ID: 1142367123

View in Genome Browser
Species Human (GRCh38)
Location 16:89656635-89656657
Sequence CTGCTTCCCCACATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 1, 2: 6, 3: 97, 4: 684}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142367117_1142367123 21 Left 1142367117 16:89656591-89656613 CCCATTGAGCACAGAAACGCTTG No data
Right 1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG 0: 1
1: 1
2: 6
3: 97
4: 684
1142367118_1142367123 20 Left 1142367118 16:89656592-89656614 CCATTGAGCACAGAAACGCTTGT 0: 1
1: 0
2: 0
3: 16
4: 93
Right 1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG 0: 1
1: 1
2: 6
3: 97
4: 684
1142367120_1142367123 -10 Left 1142367120 16:89656622-89656644 CCTGCTCAAACCTCTGCTTCCCC 0: 1
1: 0
2: 1
3: 41
4: 512
Right 1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG 0: 1
1: 1
2: 6
3: 97
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142367123 Original CRISPR CTGCTTCCCCACATGGAGAA TGG Intronic
900900904 1:5515214-5515236 CTGCTTCCACTCATGGTGGAAGG + Intergenic
901291395 1:8126928-8126950 CTGTGTCCCCACATGGTGGAAGG - Intergenic
901453978 1:9352869-9352891 CTGCTCCCACACGTGGAGAGAGG + Intronic
902142611 1:14369491-14369513 CGGCTTCTCCATCTGGAGAATGG + Intergenic
902313108 1:15597114-15597136 CTGCTTCCACTCATGGCAAATGG - Intergenic
902541490 1:17158767-17158789 CTGCTTCCACTCATGGAGGAAGG - Intergenic
902830563 1:19009762-19009784 CTGCTCCCCAACCTGGGGAATGG + Intergenic
902899753 1:19506778-19506800 CTGTGTCCCCACATGGTGGAAGG + Intergenic
903481589 1:23657395-23657417 CTGTTTCCCCACCTGTAAAATGG + Intergenic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
904869877 1:33610005-33610027 CTGCGTCCTCACATGGTGGAAGG - Intronic
906213396 1:44024693-44024715 CTGATTCCCCTCCTGGGGAAAGG - Intronic
906702880 1:47872541-47872563 CTGCCTCCCCACATGCACATGGG - Intronic
906730042 1:48072932-48072954 CTGCGTCCTCACATGGTGGAAGG - Intergenic
907159597 1:52360601-52360623 CAGCTTCCGCAGAGGGAGAATGG - Intronic
907246205 1:53110621-53110643 CGGCTTCTCCACATGGTGGAAGG - Intronic
907812475 1:57884946-57884968 CTGCTTCCCTTCATGGTGGAAGG - Intronic
907814034 1:57900634-57900656 CTGGTTGGCCACATGGACAAAGG - Intronic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
909052419 1:70782637-70782659 CTGCATCCTCACATGGTGGAAGG - Intergenic
909325635 1:74348203-74348225 CTGGTTAGCCACATGTAGAAAGG - Intronic
910011455 1:82468752-82468774 CTGTATCCCCACATGGTGGAAGG + Intergenic
910012582 1:82483515-82483537 CAGCTTCCTCACCTGGAAAACGG + Intergenic
910124068 1:83820735-83820757 TTGCTTCCACTCATGGAGGAAGG - Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911294087 1:96093085-96093107 CTGCTTCCCTTCATGGGCAAAGG + Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
911713039 1:101096967-101096989 CTGCGTCCTCACATGAAGGAAGG + Intergenic
911880101 1:103225901-103225923 CTGCTTCCAGTCATGGAGGAAGG - Intergenic
912656823 1:111493441-111493463 CTGCTTCCACCCATGGTGGAAGG - Intronic
912695642 1:111840081-111840103 CTGCATCCTCACATGGTGGAAGG + Intronic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
913575542 1:120170016-120170038 CTGTTTCCTCACATGGTGGATGG - Intronic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
914557852 1:148785658-148785680 CTGTTTCCTCACATGGTGGATGG - Intergenic
914614982 1:149344572-149344594 CTGTTTCCTCACATGGTGGATGG + Intergenic
915098282 1:153479498-153479520 CTCCTTCCCAAAAAGGAGAATGG - Intergenic
915647504 1:157284238-157284260 CTGCGTCCTCACATGGTGGAAGG + Intergenic
915647559 1:157284574-157284596 CTGTGTCCTCACATGGTGAAAGG + Intergenic
916528345 1:165631967-165631989 CTGCCACCCCACATAAAGAAGGG - Intronic
916539223 1:165736097-165736119 CTGCATCCTCACATGGTGGAAGG - Intronic
916671406 1:167024640-167024662 CTGTGTCCCCACATGGTGGAAGG - Intergenic
917347811 1:174046826-174046848 CTGCATCCTCACATGGCGGAAGG + Intergenic
917447087 1:175115504-175115526 CTGCTTGGCCCCATGGGGAAAGG + Intronic
917652664 1:177094490-177094512 CTGTGTCTCCACATGGTGAAAGG - Intronic
918102004 1:181384473-181384495 CTGCTACCCTACATGGAAAAAGG - Intergenic
918412737 1:184277135-184277157 ATGCTTCCACTCATGGAGGAAGG - Intergenic
919159124 1:193805773-193805795 CTGTGTCCTCACATGGTGAAAGG + Intergenic
919182651 1:194104800-194104822 ATGCTCCCTCACATGGGGAAGGG - Intergenic
919410600 1:197237394-197237416 CAGCATCCTCACATGGTGAAAGG + Intergenic
919574474 1:199290503-199290525 CAGCTTCCCCATCTGGAAAATGG + Intergenic
920411185 1:205762183-205762205 CTGCTTCCTCACATGGCAGAAGG - Intergenic
920533564 1:206722851-206722873 CTGCTGCACCACATGGAGGATGG - Intronic
920582584 1:207125615-207125637 CTGCGTCCTCACATGGGGGAAGG - Intronic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920834576 1:209497823-209497845 CTGCTTCCATTCATGGTGAAAGG + Intergenic
921249749 1:213285850-213285872 CTGCATCCTCACATGGTGGAAGG - Intergenic
922529750 1:226335412-226335434 CTGCTTTCTCACATGGCGAAAGG - Intergenic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
922712088 1:227841942-227841964 CTGCTTCCACTCATGGGGAAGGG + Intronic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
923379733 1:233404139-233404161 CTGCTTCCACTCATGGTGAAAGG - Intergenic
923515005 1:234689413-234689435 CTGTGTCCTCACATGGTGAAAGG + Intergenic
923889117 1:238191669-238191691 CTGTGTCCTCACATGTAGAAGGG - Intergenic
924021585 1:239789535-239789557 CTGCTTCCACTCATGGAGGAAGG + Intronic
924124695 1:240838225-240838247 CTGTTTCCTCACATGGTGGAAGG + Intronic
924440882 1:244084151-244084173 TAGCTTCCCCATCTGGAGAATGG + Intergenic
1063023535 10:2154934-2154956 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1063211225 10:3883062-3883084 ATGCTTAGCCACATAGAGAAGGG + Intergenic
1063506840 10:6607330-6607352 CTGCTTCATCACATGGAGACTGG - Intergenic
1063544261 10:6964562-6964584 CTGCATCCTCACATGATGAAAGG - Intergenic
1063897508 10:10697641-10697663 CTGCATCCTCACATGGCAAAAGG + Intergenic
1065416404 10:25492063-25492085 CTGCTTCCACTCATGGTGGAAGG + Intronic
1065433563 10:25684135-25684157 CTGCATCCTCACATGGTGGAAGG + Intergenic
1066224667 10:33370527-33370549 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1066339052 10:34511491-34511513 CTGCATCCTCACATGTAGGAAGG + Intronic
1067141670 10:43663058-43663080 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1067577747 10:47418868-47418890 CTGCTGGCCCAAATGGAGGATGG + Intergenic
1068657516 10:59590878-59590900 AGGCTCCCCAACATGGAGAAAGG + Intergenic
1068660057 10:59614447-59614469 CTGCATCCCCACAAGGTGAAAGG + Intergenic
1068863687 10:61872178-61872200 CTGTATCCTCACATGGGGAAAGG + Intergenic
1069819999 10:71221473-71221495 CTGATACCCTACATGGAGACAGG - Intronic
1069822581 10:71236740-71236762 CTGCTTCTCCTCTGGGAGAATGG + Intronic
1070052729 10:72904940-72904962 CTGCTCCCACTCATGGAGGAAGG + Intronic
1070419977 10:76226768-76226790 CTGATTCCACTCATGGAGGAAGG - Intronic
1070544614 10:77442554-77442576 CAGCTTCCCCACCTGTACAATGG + Intronic
