGGCTGG - Intergenic
1182446889 22:30394960-30394982 GGGAAGGGCAGGCCTGGGGAAGG + Intronic
1182503306 22:30764279-30764301 GGGGTGGGCGGGGATGAGGAGGG + Intronic
1182511162 22:30821529-30821551 GAGGTGGGGAGGGTTGAGGAAGG + Intronic
1182771606 22:32800913-32800935 GGGTTGGACATGACTGGGGAGGG - Intronic
1183034911 22:35134239-35134261 GGAGTGGGTGGGACTGGGGAGGG - Intergenic
1183271171 22:36863445-36863467 GGGGTGGTGGGGGCTGAGGAAGG - Intronic
1183346720 22:37312179-37312201 GGGGTGCCCAGGTCTGGGGACGG + Intronic
1183410224 22:37650625-37650647 GGGGTGGGCACGGCAGTGGACGG - Exonic
1183459991 22:37944084-37944106 AGGATGGGCTGGCCTGAGGATGG + Exonic
1183728733 22:39605076-39605098 TGGGTGGGCAGCTCTGGGGATGG - Intronic
1184066910 22:42126420-42126442 GGGGTAAGCAGGAATGAGGCAGG + Intergenic
1184069637 22:42140124-42140146 GGGGTAAGCAGGAATGAGGCAGG + Intergenic
1184149933 22:42631931-42631953 GGGGCAGCCAGGACTGAGGTGGG + Intronic
1184296176 22:43526951-43526973 CAGGTGTGCAGGACTCAGGATGG - Intergenic
1184303435 22:43577779-43577801 GGGGAGGGAAGGAGTGAGGAGGG - Intronic
1184328588 22:43811325-43811347 GGGGAGGGGAGGAGAGAGGAGGG + Intronic
1184529416 22:45045075-45045097 GGCGTCGGCAGGGCTGAGGCAGG + Intergenic
1184903750 22:47464796-47464818 GGCGAGGGCAGGAATGTGGATGG - Intronic
1184933719 22:47702236-47702258 GGGGTGGGGAGGGGAGAGGAGGG - Intergenic
1184947057 22:47811096-47811118 GGGGTAGATGGGACTGAGGATGG - Intergenic
1185169437 22:49284107-49284129 GGGGTTTCCAGGAATGAGGAGGG + Intergenic
1185208787 22:49555062-49555084 GGGCTGGGGTGGACTGCGGAGGG + Intronic
1185221908 22:49633264-49633286 AGGGAGGCCAGGACTGGGGAGGG - Intronic
1185253894 22:49821138-49821160 TGGGTAGGCAGGACTGAAGGAGG - Intronic
1185299431 22:50071908-50071930 AGGGTGGGCAGGACAGAGATGGG + Intronic
1185333098 22:50260390-50260412 GGGGAGGGCAGGAGTGACGTGGG + Intronic
1185415378 22:50706402-50706424 GGGGTGTCCAGGACAGATGACGG + Intergenic
949494588 3:4619756-4619778 GGGGAGGGCAGAAGAGAGGAGGG - Intronic
949512048 3:4774922-4774944 GGGGTGGGCAGGAGAGAGGAAGG + Intronic
949943664 3:9173680-9173702 GAGGTGGGCAGGGGTGGGGAGGG - Intronic
949999344 3:9644753-9644775 GGGGTGGAAAGGACTGAGATGGG + Intergenic
950222503 3:11206930-11206952 AGTGTGGGGAGGTCTGAGGAGGG + Intronic
950469947 3:13178372-13178394 GGTGTGGTCAAGAGTGAGGATGG + Intergenic
950485898 3:13273861-13273883 GGGGAGGGCATGAGAGAGGAGGG - Intergenic
950678354 3:14568223-14568245 GGGGAGGGACAGACTGAGGAGGG + Intergenic
950706923 3:14788576-14788598 GGGCTGGGCTGGGCTGAGGTGGG + Intergenic
950709296 3:14803536-14803558 GGGGCTGGAAGGACTGAGCAGGG + Intergenic
951060750 3:18204254-18204276 TGGGGTGGCAGGAGTGAGGATGG - Intronic
951073556 3:18362205-18362227 GGGGTGGGCTGGAATAAAGAAGG - Intronic
951100826 3:18685887-18685909 GGAGTAGAGAGGACTGAGGATGG - Intergenic
951145266 3:19219237-19219259 TGGGTAGGCATTACTGAGGAGGG - Intronic
951344008 3:21523856-21523878 GAGGAGGGCAAGACTGGGGAAGG + Intronic
952261740 3:31746824-31746846 GGGGTGGGGGGGAGGGAGGAGGG + Intronic
952858319 3:37791713-37791735 CATGTGGGCAGGACTGTGGAGGG - Intronic
952979374 3:38722606-38722628 AGAGTGGGCAAGACTGATGATGG - Intronic
953216650 3:40924576-40924598 GGGCTGGCCAGGACCAAGGAAGG - Intergenic
953681156 3:45039374-45039396 GGGATGGGCTGGGGTGAGGAAGG - Intergenic
953829586 3:46284241-46284263 GGAGTGGGCAGGGGTGGGGAGGG + Intergenic
954117411 3:48474847-48474869 GGGGTGAGCAGGAATGAGTTAGG - Intronic
954176152 3:48847439-48847461 GCGGCGGGCAGGACTGAGGCTGG + Exonic
954214241 3:49115690-49115712 GGGGTGGGAAGGACGAAGAATGG - Intronic
954361203 3:50123804-50123826 GGGGAAGGGAAGACTGAGGAAGG + Intergenic
954695301 3:52421396-52421418 GGGCTCGGCAGTACTGAGTAGGG - Intronic
955286317 3:57644753-57644775 GGGGAGGGGAGGGGTGAGGAGGG + Intronic
955349297 3:58182181-58182203 GGGGAGGGGAGGAGGGAGGAGGG + Intergenic
