ID: 1142367043

View in Genome Browser
Species Human (GRCh38)
Location 16:89656091-89656113
Sequence CCTTCATGATGATGACACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142367043 Original CRISPR CCTTCATGATGATGACACGG TGG Intronic
902007190 1:13241729-13241751 CAGTCAGGATGACGACACGGAGG + Intergenic
906330219 1:44878003-44878025 CTTTCATGATGTGGACACAGCGG + Intronic
907319029 1:53591258-53591280 CCTCCATGATGCTGGCACAGTGG - Intronic
908118114 1:60960998-60961020 ACTTCATGAGGTTGACAGGGAGG + Intronic
909077039 1:71061600-71061622 CCATCATCATGATAAGACGGGGG - Intergenic
913172050 1:116241889-116241911 CCTTCAAGATGATGCCTCAGTGG + Intergenic
915805335 1:158842933-158842955 CTTTCATGATGCTGACAGGCTGG - Intronic
920616980 1:207503196-207503218 CCTTTATGAAGATGAAACTGAGG + Intronic
922741174 1:228015178-228015200 CCTTCTGGATGATCACACGATGG + Intronic
1069305311 10:66962172-66962194 CTTTCATGATGAGGAAATGGGGG - Intronic
1076520520 10:131078168-131078190 CCTGAATGATGATGACATGCTGG + Intergenic
1077509366 11:2948255-2948277 CCTACATGAGGAAGACAGGGAGG + Intronic
1077922144 11:6649660-6649682 CCTTCATGATGTTCACAGGTAGG + Intronic
1083749050 11:64751352-64751374 TCTCCAGGAAGATGACACGGAGG + Exonic
1091655749 12:2345743-2345765 ACTTCAAAATGATGACATGGAGG + Intronic
1093151155 12:15623455-15623477 CTTTCATGATGATGACCCTGAGG + Intronic
1098651114 12:72970585-72970607 CCATCATGAGGATGAGATGGTGG + Intergenic
1100340451 12:93674495-93674517 CCTTGATGATGATGCCCAGGAGG - Intergenic
1102862925 12:116352000-116352022 CCTCCATGATGTAGACATGGTGG - Intergenic
1103865657 12:124049962-124049984 CCTTCATCAAGAGCACACGGAGG - Intronic
1105373079 13:19818184-19818206 CCTCCTTGGTGATGAAACGGTGG + Intergenic
1108736407 13:53288168-53288190 CAATAATGATGATGACAGGGTGG - Intergenic
1110694502 13:78472380-78472402 ACTTCATGATGAGGAAACGAAGG - Intergenic
1113108903 13:106801078-106801100 CCTTCATGATCGTTACACAGAGG + Intergenic
1114786397 14:25604722-25604744 CATTCATGATGATGAGAAGCAGG + Intergenic
1119208862 14:72814219-72814241 CCTTCATGAAGATGATTCTGAGG + Intronic
1126089809 15:45041296-45041318 CCTGCATGATTATGACAAAGTGG - Intronic
1129028691 15:72603617-72603639 CCCAGATGATGATGACAGGGAGG - Intergenic
1130735045 15:86539093-86539115 CCTTCCTGATGAAGAAACTGAGG + Intronic
1133369142 16:5234760-5234782 CCTGAATGCTGATGACACTGTGG - Intergenic
1136301355 16:29336449-29336471 GGTGCATGATGAGGACACGGTGG - Intergenic
1139286710 16:65821804-65821826 CCCTCAAGATGAAGACCCGGAGG + Intergenic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1142367043 16:89656091-89656113 CCTTCATGATGATGACACGGTGG + Intronic
1143734158 17:8898698-8898720 CGTTGATGATGATGACGAGGAGG - Intronic
1147636679 17:41968172-41968194 CCTTCAGGATGAGGACACAGTGG + Exonic
1147772924 17:42879957-42879979 CCTTCATAGTGATGTCATGGTGG + Intergenic
1148177391 17:45579071-45579093 CCTTAATGATGGAGACATGGGGG - Intergenic
1148610110 17:48959491-48959513 CCCTCATGATGCAGACACAGAGG - Intronic
1149545946 17:57504132-57504154 CCTTCATGATGCTGTGAAGGTGG + Intronic
1152079588 17:78178435-78178457 CCTTCCTCAGGATGGCACGGTGG + Intronic
1158560762 18:58511818-58511840 ACTTCATGAAGAGGACACAGAGG + Intronic
1162970360 19:14177530-14177552 CCTTCAAGATCATGTCACAGAGG - Exonic
1167103511 19:47418214-47418236 CCTCAGTGATGAAGACACGGAGG + Intronic
925043531 2:752741-752763 TCTTCATCATGATGACTCTGAGG - Intergenic
925552040 2:5086839-5086861 CCTTCATGAGGAGGACAATGGGG + Intergenic
925878151 2:8329232-8329254 CCTTCATGATCAAGGCAAGGGGG - Intergenic
928947307 2:36782944-36782966 CCTACATGATCTTGGCACGGTGG + Intronic
937159068 2:119742949-119742971 CCATCATGATGGTGACACATAGG - Intergenic
939849688 2:147289792-147289814 CCTACATTATGATGACACCGAGG + Intergenic
944871502 2:203916874-203916896 GCTTCAGGATGCTGACACAGTGG + Intergenic