1070580759 10:77717366-77717388 CTGCTTCCACCCATGGTGGAAGG - Intergenic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1072171093 10:92862491-92862513 CTGCATCCTCACATGGTGGAAGG - Intronic
1072436840 10:95421858-95421880 CTGCTTCCCCAGTTGGATAACGG - Intronic
1072441231 10:95457404-95457426 CAGCTTCCCTACATGCAAAACGG + Intronic
1072477109 10:95773002-95773024 CTGCTTCCACTCTTGGAGGAAGG + Intronic
1073080903 10:100860072-100860094 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1073429288 10:103475979-103476001 CTGCTTCCTCACCTGGAGAATGG + Intronic
1073873539 10:107894662-107894684 CTGCTTCCCCTCATGGTGGGAGG + Intergenic
1074982669 10:118632291-118632313 CTGCTTCCACTCATGGAAGAAGG - Intergenic
1075009844 10:118858157-118858179 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1075320975 10:121491542-121491564 CAGCTTCCCCACCTGTAAAATGG - Intronic
1075510395 10:123067625-123067647 CTGCTTCCTCCCATGGCAAAGGG + Intergenic
1075661182 10:124197545-124197567 CTGCTTCTCCTCATGTAAAACGG + Intergenic
1075949510 10:126464561-126464583 CTGCTCTCCCAGTTGGAGAAGGG + Intronic
1076594064 10:131614162-131614184 CTGCTTCTACTCAGGGAGAATGG - Intergenic
1076722505 10:132398878-132398900 CAGATTCCCCACAAGGACAAGGG - Intronic
1077316323 11:1920945-1920967 CAGTTTCCCCACTTGGAGAGTGG + Intronic
1077805452 11:5587545-5587567 CTGTGTCTTCACATGGAGAAAGG + Intronic
1078259280 11:9689684-9689706 CAGCTTCCTCATCTGGAGAAGGG + Intronic
1078443246 11:11385053-11385075 CTGCTTCCACTCATGGTGGAAGG + Intronic
1078467178 11:11559027-11559049 CTGCTTCCTCATTTGGAAAATGG + Intronic
1078723514 11:13906197-13906219 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1078740705 11:14063786-14063808 CTGATTCCCAACATTGTGAAGGG + Intronic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079329464 11:19521736-19521758 CTGCTTCCTCATCTGGAAAATGG - Intronic
1079484652 11:20922820-20922842 CTGTTTCCCCATATGTAAAATGG + Intronic
1079519119 11:21303914-21303936 CTGCGTCCTCACATGGTGGAAGG + Intronic
1080257344 11:30305843-30305865 CTTCATCCTCACATGGTGAAAGG + Intergenic
1080335333 11:31188976-31188998 CTGCATCCTCACATGGTGGAGGG - Intronic
1081327544 11:41764163-41764185 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1081439137 11:43061251-43061273 CTGCATCCTCACATGGTGGAAGG + Intergenic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083042797 11:59703934-59703956 TTGCTGCCCCAAATTGAGAAGGG - Intergenic
1083186386 11:61020125-61020147 CTCCTTGCCCCCATGGAGACTGG - Exonic
1083813840 11:65120795-65120817 CTGTTTGGCCACCTGGAGAAGGG + Exonic
1084273125 11:68039390-68039412 CAGCTTCCCCATCTGTAGAATGG - Intronic
1084643891 11:70443176-70443198 CTGCTTCCACTCATGGGGGAGGG + Intergenic
1084651767 11:70493748-70493770 CTGCTTCTCCCCAGGGAGTAAGG - Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1085147106 11:74210688-74210710 CTGCTTCCACTCATGGTGGAAGG - Intronic
1085506130 11:77060772-77060794 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1086086334 11:82958554-82958576 CTGCATCCTCACATGATGAAAGG - Intronic
1086640766 11:89152826-89152848 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1086958767 11:92960985-92961007 CTTCTTCCCCAACTGGAGGAAGG - Intergenic
1087097158 11:94330209-94330231 CTGCATTCTCACATGGTGAAAGG + Intergenic
1087159580 11:94935718-94935740 CTGCTTCCCCTCTTGGGGAAAGG - Intergenic
1087219524 11:95531315-95531337 CTGCTTCCACTCATGGTGAAAGG - Intergenic
1087334814 11:96830212-96830234 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1089201221 11:116725785-116725807 CTGTTTCCCCACCTGCAGAGTGG + Intergenic
1089868361 11:121651468-121651490 CTCTGTCCTCACATGGAGAAAGG + Intergenic
1090822694 11:130357875-130357897 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1091910705 12:4228314-4228336 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1092962109 12:13606298-13606320 CTGCTTCCACTCATGGTGGAAGG + Intronic
1093012648 12:14125411-14125433 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1093214130 12:16343266-16343288 CTGCTTCCTCACATGACGGAGGG - Intergenic
1093696723 12:22169488-22169510 CTGCTTCCACACATGGCAGAAGG + Intronic
1093763085 12:22932230-22932252 CTGTGTCCTCACATGGGGAAAGG - Intergenic
1093770670 12:23014004-23014026 CTGCATCCTGACATGGTGAAGGG + Intergenic
1093798567 12:23343761-23343783 CTGCTTCCTCACATGGAAGAAGG - Intergenic
1093904701 12:24676811-24676833 CTGTGTCCTTACATGGAGAAAGG + Intergenic
1094023999 12:25943047-25943069 CTGCTTCCACTCATGGCCAAAGG + Intergenic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1095304709 12:40625982-40626004 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096076889 12:48811474-48811496 GGGCTGCCCCACATGGAGAATGG - Intergenic
1097049100 12:56210260-56210282 CTTCTGCCCCACATGGATAAGGG - Intronic
1097275585 12:57811262-57811284 CTGCTGCCCCACAAGTAGACTGG + Intronic
1097478238 12:60086178-60086200 CTACTTCCCCACCTGATGAATGG - Intergenic
1097480304 12:60116049-60116071 CTTCTTCCACTCATGGTGAAAGG + Intergenic
1097708763 12:62895788-62895810 CTGCTTCCACTCATGGTGGAAGG - Intronic
1097754623 12:63395982-63396004 CTGCATCCTCACATGGCGGAAGG + Intergenic
1098761191 12:74427411-74427433 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1100795498 12:98177436-98177458 CTGCTTCCTCTCATGGTGGAAGG - Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101654226 12:106705780-106705802 CTCCATCCCCAGATGGACAACGG - Intronic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1102010590 12:109616165-109616187 CTGTTTCCCCACATGTAAAGTGG + Intergenic
1102182614 12:110923764-110923786 CTGTTTCCTCACCTGGAAAAGGG + Intergenic
1103248923 12:119483160-119483182 CTGCTTCCCCCCAACAAGAAGGG - Intronic
1103368609 12:120401543-120401565 ATGTTTCCCAACATGAAGAAGGG - Intergenic
1103950733 12:124549667-124549689 CGGTTTCCCCATCTGGAGAAGGG - Intronic
1104360917 12:128132471-128132493 CTGTTTCCCCATATTCAGAATGG - Intergenic
1104683964 12:130772316-130772338 CTCCTTCCACTCATGGAGAAAGG + Intergenic
1104873191 12:132015225-132015247 CTGCTCCGCCTCTTGGAGAAAGG - Intronic
1104979233 12:132566202-132566224 CTGCGTCCTCACATGGTGGAAGG + Intronic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1105716839 13:23074897-23074919 CTGTTTCATCACATGGTGAAAGG + Intergenic
1106345459 13:28872554-28872576 CAGCTTCTCCACATGGTGGAAGG + Intronic
1106667761 13:31870557-31870579 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1106690068 13:32105277-32105299 CTGTGTCCTCACATGGAGAAAGG - Intronic
1107076446 13:36326044-36326066 CTGCTTCCTCACATAGTGAAAGG + Intronic
1107210066 13:37842629-37842651 CTGTGTTCCCACATGGTGAAAGG + Intronic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107937523 13:45357570-45357592 CTGTTTCCTCACCTGTAGAATGG + Intergenic
1107980093 13:45727078-45727100 CTGCTTCCACACATGGAGAAAGG + Intergenic
1108041190 13:46340680-46340702 CTGCTTCCACTCATGGTGGAGGG + Intergenic
1108054724 13:46474219-46474241 CTGCCTCCTCACATGGTGGAAGG - Intergenic
1108568021 13:51720787-51720809 CTGTGTCCTCACATGGTGAAAGG + Intronic