955916562 3:63912967-63912989 GGGGAGGGGAGGAGAGAGGAGGG - Intronic
956011679 3:64838358-64838380 GGGGTGGGCTGGATTGAGTTAGG - Intergenic
956159672 3:66335899-66335921 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
958028888 3:88083024-88083046 GGAGTGAGGAGGAGTGAGGAGGG - Intronic
959185253 3:103038647-103038669 GGGGAGGGAAGGAGGGAGGAAGG + Intergenic
959884417 3:111482214-111482236 GGGGGGGGCAAGACAGGGGATGG + Intronic
959893310 3:111580656-111580678 GGGAAGGGGAGGACAGAGGAGGG - Intronic
960419240 3:117423199-117423221 GTGATGGGAAGGACTGAGAAAGG - Intergenic
960575006 3:119220654-119220676 GGGGTGAGCTGGAGTGGGGAGGG + Intronic
960950207 3:122994133-122994155 TTGGTGGGCAGCACAGAGGAGGG - Intronic
961002395 3:123383026-123383048 GGGGTGGGGGAGGCTGAGGATGG - Intronic
961081383 3:124032259-124032281 GGGCTGGGGAGGAATGGGGATGG - Intergenic
961314137 3:126023009-126023031 GGGATGGGCGGCACTGAGTAGGG + Intronic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
961739237 3:129022447-129022469 GGAGTGGCCAGGACAGCGGAAGG + Intronic
961844262 3:129747842-129747864 TGGGTGGGAAGGAGTGAGTACGG - Intronic
962384416 3:134921300-134921322 GGGGTGGGCAGTGGTGAGGAGGG - Intronic
963736092 3:149019392-149019414 GAGGTGAGCAGGACTGTGGAGGG - Intronic
963974004 3:151460819-151460841 GGGGCGGGGAGGGCTGAGGGTGG - Intergenic
964661343 3:159123603-159123625 TGGGTGGGCAGGACAGGGGCTGG + Intronic
964747056 3:160022332-160022354 GTGCTGGGCAGGACTGTGCATGG - Intronic
964847065 3:161055736-161055758 GGGGTGGCAAGGGGTGAGGAAGG - Intronic
964892616 3:161555118-161555140 GTGGTGGGCAGGACTGGAGTGGG - Intergenic
964915468 3:161836323-161836345 GGGGTGGTAAGGACTGTAGAGGG - Intergenic
965019862 3:163215302-163215324 AGGCTGGGCAGAAGTGAGGATGG - Intergenic
965362076 3:167753568-167753590 GGGGTGGGGAGCAGTGAGGTGGG + Intronic
965559036 3:170044519-170044541 GGTGTGGGCAGGCCTCAGTAGGG + Intronic
966117119 3:176478332-176478354 CCGGTGGGCAGGACTTAGAATGG - Intergenic
966655708 3:182356087-182356109 GGGGAGGGCAGGGCTGTGGTAGG - Intergenic
966863727 3:184244724-184244746 GGGGTGAGCAGGGGAGAGGAAGG + Intronic
967082550 3:186063750-186063772 GGGGTAGGGAGTACTGGGGATGG - Intronic
967171358 3:186825584-186825606 GGGGCGGACAGGACTGGAGAGGG - Intergenic
968035620 3:195544975-195544997 GGGGTGGAAAGAACTCAGGAAGG - Intergenic
968047274 3:195631389-195631411 AGGGTTGGCAGGAGTGAGGCAGG - Intergenic
968287864 3:197518783-197518805 GGGGGGGGTCGGCCTGAGGAGGG - Intronic
968307339 3:197658535-197658557 AGGGTTGGCAGGAGTGAGGCAGG + Intergenic
968469143 4:770291-770313 GGGGAGGGCTGGGGTGAGGAAGG - Exonic
968517891 4:1022525-1022547 GGGGTGTGCAGGAGGGCGGACGG + Intronic
968522550 4:1040621-1040643 GGGGTGACCAGGACTGCAGAGGG + Intergenic
968623640 4:1615903-1615925 GGGATGGGCAAGGCTGTGGATGG + Intergenic
968628255 4:1637636-1637658 GGGGTGGGCAGGGGTGGGCAGGG + Intronic
968813414 4:2810047-2810069 GGAGTGGCCATGGCTGAGGAGGG + Intronic
968889226 4:3359043-3359065 GGGGAGGGGAGGAGGGAGGAGGG - Intronic
968909293 4:3469422-3469444 TGGGTGGGCAGGGCTGATGGTGG + Intronic
968909858 4:3472171-3472193 GAGGTGGGCACGGCTGGGGAGGG + Intronic
969145988 4:5124472-5124494 TGGGTGGCCAGGACTGAGTTTGG + Intronic
969331304 4:6474706-6474728 GGGGTGGTGAGGGGTGAGGAGGG - Intronic
969335113 4:6503222-6503244 GGAGTGGGGTGGGCTGAGGAAGG - Intronic
969346505 4:6573854-6573876 GGGGTGGACAGGACAGAAGGAGG + Intergenic
969423518 4:7110737-7110759 GGGCTGGGCACCACTGTGGAGGG + Intergenic
969592934 4:8132189-8132211 GGGGTGAGCATGAGTGAGCAGGG - Intronic
971614940 4:28776716-28776738 GGGGTGGGGAAAAGTGAGGAGGG + Intergenic
972124979 4:35753302-35753324 GGGGTGGAGAGAAGTGAGGATGG - Intergenic
973758537 4:54097561-54097583 GGGCTGGGCAGGGCTGGGGTGGG + Intronic
973933740 4:55819913-55819935 GAGGTGGGCAGGACTCACCAAGG + Intergenic
