ID: 1142367525

View in Genome Browser
Species Human (GRCh38)
Location 16:89657873-89657895
Sequence GGACCCGGGCTTGCGTCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142367521_1142367525 -9 Left 1142367521 16:89657859-89657881 CCGCGGAGGTGTGGGGACCCGGG 0: 1
1: 0
2: 3
3: 19
4: 209
Right 1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1142367514_1142367525 4 Left 1142367514 16:89657846-89657868 CCCGGCTCCGCGGCCGCGGAGGT 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1142367510_1142367525 20 Left 1142367510 16:89657830-89657852 CCTTTTGTGAGTCGCTCCCGGCT 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1142367519_1142367525 -3 Left 1142367519 16:89657853-89657875 CCGCGGCCGCGGAGGTGTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1142367515_1142367525 3 Left 1142367515 16:89657847-89657869 CCGGCTCCGCGGCCGCGGAGGTG 0: 1
1: 0
2: 0
3: 25
4: 167
Right 1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142367525 Original CRISPR GGACCCGGGCTTGCGTCGGA GGG Exonic
1063636532 10:7787988-7788010 GGAACCGGGCTGGCGGCGGTGGG + Intergenic
1072552343 10:96488430-96488452 GAGCCCGGGCTGGCGTGGGAAGG - Intronic
1083623174 11:64058934-64058956 GGACCCAGGCTACCGTGGGAGGG + Intronic
1089712457 11:120325448-120325470 GGGCCCGGGCTCGCCTCCGAAGG + Intronic
1095741493 12:45611343-45611365 GGACTCGGGCTGGCGCCGGATGG - Intergenic
1106109116 13:26761034-26761056 GGCCCCGGGCTTGCACCGGGCGG + Intergenic
1117206176 14:53445938-53445960 GGACACGTGCTTGAGTAGGACGG + Intergenic
1119775094 14:77243259-77243281 GGACCAGGGCTAGAGTGGGAAGG + Intronic
1124371490 15:29107020-29107042 GGACCCGGGCTGGCCTGGGGTGG + Intronic
1131074477 15:89486685-89486707 GGACCCGGGCTTGAGGCTGGAGG - Intronic
1136183908 16:28573803-28573825 GGACCCAGGCCTGGGTCTGAGGG + Intronic
1136248811 16:28990208-28990230 GGAACCAGGCTTGCCTGGGACGG + Exonic
1136399365 16:30009446-30009468 GGGCCCGGGCTTGGGTGGCAGGG + Intronic
1137250377 16:46736807-46736829 GGCCCCGGGCTTCTCTCGGAGGG - Intronic
1140829771 16:78740432-78740454 GGACCCCGGCTGGCTGCGGAAGG + Intronic
1142367525 16:89657873-89657895 GGACCCGGGCTTGCGTCGGAGGG + Exonic
1151662137 17:75524915-75524937 TTTCCCGGGCCTGCGTCGGAGGG + Intergenic
1158530503 18:58256102-58256124 GGTCCCGGGCTGCCCTCGGAGGG - Intronic
1160706151 19:531292-531314 GGACGCGGGGTCGCGCCGGATGG + Intergenic
1160718402 19:586809-586831 GGACCCGGGCTTTCTTCCAAAGG + Intergenic
1161978362 19:7618321-7618343 GGACCCCGGCCAGCCTCGGAGGG - Intergenic
1162480213 19:10923277-10923299 GGACCCGGGCCTTCCTAGGAGGG + Exonic
1163138668 19:15332004-15332026 GGACCCGGGCTTGGGCTGGCCGG - Intronic
1168692715 19:58386549-58386571 GGGCCCGGGGTTGCGGCGGCGGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1178487375 21:33027595-33027617 GGATCCGGGCTGCCGTCGGTCGG + Exonic
1181681978 22:24501728-24501750 GGAACCAGGCTTGCCTCTGAAGG + Intronic
1184679287 22:46061710-46061732 GGTCCGGGGCCTGCGTCCGAGGG - Intronic
969726412 4:8920842-8920864 GGGCCCGGGCCTGAGTGGGAGGG + Intergenic
970664072 4:18317475-18317497 GGACCCAGGCTTCAGTCTGAGGG - Intergenic
991054307 5:62305786-62305808 GGATCCGGGTTTTCATCGGAAGG - Intergenic
1002277573 5:178113797-178113819 GGACCCGGGCTGGACTCGGGGGG + Intronic
1007222108 6:40286874-40286896 GGACCCGGGCTTCAGGCTGAGGG + Intergenic
1019341435 7:510690-510712 GGCCCCGGGCTTGGGTGGGGAGG + Intronic
1026787101 7:73308635-73308657 GAACCCGGGGTGGGGTCGGACGG - Intronic
1035881442 8:3247511-3247533 GGACCTGAGCTTGCCTCGTAGGG - Intronic
1036707972 8:11059387-11059409 GGAGCCGGGCTGGCGCCCGAAGG + Intronic
1060976470 9:127768002-127768024 GGAACCGGGCTGGCTTGGGAAGG - Intronic
1062357094 9:136170162-136170184 GGGCCCGGGCTTGCCCAGGAGGG - Intergenic
1190320420 X:49176509-49176531 GCACCCGGGGTGGCTTCGGATGG + Intronic
1200086640 X:153610326-153610348 GGGCCCGGGGTTGCGGCGGGGGG + Intergenic