1109143058 13:58740412-58740434 CTGCTTCCTCACATGGTGGAAGG - Intergenic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109376418 13:61500274-61500296 ATGCTTCCTCACATGATGAAGGG - Intergenic
1109523847 13:63548288-63548310 CTGCATCCTCACAAGGTGAAAGG - Intergenic
1109658737 13:65430138-65430160 CTGCATCCTCACATGGTGGAAGG - Intergenic
1111877155 13:93911712-93911734 CTGTTTCCCCACTTGTAAAATGG + Intronic
1112028916 13:95439287-95439309 CTGCATCCTCACATGGTGGAAGG + Intronic
1112361769 13:98725145-98725167 CTGCTTCCATTCATGGAGGAAGG - Intronic
1113012413 13:105784875-105784897 CAGCTTCCACTCATGGAGAAAGG - Intergenic
1113050456 13:106205829-106205851 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1113395662 13:109945256-109945278 CTGCATCCTCACATGGTGGAAGG + Intergenic
1113432987 13:110266312-110266334 CCGTCTCCCCACATGGAGAACGG - Intronic
1113970302 13:114183598-114183620 CTGCATCCTCATATGGTGAAAGG + Intergenic
1114202208 14:20532453-20532475 CTGTATCCTCACATGGGGAAGGG + Intergenic
1114475807 14:22993942-22993964 CTGCTGCCCATCATGGAGGAAGG - Intronic
1115565632 14:34622723-34622745 CTGCTTTCCAACAGGGAGGATGG - Intronic
1115792891 14:36899490-36899512 CTTCTTGCCTACAGGGAGAATGG + Intronic
1115979248 14:39030804-39030826 ATGCGTCCTCACATGGAGAAAGG - Intergenic
1117024050 14:51601717-51601739 CTTCTTCCTCTCATGGATAATGG - Intronic
1117288059 14:54306758-54306780 CACCTTCCCCACAGGAAGAAAGG + Intergenic
1117334208 14:54743020-54743042 CTGCTTCTCCAGAATGAGAATGG + Intronic
1117712623 14:58547770-58547792 CTGCTTTCCCACCTGCACAAAGG - Exonic
1118305919 14:64655322-64655344 CTGCCTCTCCAAATGGAGCAGGG - Intergenic
1119115322 14:72015157-72015179 CTGCTTCCACTCATGGAGGAAGG + Intronic
1119140587 14:72263669-72263691 CTGTGTCCTCACATGGTGAAAGG - Intronic
1119178350 14:72586418-72586440 CTGCTTCCACCCATGGTGGAAGG - Intergenic
1120221632 14:81741015-81741037 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121215400 14:92243944-92243966 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1121579333 14:95015188-95015210 CTGAGTCACCACATGGAGAGCGG - Intergenic
1121644908 14:95511166-95511188 CTGCTTCCCCCACTGGAAAATGG + Intergenic
1121825191 14:97004478-97004500 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1121878819 14:97480774-97480796 CTGTTTCTTCACATGTAGAATGG - Intergenic
1122562981 14:102630295-102630317 CTGCTTCCACACATGGCGGAAGG - Intronic
1122626240 14:103086787-103086809 CTGCTCCCCAACAAGGAGAATGG - Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1123670748 15:22654410-22654432 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124073311 15:26415745-26415767 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1124225349 15:27888922-27888944 CTGCTTCCTCACATGAGGGAAGG - Intronic
1124362071 15:29044972-29044994 CTGTGTCCACACATGGTGAAAGG + Intronic
1124526722 15:30460837-30460859 CTGCATCCTCACTTGGTGAAAGG - Intergenic
1124601955 15:31140640-31140662 CTGCTTCCATTCATGGAGGAAGG - Intronic
1124665150 15:31586065-31586087 CTGGTTCACCCTATGGAGAAAGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124771931 15:32546846-32546868 CTGCATCCTCACTTGGTGAAAGG + Intergenic
1125215201 15:37264040-37264062 CTGCATCCTCACATGGTGAAAGG - Intergenic
1125268446 15:37911577-37911599 CTGCTTCCTCACTTGTAAAATGG + Intergenic
1125333337 15:38603506-38603528 CTGGTCTCCCACAAGGAGAAAGG - Intergenic
1126261990 15:46704157-46704179 CTGCTTCCACTCATGGTCAAAGG - Intergenic
1126963015 15:54019137-54019159 CTGCTTCCTCACCTGTAAAATGG - Intronic
1127672176 15:61205781-61205803 CCACCTCCACACATGGAGAAGGG + Intronic
1127753218 15:62066742-62066764 CTGTTTCCTCACATGCAAAATGG - Intergenic
1128002969 15:64210977-64210999 CTGCTTCCACTCATGGTGTAAGG - Intronic
1128083459 15:64870426-64870448 GTGCTTTCCCACATGGGGGATGG - Intronic
1128328305 15:66739423-66739445 CTTCTGTCCCACATGGAGCACGG + Intronic
1128928980 15:71686705-71686727 CTGCTTCCCCCCACAGAGATTGG - Intronic
1129063220 15:72878262-72878284 CTGTATCCTCACATGGAGGAAGG + Intergenic
1129101978 15:73273523-73273545 CTTAATCCCCACATTGAGAAGGG - Intronic
1129172499 15:73816809-73816831 CAGCTTCCCCAGGTGGAGACAGG - Intergenic
1129345047 15:74912137-74912159 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1129684966 15:77680592-77680614 GACCTTCCCCACATGCAGAAGGG + Intronic
1129958245 15:79659004-79659026 CTGCTTCCTCTCATGGAGGAAGG + Intergenic
1130177764 15:81592882-81592904 CTGCATCCCCACATGGTGGAAGG - Intergenic
1130533306 15:84764378-84764400 CTGTTTCCCCATATGTAAAATGG - Intronic
1130562746 15:84971530-84971552 CTGCTTCCTCTCATGGTGGAAGG - Intergenic
1130651550 15:85764854-85764876 CAGCTTCCCCATCTGGACAACGG - Intronic
1130689793 15:86071978-86072000 CTGCTTCCACTTATGGTGAAAGG - Intergenic
1130799145 15:87243454-87243476 CTGAGTCTCCACATGGATAAGGG - Intergenic
1130815765 15:87430722-87430744 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1130992372 15:88883408-88883430 CAGCTTCCCCATTTGTAGAATGG + Intronic
1131602517 15:93863756-93863778 CTGCTTCCACTCATGGCAAACGG - Intergenic
1132238432 15:100239209-100239231 CGGTTTTCCCACATGCAGAATGG + Intronic
1132548351 16:543909-543931 CCGCTCCCCCACATGGATGAAGG + Intronic
1133221886 16:4322440-4322462 AGGTTTCCCCACATGGAAAATGG + Intronic
1133439178 16:5806339-5806361 CTGCATCCCCACATGGTGGATGG + Intergenic
1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG + Intergenic
1133485653 16:6215786-6215808 CTGTTTTCTTACATGGAGAAAGG + Intronic
1134560279 16:15203123-15203145 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1134630054 16:15750012-15750034 AGCCTTCCCCACATGGAAAATGG + Intronic
1134920821 16:18114737-18114759 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1135060101 16:19264071-19264093 CTGAGTCCCCACATGGTGGAAGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1135397499 16:22142352-22142374 CTGCTTCCACTCATGGTGGAAGG + Intronic
1135662778 16:24311007-24311029 CTGCTTCCCAACATGGAAACGGG - Intronic
1135778923 16:25281767-25281789 CAGCTTCCTCACCTGGAGAATGG + Intergenic
1135824112 16:25711305-25711327 CAGCTGCCCCACATTGGGAAGGG - Intronic
1135829976 16:25764363-25764385 CTGCTTCCCCATCTGTAAAATGG - Intronic
1135941745 16:26827941-26827963 CTGCTTCCCACCTTAGAGAATGG - Intergenic
1136863749 16:33723102-33723124 TTACTTCCCCACATTGAGATTGG - Intergenic
1137595156 16:49718732-49718754 CTGCGTCCTCACATGGTGGAAGG + Intronic
1137793604 16:51196227-51196249 ATGCTTCTCCACATGGTCAAGGG - Intergenic
1137805490 16:51301089-51301111 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1138101638 16:54256612-54256634 CTGCAGCCCCCCAGGGAGAAAGG - Intronic
1138678913 16:58671241-58671263 CGCCCTGCCCACATGGAGAAGGG + Exonic
1138693212 16:58788174-58788196 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1138802738 16:60054340-60054362 CTGCATTCTCACATGGTGAAAGG - Intergenic
1138954382 16:61953093-61953115 CTGTGTCCCCACATGGTGGAAGG - Intronic
1139055112 16:63173917-63173939 CTGCTTTCACTCATGGTGAAAGG - Intergenic
1139336443 16:66235038-66235060 CTGTGTCCTCACATGGTGAAGGG - Intergenic