974134971 4:57803940-57803962 GAGCTGGGCATGAGTGAGGAGGG + Intergenic
975575039 4:75854041-75854063 AGGGTGGGGAGGATAGAGGATGG + Intergenic
975579142 4:75891394-75891416 GGGGTGGGAGGGAGTGGGGAAGG - Intronic
976389192 4:84492474-84492496 GGGGTGGGCAGGGCAGGGCAGGG + Exonic
976544352 4:86317366-86317388 GAGGTGGGCAGGACTAAGGAGGG - Intronic
976570132 4:86597676-86597698 GGGTTGGGCAGGATAGAGCAGGG - Intronic
976862947 4:89688339-89688361 GAGGTGGGCAAGCCTGAAGAGGG + Intergenic
977210720 4:94214598-94214620 GGAGAGGGAAGGACTGAGGGAGG + Intronic
977279876 4:95026700-95026722 GGGCAGGGCAGGACAGGGGAGGG - Intronic
977600750 4:98931395-98931417 GGGGAGGGGAGGACAGGGGAGGG - Intergenic
977906779 4:102485779-102485801 GGGGTGGGGAGGACAGAGAGAGG + Intergenic
978132849 4:105220572-105220594 AGATTGGGCAGGACTGAGGAAGG + Intronic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
979442605 4:120769325-120769347 GAAGTGGGCAGTGCTGAGGAGGG + Intronic
979494625 4:121369821-121369843 GGGGTGGACAGGGCTGATGCAGG + Intronic
980568889 4:134584128-134584150 GGGGAGGGAAGGAAAGAGGAGGG - Intergenic
981088630 4:140709722-140709744 GGGGTGGGGTGGTCTGGGGATGG + Intronic
981569798 4:146139402-146139424 TGGCAGGGCAGGACTGAGGCAGG - Intergenic
981619084 4:146673435-146673457 GTGGTGGGGAGGACTCAGGGTGG + Intergenic
981786235 4:148482503-148482525 GGGCTGGGGAGGCCTCAGGAAGG + Intergenic
983479531 4:168256085-168256107 GGGGTGGGGGGGAGTGGGGAGGG - Intronic
984252262 4:177348609-177348631 GGGGTGGGCAGCATGGAGAATGG - Intronic
984473007 4:180200960-180200982 AGGGGGAGCAGGACTGAGCATGG - Intergenic
984488616 4:180403244-180403266 GGTGTGTGCAGGACGGAGGAAGG - Intergenic
984820408 4:183876686-183876708 GGGCTGGGCAGCAGAGAGGAGGG - Intronic
985025776 4:185737690-185737712 GTGGTGGGCAGATATGAGGAAGG + Intronic
985151890 4:186955605-186955627 GGGGTTGTCACAACTGAGGAGGG + Intergenic
985308274 4:188568343-188568365 GGGGTGGGAGGGAGTGGGGAGGG - Intergenic
985607355 5:865154-865176 GGGGTGGACAGAACTGGGGACGG + Intronic
985746459 5:1651537-1651559 GGGGAGGGCGGGGCTGGGGAGGG + Intergenic
985966474 5:3342222-3342244 TGGGTGAGCAGGACAGAGAAAGG + Intergenic
986279992 5:6314954-6314976 GGGGTGAGCAGGAGCGTGGATGG + Intergenic
986517733 5:8581235-8581257 GGAGAGGGCAGGTATGAGGAGGG - Intergenic
987109529 5:14672348-14672370 TGGGAGGGCCAGACTGAGGAAGG - Intronic
987628530 5:20435461-20435483 GGGGTTTGCAGGCCTGAGGTTGG - Intronic
987878470 5:23711214-23711236 GGGGTGAGCAGGACGGGAGAGGG - Intergenic
988490713 5:31702957-31702979 GGAGAGGGCCTGACTGAGGATGG + Intronic
988526284 5:31989917-31989939 GGGGATGGCAGAACTGAGGCAGG - Intronic
990457825 5:56005154-56005176 GGGGAGGGGAGGACAGAGGAGGG - Intergenic
990515429 5:56527203-56527225 GGGCTGGGCAGGGCTGGGCAAGG + Intronic
990532724 5:56689740-56689762 TGGGTGGGTAGGGCAGAGGATGG - Intergenic
990631827 5:57678896-57678918 GGTGTGGGCGGGAGTCAGGAAGG + Intergenic
991445737 5:66698370-66698392 GGAGGGGGCAGGAGTGGGGATGG - Intronic
992646082 5:78812346-78812368 GGGGAGGGGAGGACAGAGCATGG + Intronic
992849904 5:80796846-80796868 GAGGTGGGCAGGGTGGAGGAGGG - Intronic
993506693 5:88717258-88717280 AAGGTGGGCAGGATTGAGAAAGG - Intergenic
994043552 5:95284463-95284485 GGGGTGGGCAGGAGCAAGGGCGG - Exonic
994850130 5:105044192-105044214 GGGGAGGGCAGGAGTGACAAAGG + Intergenic
994934692 5:106239094-106239116 GGGGAGGGCATGACAGAGGATGG + Intergenic
994954418 5:106510169-106510191 GGGGAGGGGAGGGCAGAGGAGGG - Intergenic
996023283 5:118615290-118615312 GGGCTGGGCAGGGCTGTGCAGGG - Intergenic
996347394 5:122501783-122501805 GGAGGGGGCAGAAGTGAGGAGGG + Intergenic
996415624 5:123207204-123207226 GGGGTGGGGAGGAAGGAGGAAGG - Intergenic
997197419 5:131989228-131989250 GGGGTGGCCAGTGCTGATGAGGG + Intronic
997211642 5:132080449-132080471 GGGGTGGGCAGGTGTGTGGTTGG - Intergenic