946691685 2:222312928-222312950 ACTGCATTTTGATGACACGGGGG + Intergenic
948901450 2:240958667-240958689 CCTTCATGTTGAGGACACTGAGG + Intronic
1173737998 20:45375242-45375264 GCTTAATGAAGATGACTCGGGGG + Exonic
1175668895 20:60884310-60884332 CCATCATGCTGATGACAGTGCGG - Intergenic
1181797806 22:25322389-25322411 CTGACTTGATGATGACACGGTGG + Intergenic
1184747382 22:46464292-46464314 CCGTGATGATGGTGACACGCAGG + Exonic
949629081 3:5902925-5902947 CCTTCCTGATGAGGAAACTGAGG + Intergenic
951743971 3:25956297-25956319 CCTTCATTAAGAAGAGACGGAGG + Intergenic
953158521 3:40396687-40396709 ACTTCATGATGATAAAGCGGGGG - Intronic
954616117 3:51969506-51969528 CCTTCATGATCAGCACCCGGTGG + Exonic
954652688 3:52175037-52175059 CCAGCAGAATGATGACACGGCGG - Intergenic
959259657 3:104060527-104060549 AATTCATGATGATTACACTGTGG - Intergenic
960227687 3:115185978-115186000 CTTCCATGATGATGAAAGGGAGG + Intergenic
960541580 3:118867658-118867680 CCATCATGCTGATGTCACTGGGG + Intergenic
967438169 3:189475662-189475684 CCTTTATGATTATGACACTGAGG + Intergenic
969228426 4:5813868-5813890 CCTCCATGATGAAGACGCGTGGG + Exonic
982249037 4:153385844-153385866 CTTTCTTCATGATGACAAGGTGG + Intronic
983893707 4:173058721-173058743 ACTTCATAATGATGACACAGAGG - Intergenic
988285141 5:29205035-29205057 CCTTCATGATGTTGACTTTGGGG + Intergenic
993921222 5:93805562-93805584 CCTTCCTGATAATTACACAGAGG + Intronic
997661467 5:135592271-135592293 CCTCCCTGATGAGGCCACGGGGG - Intergenic
1000234869 5:159348028-159348050 CCTTCCTGATGAAGAAACTGGGG - Intergenic
1002293641 5:178215888-178215910 CCTGCAGGATGAGGACAGGGTGG - Intronic
1002446127 5:179291130-179291152 CCAGCATGATGCTGACACGTGGG + Intronic
1003131871 6:3401809-3401831 CCTTCATCCTGAGGACACGGGGG + Intronic
1003266465 6:4568664-4568686 GCCTCAAGATGATGACATGGAGG - Intergenic
1003406227 6:5829166-5829188 ACTTCGTGATGAGGAAACGGAGG + Intergenic
1007477470 6:42128546-42128568 CCTTCCTGATGCTGACCCGGCGG - Intronic
1008872220 6:56285805-56285827 CCTTCAGGATGGTGAGATGGTGG - Intronic
1012354228 6:98293063-98293085 CCTTCACCATGATGAGATGGGGG - Intergenic
1014986673 6:128019866-128019888 CCTTTCTGAAGAAGACACGGAGG + Intronic
1016190380 6:141258313-141258335 CTTGCATGATGAGGACACTGGGG + Intergenic
1019093686 6:169561970-169561992 CCTTCATTGTGATGACATGGTGG - Intronic
1019133948 6:169896804-169896826 CCTTCTTGATGGTTACAGGGAGG - Intergenic
1019850091 7:3546199-3546221 CCCTGAGGATGATGACACCGCGG + Intronic
1023217391 7:37878229-37878251 CCTTCATTTTGATAACATGGTGG + Intronic
1037858949 8:22391206-22391228 CCTGAATGATGATGACAAGGGGG - Intronic
1043614099 8:82104153-82104175 CCCTTATTATGATGACAGGGTGG - Intergenic
1048706803 8:137162751-137162773 CCTCCATGATGATGAGACCCTGG + Intergenic
1055149777 9:72982536-72982558 GCTTCATGATGATGGCATAGAGG + Intronic
1187593295 X:20742327-20742349 CCTGAATGATTAGGACACGGAGG + Intergenic
1188844801 X:35059555-35059577 CCTTCATGAAGATCACACTCGGG - Intergenic
1188907189 X:35802823-35802845 CCTTCATGAAGATCACACCCAGG - Exonic
1198192727 X:134326196-134326218 CCTTCATGATGAAAAAACTGTGG - Intergenic
1200686437 Y:6263855-6263877 CCTTCATGATGATTTCACTGTGG + Intergenic
1200989310 Y:9334772-9334794 CCTTCATGATGATTTCACTGTGG + Intergenic
1200991979 Y:9355102-9355124 CCTTCATGATGATTTCACTGTGG + Intergenic
1200994633 Y:9375382-9375404 CCTTCATGATGATTTCACTGTGG + Intronic
1200997296 Y:9395728-9395750 CCTTCATGATGATTTCACTGTGG + Intergenic
1200999811 Y:9464265-9464287 CCTTCATGATGATTTCACTGTGG + Intergenic
1201002469 Y:9484574-9484596 CCTTCATGATGATTTCACTGTGG + Intronic
1201005129 Y:9504861-9504883 CCTTCATGATGATTTCACTGTGG + Intergenic
1201007787 Y:9525188-9525210 CCTTCATGATGATTTCACTGTGG + Intergenic
1201010406 Y:9545378-9545400 CCTTCATGATGATTTCACTGTGG + Intergenic
1202034824 Y:20621407-20621429 GCTTCCTGATGATGGCAGGGTGG - Intergenic