1139355876 16:66366828-66366850 CAGCTTCCCCATCTGTAGAATGG + Intronic
1140305584 16:73799623-73799645 CTGCTTCCTCTCAGGAAGAAAGG + Intergenic
1140601153 16:76476669-76476691 CTGTGTCCTCACATGGTGAAAGG + Intronic
1140814574 16:78609386-78609408 ATGCTTCCCCACCAGGAGAGTGG + Intronic
1141236538 16:82222940-82222962 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1141651898 16:85397228-85397250 CTGCTTCCCCCAATGCAAAAGGG - Intergenic
1141676433 16:85520195-85520217 CTGTATCCTCACATGGTGAAAGG + Intergenic
1141996358 16:87638734-87638756 CTGCTTCCCCTCCTGTAGAATGG + Intronic
1142133083 16:88439697-88439719 CCGTTCCCCCACATGGAGAAGGG + Exonic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142235386 16:88920074-88920096 CTCCTTCCCCAGATAGTGAAAGG + Intronic
1142367123 16:89656635-89656657 CTGCTTCCCCACATGGAGAATGG + Intronic
1203125233 16_KI270728v1_random:1571249-1571271 TTACTTCCCCACATTGAGATTGG - Intergenic
1142504361 17:353445-353467 CTGCTGCTCCCCATGGGGAAAGG - Intronic
1142737382 17:1909828-1909850 CTGCTCCTGCACACGGAGAAAGG - Intergenic
1143037805 17:4009695-4009717 CTCTTTACCCACATGGAGTACGG - Exonic
1143478228 17:7215006-7215028 CTGCTTCCCCAAATGCTGGATGG - Intronic
1143979270 17:10854306-10854328 CTGCTTCCACTTATGGTGAAAGG + Intergenic
1144395420 17:14838347-14838369 CTTCTTCCCCACAAGAACAATGG + Intergenic
1144599293 17:16598640-16598662 CTGCTTCCACTCATGGCGGAAGG - Intergenic
1144770955 17:17759172-17759194 GTCCATCCCCACATGGGGAAGGG + Intronic
1144839593 17:18177697-18177719 CTGTTTCCCCACCTGTGGAATGG + Intronic
1145266207 17:21380731-21380753 CTGCTTCCCTACATGTCCAAGGG - Intronic
1146260017 17:31415006-31415028 CTGCTTCCCCTGCTGGAGAAGGG - Intronic
1146905443 17:36614995-36615017 CTCCTTCCCCAGATTGGGAAAGG + Intergenic
1146931729 17:36782655-36782677 CAGTTTCCCCACATGCAAAAGGG + Intergenic
1147538223 17:41334726-41334748 CTGCTTCCTCAAAAGGAGAGTGG + Intergenic
1147688092 17:42299324-42299346 CAGCTTCCCCACGTGTAAAACGG - Intronic
1149489212 17:57070111-57070133 ATTCTTCCCTCCATGGAGAAAGG + Intergenic
1151123350 17:71817756-71817778 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1151633286 17:75326050-75326072 CTGCTTCCCCACAAAGAAACGGG + Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1153073764 18:1137906-1137928 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1153206816 18:2711984-2712006 CTGCTTCCACTCATGGTGGAAGG - Intronic
1153841573 18:9012734-9012756 CTGCTTCCACACATGGTGGAAGG + Intergenic
1155254745 18:23985013-23985035 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1155438002 18:25833222-25833244 CTGTATCCTCACATGGGGAAAGG - Intergenic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156069857 18:33193937-33193959 CTGCATCATCACATGGAGGAAGG + Intronic
1156407350 18:36795497-36795519 CTGCTTCCCAACAGGGAAAGTGG - Intronic
1157908362 18:51590952-51590974 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1158645840 18:59246311-59246333 CTGCATCCTCACATGGTGGAAGG + Intergenic
1158855840 18:61542760-61542782 CTGCTTCCATGCATGGAGGAAGG + Intronic
1160144675 18:76353714-76353736 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1160245939 18:77159468-77159490 CTGCATCCCCACATGGTGGAAGG - Intergenic
1161519657 19:4716720-4716742 CAGTTTCCCCACCTGTAGAATGG - Intronic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1163726273 19:18924833-18924855 CGGTTTCCCCACATGGACAGTGG + Intronic
1165929917 19:39350787-39350809 CTGCACTCCCACCTGGAGAAAGG - Intronic
1166147573 19:40848148-40848170 CTGCTCCCCTACCTGGAGACAGG - Intronic
1166151714 19:40880013-40880035 CTGCTCCCCTACCTGGAGACAGG - Intronic
1166170613 19:41025533-41025555 CTGCTCCCCTACATGGGGACAGG - Intergenic
1166178451 19:41090612-41090634 CTGCTCCCCTACCTGGAGACAGG + Intronic
1167100311 19:47400609-47400631 CTGCTTCCTCACCTGGGAAATGG + Intergenic
1167558876 19:50213315-50213337 CAGCTTCCCCACCTGCAGAGCGG - Intronic
925249271 2:2417393-2417415 CTGCATCCTCACAGGGTGAAAGG - Intergenic
925409683 2:3632805-3632827 CTGAGTCCCCACTTGGAGAGGGG + Intronic
925679087 2:6398223-6398245 CTGCATTTCCACAAGGAGAAGGG - Intergenic
925834345 2:7929447-7929469 CTGCTTCTCCACGTGGAGTCTGG - Intergenic
925923233 2:8652169-8652191 CTGCTTCCCCTCATGGCGGAGGG + Intergenic
926288503 2:11509734-11509756 CTGCATCCTCACATGGTGGAAGG - Intergenic
926392652 2:12409534-12409556 CTGTGTCCTCACATGGTGAAAGG - Intergenic
926574118 2:14561568-14561590 CTGCCTCCACACACAGAGAAGGG - Intergenic
926659493 2:15447975-15447997 CTGTGTCCTCACATGGTGAAAGG + Intronic
926749115 2:16184495-16184517 CTTCTTCCCCATAGGGAGATGGG + Intergenic
926933896 2:18067650-18067672 CTGTGTCCTCACATGGTGAAAGG - Intronic
926961867 2:18365819-18365841 CTGCATCCTCACATGGTGGAGGG - Intergenic
927070800 2:19527330-19527352 TTGCTTCCCCACCTGAAGAGAGG - Intergenic
927458041 2:23274478-23274500 CTGCATCCTCACATGGTGGAAGG - Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
927585013 2:24294904-24294926 CTGCGTCTTCACATGCAGAAAGG - Intronic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
927785388 2:25970773-25970795 CTGCTGGCCCACCTGAAGAAAGG + Intronic
928925499 2:36574962-36574984 CTGCTTCTCCTCATTGACAAGGG - Intronic
928977659 2:37105496-37105518 CTGCTTCCACTCATGGTGGAAGG - Exonic
930170638 2:48247723-48247745 CTGTTTCCTCACATGGTGGAAGG - Intergenic
930689155 2:54341343-54341365 CTGCATCCTCACATGGTGGAAGG - Intronic
931008646 2:57881777-57881799 CTGCTTGTCCACTGGGAGAAGGG - Intergenic
933558172 2:83857766-83857788 CTGTGTCCCCACATGGCAAAAGG - Intergenic
934086532 2:88514537-88514559 ATACCTCCCCACATTGAGAAGGG - Intergenic
935092030 2:99904731-99904753 CTCCTTTCCCACAGGGAGAGGGG + Intronic
935167915 2:100585750-100585772 CTGCTTCCACTCATGGTGAAAGG - Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935264784 2:101384956-101384978 CTGCTTCCACTCATGGTGGAAGG - Intronic
935727761 2:106038578-106038600 CTGCTTCCTCACCTGTAAAATGG - Intergenic
935822632 2:106909396-106909418 CTGCTTCCACTCATGGCGGAAGG - Intergenic
935920302 2:108005720-108005742 CTGCCTCCTCACATGGTGGAAGG + Intronic
936287918 2:111195433-111195455 CTGCTTCCTCACGTGGTGGAAGG - Intergenic
936491979 2:112979728-112979750 CTGCTTGAGCACATGGAGATGGG - Intronic
936948561 2:117953937-117953959 CTGCTTCCTCACATGGTGGAAGG - Intronic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937473350 2:122192137-122192159 GTGCTTCCCCACATGGGAAGAGG + Intergenic
937802832 2:126100459-126100481 CTGCTTCCACTCATGGTGGAAGG - Intergenic
938684285 2:133721871-133721893 CTGTGTCCTCACATGGTGAAAGG - Intergenic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
939099326 2:137877951-137877973 CTGCTTCCACTCATGGTGAAAGG + Intergenic
939826094 2:147017222-147017244 CTGTGTCCCCACATGGTGGAAGG + Intergenic
939888311 2:147705768-147705790 CTGCTTCCACTCATGGTGGAAGG + Intergenic
940363706 2:152822412-152822434 CTGCGTCCTCACATGGTGGAAGG + Intergenic
941162560 2:162052395-162052417 CAGCATCCCCACATGGTGAAAGG - Intronic
941197185 2:162467527-162467549 CTGCTTCCACTCATGGTGGAAGG - Intronic