997410067 5:133684277-133684299 GGGTCGGGGAGGACAGAGGAAGG - Intergenic
997420643 5:133764199-133764221 GAGCTGGGCAGGAAGGAGGAAGG - Intergenic
997577768 5:134996079-134996101 GGGGTAGGGAGGACAGAGAAGGG + Intronic
997984266 5:138491031-138491053 GGGATGGGCAGGACTGATGAGGG + Intergenic
998091738 5:139375039-139375061 GGGCTGGGGAGGACAGAGGAGGG - Intronic
998177769 5:139912354-139912376 GGGGTGGGCAGGGCTGGGCTGGG - Intronic
998382280 5:141734447-141734469 GTGGAGGGCAGGAATCAGGAAGG + Intergenic
999376687 5:151091640-151091662 GGGGAGTGCAGGAGTGGGGAAGG - Intronic
999671789 5:153964909-153964931 GGGATGGGGAGGACTGAACAAGG + Intergenic
999769115 5:154761660-154761682 GGAGTGGCCAGGAGAGAGGATGG + Intronic
1001396705 5:171423162-171423184 GGGGTGGGCAGGACAGTGTCTGG - Intronic
1001400737 5:171445013-171445035 GGGTAGGGCTGGACTGGGGAGGG + Intronic
1001446594 5:171789775-171789797 AGGCAGGGCAGGAGTGAGGATGG + Intronic
1001549657 5:172593784-172593806 GGGGCTGCCAGGACTCAGGAGGG + Intergenic
1001773177 5:174311065-174311087 GGGGTGGGCAGGTTCCAGGAAGG + Intergenic
1001896325 5:175384994-175385016 GGGGAGGGAAGGAGAGAGGAAGG + Intergenic
1001963840 5:175896380-175896402 GGGGAGGGGAGGGCTGGGGAAGG - Intergenic
1002617370 5:180464215-180464237 GGGGTGGGCCGGAGACAGGAGGG - Intergenic
1002661394 5:180792985-180793007 GGGGAGGGCAGGCCAGGGGACGG + Exonic
1002697574 5:181100918-181100940 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1002697594 5:181100953-181100975 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1002826852 6:781803-781825 GGGTTGGACAGATCTGAGGAAGG + Intergenic
1003337284 6:5185923-5185945 AGGGGAGGCAGGAGTGAGGAGGG + Intronic
1003870147 6:10396092-10396114 GGGGTGGGGAGGATGGGGGAGGG - Intronic
1004160488 6:13208613-13208635 GGGGTGGGCAGCAATGACGTTGG - Intronic
1004314274 6:14572419-14572441 GGGGTGGGCTGGGGTGAGGCAGG - Intergenic
1004717714 6:18234188-18234210 GGGGTGGGGGGGACGGGGGAGGG + Intronic
1004772115 6:18795798-18795820 AGAGTGAGCAGGACAGAGGAGGG + Intergenic
1004866300 6:19856581-19856603 GAGGGGGGCAGGAGTGGGGAAGG + Intergenic
1005001577 6:21247138-21247160 GGGCTGGGCAGGACAGAGACTGG - Intergenic
1005685283 6:28247972-28247994 GGGTGGGGTAGGACTGGGGAGGG + Intronic
1006299238 6:33185088-33185110 GGGGTGGGAAGGAAGGAGAAAGG + Intronic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006694724 6:35921146-35921168 GGGTGGGGCGGGACTGAGGGCGG - Exonic
1006897224 6:37478921-37478943 AGGGTTGGCAGGACTGGGGTGGG + Intronic
1006984234 6:38166807-38166829 GGGCTGGGAAGGATTGAGGATGG - Intergenic
1007292782 6:40799775-40799797 GAGGTGGGCAGGACAGTGAAAGG + Intergenic
1007302203 6:40875934-40875956 GGTGGGGGCAGGACTGAGGGAGG + Intergenic
1007355440 6:41311962-41311984 GTGCTGGGCAGGACTCAGGGAGG - Intergenic
1007475402 6:42116475-42116497 GGGATGGTGAGGACTGAGGAAGG - Intronic
1007692465 6:43711524-43711546 GGGGTGGGTTGGGCAGAGGAGGG + Intergenic
1007775649 6:44223172-44223194 GGCGTGGGCAGGGCTTGGGAAGG + Intronic
1007996252 6:46311304-46311326 GGGTTGGGAAAGGCTGAGGATGG + Intronic
1008449635 6:51635673-51635695 GGTGTGGGGAGGATTGGGGATGG + Intronic
1008566981 6:52778139-52778161 TGAGTGGGCAGGACTGTTGAAGG - Intergenic
1008570527 6:52812204-52812226 TGAGTGGGCAGGACCGTGGAAGG - Intergenic
1008845116 6:55953259-55953281 AGGGTGGGCGAGACGGAGGAAGG + Intergenic
1008920992 6:56843873-56843895 AGGGTGGGCGGGCCTGGGGAGGG - Intronic
1009413377 6:63392221-63392243 CTGGTTGGCAGCACTGAGGAAGG - Intergenic
1009598425 6:65766373-65766395 GTGGTGTGCAAGACTGAGAAAGG + Intergenic
1010581844 6:77609250-77609272 GGGGTGGGCAAGTCTGAGTCTGG - Intergenic
1010845235 6:80699239-80699261 GGGGTGGGAAGGTGTGAGGTGGG - Intergenic
1010851146 6:80779944-80779966 GGGGTGGGGGGGAGTGGGGAGGG - Intergenic
1010926826 6:81753904-81753926 TGGGCGGGCAGGGCTGAGCAGGG - Intergenic
1011195105 6:84773173-84773195 TGGGTGGGAAGCACTGAGGAAGG + Intergenic
1011494265 6:87923181-87923203 GGGGTAGGAAGGAGAGAGGAGGG - Intergenic
1013293734 6:108740395-108740417 GGGGTGGGCAGGTGAGAGGGAGG + Intergenic
1013341662 6:109221490-109221512 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1013415047 6:109917529-109917551 GGGGTGGGTGGCACCGAGGAGGG - Intergenic
1013490590 6:110642793-110642815 GGGGAGGGGAGGAGTCAGGAAGG + Intronic
1013833517 6:114303297-114303319 GGGGGTGGGGGGACTGAGGAAGG - Intronic
1015155331 6:130088652-130088674 GGAGTGGGAAGGAATGAGGCAGG - Intronic
1015430729 6:133128010-133128032 TGGGTGGAGAGGGCTGAGGAAGG + Intergenic
1015601729 6:134917017-134917039 GAGGTGGGTAGGAGAGAGGATGG + Intergenic
1016014166 6:139166845-139166867 GAAGTGGGCAGGAGAGAGGATGG - Exonic
1016098146 6:140063269-140063291 GGGCTGGGAATGAGTGAGGAGGG + Intergenic
1016480090 6:144471213-144471235 AGGGTGGGAAGGAGGGAGGAGGG + Intronic
1016614564 6:146030334-146030356 TGGGTGGGCAGTACTGAGAAGGG - Intronic
1017014273 6:150087580-150087602 GGGAAGGACAGGACTGTGGAGGG - Intergenic
1017715942 6:157213263-157213285 AGGGTGGGCCGGGCTGGGGAGGG - Intergenic
1017716490 6:157217202-157217224 AGGGTGGGCCGGGCTGGGGAGGG + Intergenic
1017988701 6:159467509-159467531 GGGGAGGGGAGGAAGGAGGAAGG + Intergenic
1018258369 6:161944513-161944535 TGGGTGGGAAGGACAGAGAAGGG - Intronic
1018632924 6:165835810-165835832 GGGCTGAGCAGGACCCAGGAAGG + Intronic
1018911080 6:168101240-168101262 GGGGTTTCCAGGACTGAGGCGGG - Intergenic
1019138661 6:169929213-169929235 GGGGTGGTCAGCAGTGAAGATGG + Intergenic
1019355874 7:578617-578639 AGGGTGGGTAGAGCTGAGGAGGG - Intronic
1019483591 7:1277331-1277353 GGGGAGGGAGGGAGTGAGGAGGG - Intergenic
1019495809 7:1340148-1340170 GGGCTGGACAGGAGAGAGGATGG - Intergenic
1019557248 7:1638707-1638729 GTGATGGGCAGGGCTGGGGAGGG + Intergenic
1019968819 7:4523872-4523894 GGGAAGGGCAGGAAAGAGGAAGG + Intergenic
1021600286 7:22357243-22357265 GGGGAGGGGAGGAGAGAGGAGGG - Intergenic
1021687516 7:23201742-23201764 GGGGAGGGCAGGAAAGGGGATGG - Intergenic
1022489926 7:30808807-30808829 GGGGTGGGGAGGGCCGACGACGG - Intronic
1022506597 7:30911637-30911659 GGGCTGGGCAGGGCTGAGGGCGG + Intergenic
1023402983 7:39803894-39803916 GGGGTGGGCAGAAGTGGGCAGGG + Intergenic
1023518492 7:41027334-41027356 GGCCAGGGCAGGGCTGAGGATGG + Intergenic
1023746745 7:43329187-43329209 GGGGTGGGAAGGGGTGAGGCTGG + Intronic
1023754072 7:43399565-43399587 GAGCAGGGCAGGACTGGGGAGGG + Intronic
1023822201 7:43986527-43986549 GGGGTCCTGAGGACTGAGGATGG - Intergenic
1023823775 7:43995103-43995125 AGGGTGGGGAAGACTGGGGATGG + Intergenic
1023847739 7:44132173-44132195 GGGAGGGTCAGGACTGAGGTGGG + Intergenic
1023862513 7:44224949-44224971 GGGCTGGGCAGGGCTGGGAAAGG - Intronic
1024008057 7:45241760-45241782 GGAGTGAGCAGGATGGAGGAGGG + Intergenic
1024051142 7:45624190-45624212 GGGCTGGGCAGGACAGAGCCAGG + Intronic
1024311244 7:47971308-47971330 TGGGTTACCAGGACTGAGGATGG + Intronic
1024646353 7:51374243-51374265 GGGGTGGGCAGAAGTGGGCAGGG - Intergenic
1024661511 7:51499879-51499901 GGTGTGAGCAGTAGTGAGGAAGG + Intergenic
1024695125 7:51847933-51847955 GGGGAGGGCAGGAGAGAGTATGG + Intergenic
1024768668 7:52691625-52691647 GTGGTGGGAAGGGCAGAGGATGG + Intergenic
1025099435 7:56122947-56122969 CGGGTTGGCAGGGCTGGGGAAGG + Intergenic
1025124839 7:56336142-56336164 GGGGTGGGAGGGAGGGAGGAAGG + Intergenic
1025607173 7:63047743-63047765 GGGCTGGGAAGGGCTGAGGAAGG - Intergenic
1025811956 7:64881225-64881247 GGAGTGGGATGGACTGAGGCTGG + Intronic
1026122508 7:67550281-67550303 GGGGAGGGGAGGAGAGAGGAGGG - Intergenic
1026642445 7:72139493-72139515 AGGGTGGGCATGGCTGAGGTGGG - Intronic
1026674385 7:72416856-72416878 GGGGTGGGCTGGGCTGAGCTGGG + Intronic
1026714337 7:72774119-72774141 AGGAAGGGAAGGACTGAGGAAGG + Intronic