941589690 2:167404107-167404129 CTGCTTCCACTCATGGTGGAAGG + Intergenic
943152075 2:184126395-184126417 CTGCTTCCACTCATGGTGGAAGG + Intergenic
946151225 2:217772807-217772829 CTGTGTCCTCACATGGTGAAAGG + Intergenic
946391477 2:219419153-219419175 CTCCTGCCCCATGTGGAGAAAGG + Intronic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
947154807 2:227151790-227151812 CTGCATCCTCACATGGTGGAAGG - Intronic
947366636 2:229403252-229403274 CTGCTTCCATACAAGGAGTATGG - Intronic
948148317 2:235724974-235724996 CCGCTTCACCTCCTGGAGAAAGG + Intronic
948543955 2:238712256-238712278 CTGCTTCCGCTCATGGTGGAAGG + Intergenic
1168810517 20:701659-701681 CTGGTCCCCCACCTGGAGCAGGG - Intergenic
1168949653 20:1787987-1788009 CTGCTTGCTCTCATGGAGACAGG - Intergenic
1168951276 20:1803600-1803622 CTTCTTCCCCACCTGGGGAGCGG + Intergenic
1169292523 20:4364848-4364870 ATGCTTCCCCACATGGGGAAAGG + Intergenic
1169399030 20:5264186-5264208 CTGCTTCCCCTCATGGTGGAAGG + Intergenic
1169543693 20:6629415-6629437 GTGCTGCCCAAAATGGAGAAGGG + Intergenic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1170382918 20:15781571-15781593 CTGTGTCCCCACATGGTGGAAGG + Intronic
1171020632 20:21581477-21581499 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1171058659 20:21934024-21934046 CTGCATTCCAACATGGAGGACGG - Intergenic
1171295062 20:24010128-24010150 CTGCTTCCTCACATGGCAAAGGG - Intergenic
1171751879 20:29059491-29059513 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1172701792 20:36857878-36857900 CTGCGTCCTCACATTGAAAAGGG + Intronic
1172807569 20:37623294-37623316 CTGAGACCCCATATGGAGAAGGG - Intergenic
1172822372 20:37748745-37748767 CTGCGTCCTCACATGGTGGAAGG + Intronic
1173010684 20:39179027-39179049 CTGCATTCCCACATGGCGAAAGG + Intergenic
1173840207 20:46152069-46152091 CTGTTTCCTCACCTGGAGATGGG + Intergenic
1174077273 20:47946561-47946583 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1174289701 20:49499341-49499363 CTGCTTCCACTCATGCTGAAAGG + Intergenic
1174424991 20:50425696-50425718 CAGTTTCCCTATATGGAGAATGG + Intergenic
1174588376 20:51625985-51626007 CAGTTTCCCCGCATGGAGCAGGG + Intronic
1175212977 20:57373075-57373097 CTGCCTCCCCAGCTGGAGGAGGG - Intronic
1176415537 21:6472522-6472544 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1177349778 21:19922340-19922362 CTGTCTCCTCACATGGTGAAAGG + Intergenic
1177392735 21:20497648-20497670 CTGTGTCCTCACATGGTGAAGGG + Intergenic
1178110693 21:29367164-29367186 CTGCTTCCACTCATGGTGGAAGG - Intronic
1178186982 21:30233796-30233818 CTGCTTCCCATTAAGGAGAAAGG - Intergenic
1178231456 21:30789748-30789770 CTGTGTCCCCACATGGCAAAGGG - Intergenic
1178595495 21:33949233-33949255 CTGATTCTCCACAGGGAGAGTGG - Intergenic
1179533933 21:42039318-42039340 CTGTGTCCCCACATGGTGGAGGG + Intergenic
1179691037 21:43080855-43080877 CTGCTTGCCCAAATGCAGAGTGG - Intergenic
1179722002 21:43321429-43321451 CTGTTTCTCCACATAGAGGATGG + Intergenic
1180085053 21:45504691-45504713 CTGCGTCCCCACACGGGGACAGG - Intronic
1180408589 22:12581249-12581271 CTGTTTCCTCACATGGTGGAAGG - Intergenic
1180669431 22:17541953-17541975 CTGCTTACCTGCATGGTGAAAGG - Exonic
1181405094 22:22678770-22678792 CTGCTTCCTGTCATGGTGAAAGG + Intergenic
1181408245 22:22700415-22700437 CTGCTTCCTGTCATGGTGAAAGG + Intergenic
1182001212 22:26921345-26921367 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1182352968 22:29709212-29709234 CAGTTTCCCCACCTGTAGAATGG - Intergenic
1182890694 22:33816440-33816462 CTACGTCCTCACATGGTGAAAGG + Intronic
1182915317 22:34024068-34024090 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1182955136 22:34417422-34417444 CTGAGTCCCCACATGGTGGAAGG + Intergenic
1183017800 22:35004245-35004267 CTGCATCCTTACATGGTGAAAGG + Intergenic
1183670714 22:39270774-39270796 CTGTTTCCCCACCTGTAAAATGG + Intergenic
1183737436 22:39651621-39651643 ATGCTGCCCCACTTGGAGACTGG - Intronic
1183799217 22:40147558-40147580 CTGCGTCCCCACGTGGCAAAAGG + Intronic
1184093021 22:42302196-42302218 CAGTTTCCCCATCTGGAGAAGGG - Intronic
1184227384 22:43136874-43136896 CTGCTCCACCACGTGTAGAATGG - Intronic
1184406746 22:44304785-44304807 CAGCTTCCCCATCTGTAGAATGG - Intronic
1184411114 22:44327075-44327097 CTGCTTCCCCATATTCAGATGGG - Intergenic
1184908806 22:47511711-47511733 CTGCATCCTCACATGGTGAAAGG - Intergenic
949602314 3:5613566-5613588 CTGGTTCCCCACATGGCAAAAGG - Intergenic
949705693 3:6814154-6814176 CTGCTTCCACCCATGGTGGAAGG + Intronic
950196721 3:11014645-11014667 CTGCCTCCCCTTCTGGAGAATGG - Intronic
950454022 3:13082051-13082073 CTGCTTCCACTCAAGGATAAAGG - Intergenic
950458336 3:13105808-13105830 CCACCTCCCCACATGGAGAGGGG - Intergenic
950490752 3:13303497-13303519 CTGCTTCCACACCTGGGAAATGG - Intergenic
950573957 3:13819634-13819656 CAGTTTCCCCATATGTAGAAGGG + Intronic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
950812048 3:15658399-15658421 ATGCTGCCCCACAGGGACAATGG + Intergenic
950948769 3:16977903-16977925 CTGCATCCTCACATGGTGGAAGG + Intronic
951288826 3:20850129-20850151 CTGCTTCCACTCATGGCGGAAGG + Intergenic
952122927 3:30266039-30266061 CTGCTTCCACTCATGGTGAAAGG - Intergenic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
952892131 3:38050474-38050496 CTGCTTCCACTCATGGGGGAAGG + Intronic
952957137 3:38564405-38564427 ACTCTTCCCCACATGGAGGAAGG - Intronic
953007979 3:38995499-38995521 CTGCCTCCCAACATGGAGGAAGG - Intergenic
955113007 3:55967884-55967906 CTGCTTCAGCCCATGGTGAAAGG - Intronic
955148815 3:56346834-56346856 CTGCATCCTCCAATGGAGAAAGG + Intronic
955184186 3:56699367-56699389 CTGCGTCCTCACATGGCTAAAGG - Intergenic
955251581 3:57288230-57288252 CTGCTTCACCAAATGCGGAATGG + Exonic
955407515 3:58634788-58634810 CAGCTTCCCCATCTGTAGAATGG - Intronic
955613869 3:60784860-60784882 CTGTGTCCTCACATGGTGAAGGG - Intronic
956571862 3:70705569-70705591 CTGCATCCTCACATGGGGGAAGG + Intergenic
956812697 3:72879801-72879823 CTCCTTCCACTCATGGTGAAAGG - Intergenic
958720142 3:97833899-97833921 CTGCTTCCACTCATGGTGGAAGG + Intronic
959003227 3:100989147-100989169 CTGCATCCTCACATGGTGGAAGG - Intronic
959108828 3:102097270-102097292 CTGTTTCCACTCATGGTGAAAGG - Intergenic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960514447 3:118588291-118588313 CTGCTTCCACTCATGGTGGAGGG - Intergenic
961021583 3:123511989-123512011 CTGCTTCCACTCATGGGGGAAGG - Intronic
961198570 3:125025265-125025287 CTGCATCCCCACGGGGAGGAGGG + Intronic
961649797 3:128411587-128411609 CTGCCTGCCCACATGGAGTGAGG + Intergenic
961655307 3:128438541-128438563 CAGTTTCCCCACCTGAAGAATGG - Intergenic
961843373 3:129737519-129737541 CTGCATCATCACATGGTGAAAGG - Intronic
961870824 3:129986830-129986852 CTGCTTCCTCTCATGGTGGAAGG - Intergenic
962607618 3:137045570-137045592 CTGTATCCTCACATGGGGAAGGG + Intergenic
963059707 3:141215339-141215361 CTGCGTCCTCACATGGTGGAAGG + Intergenic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
963347741 3:144116017-144116039 CTGCATCCACACATGGTAAAAGG - Intergenic
963470902 3:145740568-145740590 CTGCTTCCACTCATGGCAAAAGG - Intergenic
963492453 3:146018361-146018383 CTGCTTCCAGAACTGGAGAAGGG - Intergenic
963766759 3:149344708-149344730 CTGCTTGACCACATTGAAAATGG + Intergenic
964201536 3:154122714-154122736 CTGCTTCCCCACTTTGAGGGCGG - Exonic
964679349 3:159320299-159320321 CTGTGTCCTCACATGGTGAAAGG - Intronic
964990228 3:162801699-162801721 CTGCATCCTCACATGATGAAAGG - Intergenic
965055701 3:163712006-163712028 TTGCTTCCCCCAATGAAGAAAGG + Intergenic
966062691 3:175778711-175778733 CTTCTTCCCCACTTGTAAAATGG - Intronic
966077337 3:175953448-175953470 CTGCATCGGCACATGGCGAAGGG - Intergenic
966297790 3:178444166-178444188 CTGCATCCCCACAAGGTGGAAGG - Intronic
966465544 3:180227687-180227709 CTGCTTGCACACTGGGAGAATGG + Intergenic
966493544 3:180555186-180555208 CTGCATTCCCACATGATGAAAGG + Intergenic
966558085 3:181286166-181286188 CTGTGTCCTCACATGAAGAAGGG - Intergenic
967146336 3:186609419-186609441 CTGCTTCCACTCATGGCGGAAGG - Intergenic
967190686 3:186982317-186982339 ATGCTTATCCACATGGAAAAAGG - Intronic
967325391 3:188233680-188233702 CTTTTTCCCCCCATTGAGAATGG + Intronic
967651940 3:191996414-191996436 CTGCTTCCACTCATGGTGGAAGG - Intergenic
968046539 3:195626866-195626888 CTGCGTCCTCACATGGGGGATGG - Intergenic
968154799 3:196371239-196371261 TTGCTACTCCAAATGGAGAAGGG + Intronic
968308114 3:197663175-197663197 CTGCGTCCTCACATGGGGGATGG + Intergenic
968680824 4:1918247-1918269 CTGGTCCCCCACATAGAGAAAGG - Exonic
969057637 4:4412195-4412217 CTGGTTCCCCACAGGGAGGAGGG + Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969296693 4:6274437-6274459 CTGTTTCCCCATATGTAAAATGG - Intronic
969866673 4:10080808-10080830 GTACTTTCCCACATGCAGAAGGG - Intronic
970084145 4:12326430-12326452 CTGCGTCCCTACATGGTGAGAGG - Intergenic
970412736 4:15825285-15825307 CTGTTTCCACTCATGGAGAAGGG + Intronic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970694992 4:18666719-18666741 CTGTGTCCTCACATGGTGAAGGG + Intergenic
970800091 4:19963067-19963089 CTGCATCCTCACATGGTGGAGGG + Intergenic
970809224 4:20072024-20072046 CTGCTTCCACTCATGGTGGAAGG + Intergenic
972503474 4:39698500-39698522 CTGCTTCCTCACAGGCAGAAGGG - Intronic
972739359 4:41876035-41876057 CTGCTTCCTCTCATAGACAATGG - Intergenic
972775819 4:42239531-42239553 CTGTGTCCTCACATGGGGAAAGG - Intergenic
972841383 4:42933696-42933718 CTGCATCTTCACATGGTGAAAGG - Intronic
972842374 4:42946654-42946676 CTGTATCCTCACATGGTGAAAGG + Intronic
973596637 4:52498152-52498174 CTGCTTCCTTACACGGTGAAAGG - Intergenic
973770934 4:54205813-54205835 CTGCGTCCTCACATGGTGGAAGG + Intronic
974637381 4:64582644-64582666 CTGTTTTCCCACATGGGGGAAGG + Intergenic
975805086 4:78103698-78103720 CTGTGTCCTCACATGGTGAAAGG - Intronic
976258439 4:83123174-83123196 CTGTGTCCTCACATGGTGAAGGG + Intronic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
977206950 4:94173822-94173844 CTCCATTCTCACATGGAGAAGGG - Intergenic
979133134 4:117074392-117074414 CTGCCTACCGACATGGAGAATGG - Intergenic
979213723 4:118137546-118137568 CTGCTGGCCCACATGCTGAAAGG + Intronic
979772688 4:124548401-124548423 CTGCTTCCACAAATGGTGAAAGG - Intergenic
980212938 4:129813730-129813752 CTGCTTCCCCTCATGGTGGAAGG + Intergenic
980244754 4:130224422-130224444 CTGCTTAGCCACATAGGGAAAGG + Intergenic
980379929 4:132000490-132000512 CTGTGTCCTCACATGGTGAAAGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980886767 4:138770899-138770921 TTCCTTCCTCACATGGTGAAAGG - Intergenic
980976571 4:139616785-139616807 CTGCATCCTCACATGGTGGAAGG + Intergenic
981033209 4:140146292-140146314 CTTCTGTCCCAAATGGAGAAAGG + Intronic
981959850 4:150523379-150523401 CTGTGTCCTCCCATGGAGAAAGG - Intronic
982104019 4:151996189-151996211 CTGCTGACCCACCTGGGGAATGG + Intergenic
982329409 4:154164503-154164525 CTGTGTCCTCACATGGTGAAAGG - Intergenic
982460139 4:155659492-155659514 CTGCTTCTCCTCCTGGAAAAAGG - Intergenic
982676019 4:158376696-158376718 CTGCATCATCACATGGAGGAAGG + Intronic
983573618 4:169236556-169236578 CTGCTTCCTCACCTGGAAAATGG + Intronic
983669688 4:170221714-170221736 CTGCCTCCACACATGGTGGAAGG - Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985745096 5:1642396-1642418 CTGCGTCCTCACATGGCGGACGG + Intergenic
986425407 5:7626597-7626619 CTGCCTCCACTCATGGATAATGG + Intronic
987115634 5:14724629-14724651 CTGCTTCCTCACTTGCAGAGTGG + Intronic
987228027 5:15863849-15863871 CTGCTTCCACTCATGGTGGAAGG - Intronic
988151074 5:27381299-27381321 CTGCTTCCTCACATGGTGGAAGG - Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988606558 5:32683605-32683627 CTGCTTCCACTCATGGTGGAAGG - Intergenic
989141724 5:38208057-38208079 CTCCTTTCCCACCTGTAGAAGGG + Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990120235 5:52442359-52442381 CTGTTTCCTCACATGGTGGAAGG - Intergenic
990465455 5:56067250-56067272 TTCCGTCCTCACATGGAGAAAGG - Intergenic
990513887 5:56514578-56514600 CTGCTTCCACTCATGGGGGAAGG - Intronic
990687629 5:58324403-58324425 CTGCTTCCTAACCTGTAGAATGG + Intergenic
992000382 5:72430425-72430447 CTGCTTCCACTCATGGTGGAAGG - Intergenic
992041217 5:72835473-72835495 CTGCATCCCCACATGGACGAAGG + Intronic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992999764 5:82368845-82368867 CAGATTCCCCACATGAATAAAGG - Intronic
993055430 5:82974841-82974863 TTTCTTCCCCACAAGAAGAAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993437409 5:87915017-87915039 CTGCTTCCACTCATGGTGGAAGG + Intergenic
994427678 5:99614321-99614343 CTGCATCCTCACATGATGAAAGG + Intergenic
994540304 5:101086719-101086741 CTACTTAGCCACAAGGAGAATGG - Intergenic
994663197 5:102677354-102677376 CTGTGTCCTCACATGGTGAAAGG - Intergenic
995058384 5:107787584-107787606 TTGCATCCTCACATGGCGAAAGG - Intergenic
995058585 5:107789321-107789343 CTGCATCCTCACATGGTGGAAGG - Intergenic
995316664 5:110782383-110782405 TTGCTTCCACACATGGAGAAAGG + Intergenic
995349963 5:111163867-111163889 CTGCTTCCACTCATGGTGAAAGG + Intergenic
995394182 5:111670118-111670140 CTGCATCCTCACATGGCAAAAGG + Intronic
995512009 5:112919653-112919675 CTGCTTCCTCACATGGTAGAAGG - Intronic
995856364 5:116597127-116597149 CTGCTTCCACTCATGGTGAAAGG - Intergenic
996258174 5:121430898-121430920 CTGCTTCCACTCATGGCAAAAGG - Intergenic
998326589 5:141286391-141286413 CTTCTTCCACTCATGGTGAAAGG + Intergenic
999282594 5:150375066-150375088 CTGCTTCCCCACCTGGACCTGGG - Exonic
999297229 5:150467305-150467327 CTGCATCCTCACATGGTGGAAGG - Intergenic
999816699 5:155184107-155184129 CTCCATACCCACATGGAGAGAGG - Intergenic
1000095871 5:157970400-157970422 CAGTTTCCCCATACGGAGAATGG + Intergenic
1000375245 5:160574734-160574756 CTGTGTCCTCACATGGTGAAAGG - Intronic
1000827284 5:166060617-166060639 CTGCATCATCACATGGAGGAAGG - Intergenic
1001117279 5:168950208-168950230 CTACTTCCTCACATGGAGGAAGG - Intronic
1002459496 5:179365974-179365996 CTGCTTCCACTCATGGAGGAAGG - Intergenic
1003227092 6:4215795-4215817 CTGCTTCCACTCATGGCAAAAGG - Intergenic
1003733572 6:8852959-8852981 CTGCTGCCAAACATGGAGTAAGG + Intergenic