1026738907 7:72966191-72966213 GGAGTGGACAGGACTGAGGTCGG - Intronic
1026789918 7:73324821-73324843 GGAGGGGACAGGACTGAGGTCGG - Intronic
1026823643 7:73567199-73567221 AGGGTGGACTGCACTGAGGAAGG + Intergenic
1026902273 7:74043805-74043827 TGGGTGGGAAGGGCTGGGGAGGG + Intronic
1026968638 7:74454859-74454881 TGGGTGGAGAGGACAGAGGAGGG + Intronic
1027104826 7:75398878-75398900 GGAGTGGACAGGACTGAGGTCGG + Intronic
1028128889 7:87147238-87147260 GTGGTGGGCTGGAGTGAGGCAGG - Intergenic
1028903576 7:96128090-96128112 GGGGTGAGCAGGGCTGAGTGTGG - Intronic
1029123982 7:98285033-98285055 GGGGAAGGCAGGAGTGGGGAAGG + Intronic
1029192965 7:98784880-98784902 GGGGTGGCCAGGGATGAGGAGGG + Intergenic
1029238358 7:99142565-99142587 GGGCTAGGCAGGAATGAGGGCGG + Intronic
1029665063 7:101989750-101989772 GGGGTGGGAAGGACGGGGGTAGG - Intronic
1029750467 7:102539941-102539963 GGGGTCCTGAGGACTGAGGATGG - Intronic
1029752042 7:102548516-102548538 AGGGTGGGGAAGACTGGGGATGG + Intronic
1029768419 7:102639049-102639071 GGGGTCCTGAGGACTGAGGATGG - Intronic
1029769994 7:102647610-102647632 AGGGTGGGGAAGACTGGGGATGG + Intronic
1030289194 7:107855475-107855497 GTGGTTGGCAGGAGTGAGGGGGG + Intergenic
1030293970 7:107900842-107900864 GGGGTTGTCAGGACAGTGGAAGG + Intronic
1030493947 7:110273550-110273572 GTAGTGGGTAGGACTAAGGAAGG + Intergenic
1032619335 7:133511922-133511944 GTGGTGGGAAGGAATGAGAAGGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032795011 7:135269965-135269987 GGGTAGGGCAGGCCTGAGGTAGG - Intergenic
1033046906 7:137970602-137970624 GGGGTGGGCAGGATCCAGGTGGG + Intronic
1033098857 7:138453690-138453712 GGGGAGGGGAAGACTGGGGAGGG + Intergenic
1033458837 7:141527255-141527277 GGGATGGGGAGGAGTAAGGAAGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033789604 7:144775702-144775724 TGGATGGGCAGCACTGTGGATGG - Intronic
1033959429 7:146895308-146895330 AGGGAGGGAAGGACGGAGGAAGG - Intronic
1034552942 7:151832765-151832787 AGGGAGGGAAGGTCTGAGGATGG - Intronic
1034784856 7:153916402-153916424 GGGGAGGGGAGGAGAGAGGAGGG - Intronic
1034909719 7:154985719-154985741 GGGGTGGTGAGGCCTGAAGAAGG - Intronic
1034995951 7:155577451-155577473 AGGCTGTGCAGGGCTGAGGAGGG + Intergenic
1035048277 7:155983357-155983379 AGGGTGGGCAGAGCTGGGGAGGG + Intergenic
1035061281 7:156071331-156071353 GGGGTGGGCAGGGCTGAGTCGGG + Intergenic
1035271519 7:157722677-157722699 GGGGGGGACAGGGGTGAGGAGGG + Intronic
1035287297 7:157814527-157814549 GGCGGGGGCAGGACAGAGGGAGG + Intronic
1035397540 7:158545030-158545052 GGGCTGGGCTGGAGTCAGGAAGG - Intronic
1035632356 8:1117682-1117704 GGGGAGGGCAGTAGAGAGGAGGG + Intergenic
1035632776 8:1121092-1121114 GGGGTCTGAAGGAATGAGGATGG - Intergenic
1036135265 8:6154474-6154496 GGGGTGGGGTGGAGTGAGAAGGG - Intergenic
1036668386 8:10763427-10763449 TGGGTGGGAAGGCCAGAGGAGGG - Intronic
1036777757 8:11625282-11625304 GGGCTGGGAAGGGCTGAGGAAGG + Intergenic
1036827612 8:11990416-11990438 GGGGTGGGTGGGATTGTGGAAGG - Intergenic
1037004357 8:13759315-13759337 GGGGTGGGGAGGGTTGGGGATGG - Intergenic
1037004361 8:13759325-13759347 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1037004367 8:13759335-13759357 GGGGTGGGGAGGGGTGGGGAGGG - Intergenic
1037585603 8:20273924-20273946 AGGGCGGGCAGGCCTGGGGAGGG - Intronic
1037744219 8:21630274-21630296 AGGGTGGGCAGGCCTCAGGCTGG + Intergenic
1037815596 8:22110056-22110078 GGAGGGGGCAGGGCTGGGGATGG + Intergenic
1037834066 8:22205990-22206012 GGGGTGGGGAGAACTGAGTCAGG + Intronic
1038014528 8:23502818-23502840 GGGATGGGGAGGACAGGGGAGGG - Intergenic
1038415634 8:27393187-27393209 GAGGTGGGCAGGAGTGAAGATGG - Intronic
1039441995 8:37601564-37601586 TGGGTGGGGAGGGCTGAAGATGG - Intergenic
1039821082 8:41136121-41136143 GGGGTGGGCAGGGAGGAGGAAGG + Intergenic
1039970616 8:42318823-42318845 TGGGTGGGCTGGACTGACGGAGG + Intronic