1004665029 6:17741606-17741628 CTGCCTGGCCCCATGGAGAAGGG + Intergenic
1005222418 6:23601845-23601867 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1005353525 6:24960341-24960363 CTGTGTCCTCACATGGAGAAGGG + Intronic
1006938780 6:37737704-37737726 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1007083848 6:39128728-39128750 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1007239289 6:40413623-40413645 CATCTTCCCAGCATGGAGAAGGG + Intronic
1007478984 6:42137664-42137686 TTCCTTCCCCACATGGAGCAAGG - Intronic
1007501936 6:42305114-42305136 CGGCTTCCTCACTTGTAGAATGG - Intronic
1007828114 6:44616975-44616997 CTGCATCCTCACATGGTGGAGGG - Intergenic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008533356 6:52485736-52485758 CTGCTTCCCTTCATGGTGGAAGG - Intronic
1008671282 6:53771866-53771888 CTGCTTTCACTCATGGAGGAAGG + Intergenic
1008840441 6:55896609-55896631 CTGCGTCCTCACATGGTGAAAGG + Intergenic
1009314746 6:62204049-62204071 CTGCTTCCACTCATGGTGGAAGG - Intronic
1009856069 6:69265458-69265480 CAGCTTCCCCATATGGAACATGG - Intronic
1010233885 6:73558981-73559003 CTGCTCCCCCTCCTGGAGGATGG - Intergenic
1010249464 6:73693244-73693266 CTGCTTCCACTCATGTGGAAGGG + Intergenic
1010509025 6:76694647-76694669 GTGATTCCCTACATGGAGCAAGG + Intergenic
1011000352 6:82581770-82581792 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1011503876 6:88020059-88020081 ATGCTCACCCACATTGAGAAAGG + Intergenic
1011689822 6:89856919-89856941 CAGCTTCCCCACCTGTATAAGGG + Intronic
1012879350 6:104766946-104766968 CTGTTTCCTCACCTGTAGAAAGG + Intronic
1013693295 6:112670314-112670336 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1013781863 6:113737717-113737739 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1014220539 6:118794713-118794735 CTGCCTCTTCATATGGAGAAAGG - Intergenic
1014294848 6:119605685-119605707 CTGTGTCCCCACATGGCTAAGGG + Intergenic
1014503618 6:122225793-122225815 CTGCATCCTCACATGGTGGAAGG + Intergenic
1014525105 6:122493291-122493313 CTGTGTCCTCACATGGTGAAAGG - Intronic
1015656559 6:135525169-135525191 CTGTTTCCCCATATGGTGGAAGG - Intergenic
1016861689 6:148726514-148726536 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1016983395 6:149874927-149874949 CTGCATCCCCACATGGTGGAAGG + Intergenic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1017803865 6:157925953-157925975 CTGAGTCCCCACATGGTGGAAGG + Intronic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018334791 6:162775135-162775157 CTGGGTCCCCACATGGTGGAAGG - Intronic
1018503668 6:164441250-164441272 CTGCTTCCACATATAAAGAATGG - Intergenic
1018782194 6:167078298-167078320 CTGCATCCTCACAGGGAGAAGGG + Intergenic
1018973337 6:168544725-168544747 CAGTTTCCACACATGCAGAAGGG - Intronic
1018979008 6:168588067-168588089 TTGTTTCCTCACATGGTGAAAGG + Intronic
1019085504 6:169471909-169471931 CTGCTTCCTCACATGGCGGGAGG + Intronic
1019885812 7:3903969-3903991 CTGCTTCCACTCATGGTGGAAGG - Intronic
1021263978 7:18496113-18496135 CTGCTTCTCCTCAGGGAGGAGGG + Intronic
1021559905 7:21959210-21959232 CTGCTTCCACGCATGGTGAAAGG - Intergenic
1022386811 7:29907646-29907668 CTGCATCTTCACATGGTGAAAGG - Intronic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1022652911 7:32293583-32293605 CTGTTTCCTCACATGTAAAATGG - Intronic
1023843694 7:44109763-44109785 CAGCTGCCCCATCTGGAGAACGG - Intronic
1024244101 7:47456408-47456430 CAGATTCCCCACCTGGGGAATGG + Intronic
1024316561 7:48024683-48024705 CTGCTTCCGCTCATGGTGGAAGG + Intronic
1024390591 7:48807210-48807232 CTGTGTCCTCACATGGTGAAGGG - Intergenic
1024568564 7:50705186-50705208 CTGCTTCCCCCCATTGTGAGTGG - Intronic
1024846375 7:53648196-53648218 CTGCTTCCACCAATGGTGAAAGG + Intergenic
1024985040 7:55187339-55187361 TTGTTTCCCCATATGTAGAATGG - Intronic
1026019631 7:66697257-66697279 CTACTTCCCCACCTGGAGAATGG + Intronic
1026401650 7:70020305-70020327 CTGCATCCCCACATAGAGCCAGG + Intronic
1026404064 7:70046310-70046332 CAGCTTCCCTACATGTAAAATGG + Intronic
1026594390 7:71722221-71722243 CTGCTTCCACTCATGGGGGAAGG + Intergenic
1026880753 7:73905323-73905345 CTACTTCCCCATGTGAAGAATGG - Intergenic
1026984783 7:74547893-74547915 CAGTTTCCCCAGATGCAGAATGG + Intronic
1027154866 7:75759715-75759737 CTGCTTCCTCACATGGCAGAAGG - Intergenic
1028110745 7:86938131-86938153 CTTCTTCATCACATGGAGTATGG + Exonic
1028124304 7:87094273-87094295 CTGCTTCAGTACATGGAGAAAGG - Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1030271073 7:107668800-107668822 CTGCGTCCTCACATGGTGGAAGG + Intronic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1031123044 7:117742913-117742935 CTGCTGCCCCTCCTGGAGATGGG + Intronic
1031506965 7:122596942-122596964 CTGCTTCCACACCTGGTGGAAGG + Intronic
1031512252 7:122665181-122665203 CTGCTTGCCCACATGCAGACAGG - Intronic
1031609536 7:123808838-123808860 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1032742050 7:134748944-134748966 CTGTGTCCTCACATGGTGAAAGG - Intronic
1033234758 7:139629521-139629543 CTGTTTCCCCATCTGGAAAATGG - Intronic
1034139268 7:148801368-148801390 CAGTTTCCCCACCTGCAGAAAGG - Intergenic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034362254 7:150510311-150510333 CTGTGTCCCCACATGGTGGAAGG - Intergenic
1034402708 7:150876089-150876111 CTGCGTCCTCACATGGTGGAAGG + Intergenic
1034530569 7:151693756-151693778 CTGCGTCCTCACATGGTGGAAGG - Intronic
1034543969 7:151777576-151777598 CTGCTTCCACTCATGGAGGAAGG - Intronic
1034563689 7:151897138-151897160 CTGCTTCCTCTTATGGAGAAAGG + Intergenic
1034726442 7:153340554-153340576 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1034750829 7:153567581-153567603 CTGCCTCCACTCATGGCGAAAGG + Intergenic
1034780269 7:153873073-153873095 CTGCTTCCACTCATGGTGAAAGG + Intergenic
1034888930 7:154822353-154822375 CTGCGTCCTCACATGGTGGAAGG + Intronic
1034949832 7:155289832-155289854 CTGCATCCTCACATGGTGAAGGG + Intergenic
1035619521 8:1027332-1027354 CTGGTACCACACCTGGAGAATGG - Intergenic
1036130200 8:6102788-6102810 CTGCCTCCTCACCTGGAGGAAGG + Intergenic
1036391727 8:8329794-8329816 CTGCTGCTCCACAGGGAGGAGGG + Intronic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1037393749 8:18420686-18420708 CTGCTTCCACACATGGTGGAAGG - Intergenic
1037503415 8:19506782-19506804 CTGCTTCCACTCATGGTGGAAGG - Intronic
1037682959 8:21113378-21113400 TTGTTTCCGCTCATGGAGAAGGG + Intergenic
1037925303 8:22839466-22839488 CTGATTCTCCACATGCAAAATGG + Intronic
1038270893 8:26074899-26074921 CTGCTTCCACTCATGGCGGAAGG + Intergenic
1038277907 8:26137111-26137133 TTGCATCCTCACATGGTGAAAGG - Intergenic
1038340540 8:26681685-26681707 ATGCATCCTCACATGGTGAAGGG - Intergenic
1038701713 8:29855298-29855320 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1038922143 8:32096611-32096633 CCACTTCCCCTCATGGAGGAAGG + Intronic
1039214803 8:35258146-35258168 CTGCATCGTCACATGGAGGAAGG + Intronic
1039954332 8:42195519-42195541 CTGCTTCCTCCCGGGGAGAAAGG - Intronic
1040618659 8:49064783-49064805 CAGCTTCCTCATATTGAGAATGG + Intronic
1040693186 8:49964253-49964275 CTGGCTCCCCACAAGGAGGAGGG + Intronic
1041812645 8:61928454-61928476 CTGCTTCCACAAGTGGTGAAAGG - Intergenic
1042058776 8:64794553-64794575 CTGTGTCCTCACATGGACAAAGG + Intronic
1042201204 8:66280774-66280796 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1042405203 8:68396813-68396835 CTGCTTCCCCTCATGGCAGAAGG - Intronic
1042851146 8:73217172-73217194 CTGTTTCCCCACATGGCTGAAGG - Intergenic
1043104814 8:76094545-76094567 CTGCTTCCACTCATGGGGGAAGG - Intergenic
1043448264 8:80340474-80340496 CAGCTTCCCCAGATGGGGCAAGG + Intergenic
1044415556 8:91935336-91935358 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1044801100 8:95957256-95957278 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1044868759 8:96598117-96598139 CTGCATCCTCACATGGCAAAGGG + Intronic
1045404475 8:101852008-101852030 CTGCATCCTCACATGGTGGAAGG - Intronic
1046079430 8:109353341-109353363 CTGCATCCTCACATGGTGGAAGG + Intergenic
1046427116 8:114068637-114068659 CTAATTCCCCAAATGGAAAAAGG - Intergenic
1046601670 8:116324430-116324452 CTGTTTCTCCAAATGGAAAATGG - Intergenic
1046805538 8:118475339-118475361 CTGCTTCCACTCATGGAGAATGG - Intronic
1047213989 8:122862357-122862379 CGGTTTCCCCACGTGGAGAATGG + Intronic
1047721162 8:127641006-127641028 CTGTCTCCCCAGATGGAGCATGG - Intergenic
1047767549 8:128001816-128001838 CCGCGTCCTCACATGGAGGAAGG + Intergenic
1047833976 8:128667776-128667798 TTCTTTCCCCACATGGAGTATGG - Intergenic
1048180380 8:132189078-132189100 CTGCTTCCCCACATCCAGGCTGG + Intronic
1048399121 8:134047188-134047210 CAGCGTCCTCACATGGTGAAAGG - Intergenic
1048578878 8:135714692-135714714 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1048589499 8:135808090-135808112 CTGTTTCCCCACCTGTAAAATGG - Intergenic
1048822206 8:138391009-138391031 CTACTTCCCAAGATGAAGAATGG + Intronic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1050651562 9:7782436-7782458 CTGCTTCCTCAGCTGGAAAATGG - Intergenic
1050994811 9:12203120-12203142 CTGCTTGCACTCATGGTGAAAGG + Intergenic
1051701261 9:19826628-19826650 CTGTGTCCTCACATGAAGAAAGG + Intergenic
1052024435 9:23558871-23558893 CTGTGTCCCCACATGGTAAAAGG - Intergenic
1052605023 9:30688535-30688557 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1053072403 9:35109007-35109029 CTCCTGCCCTACATGGAGGAAGG + Exonic
1053229371 9:36393587-36393609 CTGCCTGCGCACATGGGGAAGGG - Intronic
1053287311 9:36858415-36858437 CAGTTTCCCCAAATGGACAATGG + Intronic
1053377175 9:37617434-37617456 CTGTTTCCTCACATGTAAAATGG + Intronic
1053449830 9:38184153-38184175 CTGCTTCCCCTCATGGCAGAAGG + Intergenic
1053595033 9:39551872-39551894 TTGCTTCCACACATGGCGGAAGG - Intergenic
1053852815 9:42306900-42306922 TTGCTTCCACACATGGCGGAAGG - Intergenic
1054571221 9:66813101-66813123 TTGCTTCCACACATGGCGGAAGG + Intergenic
1055426682 9:76203951-76203973 CTGCTTCCCCATTTGGATGATGG + Intronic
1055434071 9:76274888-76274910 CTGCTTCCACTCATGGTGGAAGG + Intronic
1056842878 9:90012954-90012976 CTGTGTCCTCACATGGTGAAAGG - Intergenic
1057113504 9:92497963-92497985 CTGCTTCCACTCATGGTGGAAGG - Intronic
1057974391 9:99588881-99588903 CTGCATCCTCACATGGTGGAAGG - Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1058808643 9:108617595-108617617 CTGCTTCCCCTCATGGTGGAAGG - Intergenic
1058816126 9:108684342-108684364 CTCATTCTCCATATGGAGAAGGG - Intergenic
1058918799 9:109593674-109593696 CTGCTTCCACTCATGGAGGAAGG + Intergenic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1060175338 9:121493439-121493461 CAGTTTCCCCACATGCAAAATGG + Intergenic
1060500375 9:124149260-124149282 CTGTTTCCTCACATGGTGGAAGG + Intergenic
1060846166 9:126839290-126839312 CTTCTTCCCCATACAGAGAATGG - Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061734675 9:132645840-132645862 CTGCGGCCCCACGTGGAGATGGG - Intronic
1061824115 9:133247235-133247257 CAGTCTCCCCACATGGACAATGG - Intergenic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1062606528 9:137351077-137351099 CTGCTTCTCCACATGGGCCAGGG + Exonic
1185845321 X:3432496-3432518 CTGTGTCCCCACATGGTGGAAGG + Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185989618 X:4878573-4878595 CAGTTTCCCAACATGCAGAATGG + Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186703217 X:12113693-12113715 ATGCTTCCTTACATGGCGAAAGG - Intergenic
1186963463 X:14762130-14762152 CTGCATCCTCACATGGTGGAAGG + Intergenic
1187205839 X:17180409-17180431 CTGTTTCCTCACCTGGAAAAAGG + Intergenic
1187268491 X:17759152-17759174 AGACTTCCCAACATGGAGAACGG - Intergenic
1187412173 X:19061082-19061104 CTCCTTCCTCATATGGAGGAGGG + Intronic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1187563350 X:20423379-20423401 CTGCATCCTCACATGGTGAAAGG - Intergenic
1188280196 X:28258226-28258248 CTGCTACCCCAGATGGAGAGAGG + Intergenic
1188295349 X:28440758-28440780 CTGCTTCCACACATGGTGGAAGG - Intergenic
1188317455 X:28691990-28692012 CTGCTTCCCCTCATGGCTGAAGG + Intronic
1189139411 X:38585873-38585895 CTACTTCCACACATGGTGGAAGG - Intronic
1189601692 X:42633530-42633552 CTGCGTCCTCACATGGCCAAAGG - Intergenic
1189740147 X:44109446-44109468 CTGCATCCTCACATGGTGGAAGG + Intergenic
1191054133 X:56224931-56224953 CTGCCTCCTCACATGTAGGAAGG + Intergenic
1191719995 X:64221514-64221536 CTGTGTCCTCACATGGTGAAAGG + Intergenic
1192185222 X:68942029-68942051 CTGCTTCCCCACATCAAACAAGG - Intergenic
1192570921 X:72203729-72203751 CTGTTTCCTCACATGAAAAATGG + Intronic
1192989865 X:76438892-76438914 ATGCTTCCATTCATGGAGAAAGG - Intergenic
1193326524 X:80184201-80184223 CTGCTTCCACTCATGGTGGAAGG - Intergenic
1193577567 X:83220777-83220799 CTGCATCCTCACATGGCCAAAGG + Intergenic
1195218768 X:102726165-102726187 CAGCTTCCTCATATGTAGAATGG - Intronic
1196343577 X:114625530-114625552 CTGCTTCCACTCATGGTGGAAGG - Intronic
1196567424 X:117225741-117225763 CTGCTTCCTCACATGGTGGAAGG - Intergenic
1196776459 X:119342662-119342684 CTGCTTCCACTCATGGTGGAAGG + Intergenic
1197151879 X:123229064-123229086 CTGCTACCCATCATGGAGATGGG - Intronic
1197610933 X:128637431-128637453 CTGTGTCCTCACATGGCGAAAGG + Intergenic
1197787140 X:130210026-130210048 CTGCGTCCTCACATGGTGGAAGG - Intronic
1198129684 X:133681238-133681260 CAGCTTCCCCACACGTAAAATGG - Intronic
1198164478 X:134041048-134041070 CTGCATCCTCACATGCAGAAGGG - Intergenic
1198263084 X:134983878-134983900 CTGTTTCCTCACATGGCAAAAGG - Intergenic
1198308337 X:135404618-135404640 CTGAGTCCTCACATGGTGAAGGG + Intergenic
1198678607 X:139157542-139157564 CTGCATCACAACATGGTGAAGGG - Intronic
1198692915 X:139303561-139303583 CTGCCACCCCAAATGGAAAAAGG - Intergenic
1199045009 X:143159513-143159535 GTGCTTCCCCAAAGGGAGGAAGG - Intergenic
1199293881 X:146135674-146135696 CTGCTTTCACTCATGGTGAAAGG + Intergenic
1199741563 X:150740779-150740801 CTGCTTCCACTCATGGTGGAAGG + Intronic
1200283020 X:154794625-154794647 CTCCTTCCCCACACAGTGAATGG - Intronic
1201511153 Y:14764698-14764720 CTGTGTCCCCACATGGGAAAAGG + Intronic
1201597146 Y:15682957-15682979 CTGCATCCTCACATGGTGGAAGG - Intergenic