1040383213 8:46893123-46893145 CCCGTGGGCAGGACTTAGGAAGG + Intergenic
1041016246 8:53595149-53595171 GGGGTGGGCAGCACTGGGATGGG - Intergenic
1041040587 8:53842798-53842820 GGGGCGGGCAGGAGAGTGGAGGG - Intronic
1041126884 8:54650676-54650698 GGGGAGGGGAGGAGGGAGGAGGG - Intergenic
1041753224 8:61284211-61284233 GGAGAGGGCAGGACAGAGGGAGG + Intronic
1042463054 8:69093290-69093312 GGGGTGGGAAAGATGGAGGAGGG + Intergenic
1042732238 8:71948797-71948819 GGGGAGGGAAGGAAGGAGGAAGG + Intronic
1045265186 8:100612936-100612958 GGGGTGGACAGGTGTGAGCAGGG - Intronic
1045279390 8:100736488-100736510 TGGGTGGGGAGGACTATGGAGGG - Intergenic
1046380535 8:113444267-113444289 GGGGAGGGGAGGGGTGAGGAGGG - Intergenic
1046569754 8:115948235-115948257 AGGGAGGGAAGGACGGAGGAAGG + Intergenic
1046773728 8:118141879-118141901 GGGATGGCCAGGACTAAGGTGGG - Intergenic
1047363975 8:124195472-124195494 GCTGTGGGCAGGAGGGAGGAGGG - Intergenic
1048204085 8:132401744-132401766 AGGGTGGGCAGGGCAGAGGGTGG - Intronic
1048540930 8:135341771-135341793 AGAGAGAGCAGGACTGAGGAGGG + Intergenic
1048838916 8:138547526-138547548 GGGGTAGTGAGGACTGAGCAAGG - Intergenic
1049270561 8:141693443-141693465 GGGATGGGCAGGAAGGAGGGAGG + Intergenic
1049309835 8:141927995-141928017 GGGCTGAGCTGGACTGAGGACGG - Intergenic
1049378536 8:142300946-142300968 AGGGTGGGCAGGAGGCAGGAAGG + Intronic
1050291269 9:4157470-4157492 GGGGTGGGGAGCAGAGAGGAAGG + Intronic
1050537916 9:6645892-6645914 GGAGTGGGTAGGACTGGAGATGG - Intergenic
1050754031 9:8977827-8977849 GGGCTGGGAAAGACTGAGGGAGG + Intronic
1051988851 9:23126089-23126111 GGGGAGGGCAGGAATGAATAGGG - Intergenic
1053017023 9:34667672-34667694 GGGGCAGACAGGACTGGGGAGGG + Intergenic
1053054718 9:34987797-34987819 GGGGTGAGGAGGAGTGAGGAAGG - Intergenic
1053150341 9:35739138-35739160 GGAATGGGCATGCCTGAGGAGGG + Intronic
1053278082 9:36798306-36798328 GGGGTGAGCAAGAGTGAGGTTGG + Intergenic
1053691852 9:40590647-40590669 GGTCTGGGCAGGACTAAGGCAGG - Intergenic
1055028932 9:71752481-71752503 GGGGAGGGAAGGAGGGAGGAAGG + Intronic
1055378550 9:75679711-75679733 GGGGAGGGCAGGGGAGAGGAGGG + Intergenic
1056538263 9:87550170-87550192 GGGGTGGGAATGATTGAGAAGGG - Intronic
1056589027 9:87951036-87951058 TGGGTGGGGGAGACTGAGGAGGG + Intergenic
1056966223 9:91164843-91164865 GCAGAGGGAAGGACTGAGGAAGG + Intergenic
1056992554 9:91424412-91424434 GGGGTGGGCAGGAGGGAAGGCGG + Intergenic
1057942779 9:99299312-99299334 GGGCTTGGAAGGACTGAAGAGGG - Intergenic
1057961074 9:99457782-99457804 GGGGAGGGCAGGGCAGGGGAGGG + Intergenic
1058240588 9:102552893-102552915 GGGGAGGGCAGGATGGAGAAAGG - Intergenic
1058885040 9:109316559-109316581 GGGTTGGGCAGGGCTGAGCTAGG + Intronic
1059313018 9:113401331-113401353 GGCGTGGCCTGGACTGTGGAGGG - Exonic
1059451904 9:114376224-114376246 GGGGTGGGGAGGCCTGGGGTGGG - Intronic
1059456217 9:114402004-114402026 GGGGTGGGCAGGACAGGTGGGGG - Intergenic
1059598354 9:115747540-115747562 AGGGTGGGAAGGGCTGGGGAGGG + Intergenic
1059691215 9:116687515-116687537 GGGGGGGGCAGGACTAGGGTGGG + Intronic
1060251377 9:121989088-121989110 GGGGTGGGATGGCCAGAGGAGGG - Intronic
1060279191 9:122204627-122204649 GTGGTGGGCAGGATGGCGGACGG + Exonic
1060405815 9:123372628-123372650 GGGGTGAGCAGGAATGGGGTGGG + Intronic
1060556600 9:124511272-124511294 GGAGGGGGCAGCACAGAGGAAGG - Intergenic
1060768752 9:126314888-126314910 GGGGTGGGGAAGACCGAGGGAGG + Intergenic
1060945919 9:127569209-127569231 GGGGGGTGCAGGACCGAGGGCGG - Intronic
1061062409 9:128257327-128257349 GGGGTGGGCAGGCAGGAGTAAGG - Intronic
1061218350 9:129234988-129235010 AGGGTGGGCAGGGATGAGGCTGG - Intergenic
1061246145 9:129402117-129402139 GAGGTGGGGAGGAGGGAGGAGGG - Intergenic
1061246165 9:129402165-129402187 AGGGTGGGGAGGAGTGAGGAGGG - Intergenic
1061274202 9:129560146-129560168 TGGGGGGGCAGGGCTGAGGCAGG - Intergenic
1061514812 9:131082872-131082894 GCAGTGGGCAGGGCTGGGGAGGG - Intronic
1061618911 9:131798249-131798271 GTGGTGGGGAAGACTGAGGAAGG - Intergenic
1061620915 9:131810693-131810715 GGTGTGGGCAGGACGGAGGGTGG + Intergenic
1061647137 9:132013031-132013053 GGGGTGAGCAGGACAGGCGAAGG + Intronic
1061804667 9:133131281-133131303 GGGGTGGGCTGGGCTGGGGTGGG + Intronic
1061963585 9:134000378-134000400 AGGATGGGCAGGGTTGAGGAGGG - Intergenic
1062144069 9:134979127-134979149 GGGGAGGGAAGGAAGGAGGAAGG + Intergenic
1062279972 9:135747464-135747486 GGGGCAGGCAGGGCTGAGGCGGG - Intronic
1062294119 9:135814650-135814672 GGGTTGGGGAGGACCGAGGACGG - Intronic
1062316889 9:135971760-135971782 GGGGTGGGCAGTGCAGAGAAGGG + Intergenic
1062498735 9:136843429-136843451 GGGGTGGGCAGGGCGGAGGGTGG - Intronic
1062580529 9:137227402-137227424 AAGGTGGGCAGGGGTGAGGAGGG + Exonic
1203622515 Un_KI270749v1:136782-136804 GGTGTGGGCAGGACCAAGGCAGG - Intergenic
1203622922 Un_KI270749v1:138610-138632 GGGCAGGGCAGGACCAAGGAAGG - Intergenic
1185510516 X:660697-660719 GGGGTGGGCAGGGCTGGGGTTGG + Intergenic
1185646037 X:1616437-1616459 AGGCTGGGCAGGACTGCGGAGGG + Intronic
1185855524 X:3531306-3531328 GGGGAGGGGAGGACAGGGGAGGG + Intergenic
1185869159 X:3649642-3649664 GGGGAGGGGAGGATAGAGGAGGG + Intronic
1186246729 X:7622870-7622892 AGGGAGGGAAGGACAGAGGAAGG - Intergenic
1186749555 X:12607232-12607254 GAGGTGGGCAGAACTCAGGTGGG - Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1189236046 X:39488291-39488313 GGGGTGGGCAGGAGGCAGGCAGG - Intergenic
1191985031 X:66970481-66970503 GGGGTGGGGAGGAGGGGGGAGGG - Intergenic
1192150421 X:68708899-68708921 CAGGTGGCCCGGACTGAGGATGG - Intronic
1192182085 X:68922440-68922462 GGGATGGACAGGACAGATGAAGG + Intergenic
1192216664 X:69164146-69164168 GGGGTGCGCAGCACTGGAGAGGG + Intronic
1192317906 X:70066530-70066552 GGAGAGGGCGAGACTGAGGAAGG + Intergenic
1192334407 X:70205312-70205334 GGGCAGGGGAGGACTGGGGAGGG + Exonic
1192657309 X:73004442-73004464 GGGGTGGGCGGGGGAGAGGAAGG - Exonic
1192664811 X:73078565-73078587 GGGGTGGGCGGGGGAGAGGAAGG + Exonic
1192795298 X:74420878-74420900 GGGGTGCGCAGGACCGCGGGGGG + Intergenic
1192944348 X:75949515-75949537 TGGGTGGGCTGGGCGGAGGAGGG + Intergenic
1193365785 X:80630964-80630986 GGGGTGGGAGGGAATGAGGATGG - Intergenic
1194573510 X:95582303-95582325 GGGATGGGAAGGAAAGAGGAGGG - Intergenic
1195387164 X:104324279-104324301 AGGGTGAGCAGGAGTCAGGAAGG - Intergenic
1195508984 X:105692690-105692712 GAGATGGGCAGGATTGAGGTTGG + Intronic
1195770403 X:108345190-108345212 GGGATGGGAAAGATTGAGGAGGG - Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1197262353 X:124332769-124332791 GAGGAGGCCAGGACTGAGCAAGG + Intronic
1197344974 X:125319971-125319993 GAGGAGGCCAGGACTGAGCAAGG + Intergenic
1197988452 X:132292192-132292214 GGTGTGGGGAGAAGTGAGGAGGG + Intergenic
1198214808 X:134546034-134546056 GGGGTGGGGAGGACTGGAAAAGG - Intergenic
1198383386 X:136105098-136105120 GGGGAGGGATGGAGTGAGGAAGG + Intergenic
1199570685 X:149264260-149264282 GGAGAGGGCTGGATTGAGGATGG - Intergenic
1199856061 X:151759598-151759620 GGGGTGGGCAGAGCTGGGGCTGG + Intergenic
1200093094 X:153644804-153644826 GAGCTGGGCTGGAATGAGGACGG - Intronic
1200211949 X:154350642-154350664 GGGCCGGGCAGCACTGAGGCTGG + Intronic
1200397449 X:155999501-155999523 GGGATGGGCAGGAGGCAGGAGGG - Intronic
1201289743 Y:12411569-12411591 GGGGAGGGGAGGAGAGAGGAGGG + Intergenic
1201619658 Y:15942275-15942297 GGGGTGCGGGGGAGTGAGGAGGG - Intergenic
1201904470 Y:19076003-19076025 AGGGTAGGCAGGTCGGAGGAGGG - Intergenic
1202367305 Y:24174172-24174194 GGGGTGGGCAGGCAGGAGCAGGG + Intergenic
1202503476 Y:25495951-25495973 GGGGTGGGCAGGCAGGAGCAGGG - Intergenic
1202583105 Y:26402668-26402690 GGTGTGGGCAGGACCAAGGCAGG + Intergenic