ID: 1142367810

View in Genome Browser
Species Human (GRCh38)
Location 16:89659309-89659331
Sequence CCCGCAGAGCCTGCCGTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142367802_1142367810 25 Left 1142367802 16:89659261-89659283 CCAGCAAGGCCTTGCAGTAGGAA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG 0: 1
1: 0
2: 1
3: 11
4: 126
1142367803_1142367810 16 Left 1142367803 16:89659270-89659292 CCTTGCAGTAGGAATTGCAGAAG 0: 1
1: 0
2: 2
3: 17
4: 217
Right 1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142367810 Original CRISPR CCCGCAGAGCCTGCCGTCCG AGG Intronic
900147603 1:1165261-1165283 CCAGCTGAGCCTGCCGGCCCAGG + Intergenic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
902210592 1:14901738-14901760 CCCGGACAGCCTGGCGTCCAAGG + Intronic
905231071 1:36515287-36515309 CCCCCAGAGCCTGCTCTCCCTGG - Intergenic
906423344 1:45688538-45688560 CCCGCATCACCTGCCGTCCCTGG + Intronic
906612262 1:47211843-47211865 TCTGCAGAGCCTGCCTTCCTAGG - Intergenic
910200109 1:84690450-84690472 CTCGCAGCGCCTCCCGCCCGCGG + Exonic
910676544 1:89821545-89821567 CCCGCAGGGCCGGCCGCCCGGGG - Intronic
916666983 1:166975544-166975566 GCCGCAGAGCCCGCCGCGCGGGG + Intergenic
1070149422 10:73796918-73796940 CCTGCAGAGCCTGAGGTCAGTGG - Exonic
1071579300 10:86755875-86755897 CCGGCAGATCCTCCCGGCCGGGG + Intergenic
1072540889 10:96397241-96397263 CACCCAGAGCCGGCTGTCCGTGG + Exonic
1076342495 10:129759421-129759443 GCAGCACAGCCTGCCTTCCGAGG - Intronic
1076481467 10:130787842-130787864 ACCCCAGAGCCTGCCTTCAGGGG - Intergenic
1076737832 10:132466679-132466701 CCTGCTGAGCCTGCTGTCCTCGG + Intergenic
1081657164 11:44864923-44864945 CCAGCAGAGCCTGCCATGTGGGG + Intronic
1083897378 11:65626815-65626837 ACCGCACAGCCTGCCCTCCTAGG + Intronic
1084724239 11:70930257-70930279 CCGGCAGAGCATGACGTCTGTGG - Intronic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1085392961 11:76191847-76191869 CGCGCAGAGCCTGCGGACAGGGG + Exonic
1089356343 11:117856460-117856482 CCCTCAGAGCTTGTCATCCGTGG - Intronic
1089645798 11:119877910-119877932 CCAGCAGAGTCTGCAGCCCGAGG - Intergenic
1090189381 11:124758577-124758599 CCCGCGGACCCTGCCCTACGCGG + Intronic
1092871959 12:12813279-12813301 CGCGCAGAGCACGTCGTCCGGGG + Intronic
1102677770 12:114669641-114669663 CCCACACAGCCTGCAGTCCCTGG - Intergenic
1102965430 12:117121622-117121644 CCCGCAGATCCTGCAGCCCCCGG - Intergenic
1103336697 12:120195008-120195030 CCCGCAGGGCCAGCCCTACGTGG + Intergenic
1113388901 13:109876465-109876487 CCAGCAGAGCCTGTGGTCCCAGG - Intergenic
1115610769 14:35046638-35046660 GCCGCCGAGGCTGACGTCCGGGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118887557 14:69879522-69879544 CTCGCAGAGGCTGCGGTCAGGGG - Exonic
1119770478 14:77217702-77217724 AATGCAGAGCCTGCCGTCCCTGG - Intronic
1122139456 14:99653719-99653741 CCTGCAGAGCCTGCACTCTGTGG + Intronic
1124252683 15:28117298-28117320 CAGGCAGACCCTGCCGTCTGGGG + Intronic
1129062799 15:72873728-72873750 CCTGCAGAGCCAGCTGTCCTGGG - Intergenic
1132878296 16:2149821-2149843 CCCGCTGAGCCTGCAGGCCTGGG + Intronic
1132903536 16:2270988-2271010 CCTGCAGTGCCTGCCCTCAGAGG + Intergenic
1133002317 16:2857582-2857604 CCCGTCCAGCCTGCCTTCCGGGG + Intronic
1135309689 16:21395824-21395846 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1136149267 16:28336137-28336159 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1136306433 16:29374948-29374970 CAGGCAGAGCCTGCAGTCCCAGG + Intergenic
1137300397 16:47143537-47143559 CCCGCAGGGGGCGCCGTCCGTGG + Intronic
1140041644 16:71412262-71412284 TGCACAGAGCCTGCCGTCAGTGG - Intergenic
1141553200 16:84819850-84819872 CCCGCTGAGCCTGCGGGGCGGGG + Intergenic
1141596680 16:85101158-85101180 CCCACAAAGCCTGCCATCCCTGG - Intronic
1141617732 16:85219868-85219890 CCAGGAGAGCCTGCCTTCCCTGG - Intergenic
1141756839 16:85996993-85997015 CCCCCAGGGCCTGCAGTCCCTGG + Intergenic
1142153105 16:88521348-88521370 GCCCCAGAGCCTGGCGTCAGGGG - Intronic
1142270760 16:89088246-89088268 GCCGCAGAGCCTGCAGTGGGAGG + Intergenic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1143027114 17:3947468-3947490 CGTGCGAAGCCTGCCGTCCGTGG - Exonic
1143749957 17:9021164-9021186 CCCGGAGAGCCTCACGCCCGGGG - Intergenic
1144778734 17:17797477-17797499 CTGGCAGGGCCTGCCCTCCGGGG - Exonic
1147726063 17:42566889-42566911 CCCGCCGTGCCTGCCCTCCCCGG - Intergenic
1148676859 17:49450827-49450849 GCCACAGAGCCTGCCTTCCTGGG - Intronic
1151436782 17:74102612-74102634 CGTGCAGAGCCTGGCGTCCTGGG - Intergenic
1152276301 17:79359654-79359676 CCTGCAGAGCCAGCCCTCCCTGG - Intronic
1152554612 17:81046656-81046678 ACCTCAGAGCTTGCTGTCCGGGG - Intronic
1153219246 18:2847440-2847462 CCCGCAGAGGGAGCCGCCCGGGG - Intronic
1160517533 18:79486777-79486799 CCCGCAGCACCTGCCGTCCACGG + Exonic
1161101799 19:2425214-2425236 GACGCAGCGCGTGCCGTCCGGGG - Exonic
1161143047 19:2660113-2660135 CTCACAGAACCTGCCATCCGTGG + Intronic
1161383019 19:3976522-3976544 CCTGCAGCGCCTGCCGCCCCGGG - Exonic
1162324184 19:9989149-9989171 CCCGGAGGGCCTGCCGACCCTGG + Exonic
1162809536 19:13155679-13155701 GCGGCAGAGCCAGCCGTCGGCGG - Intergenic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1167145790 19:47680349-47680371 CCCGCAGAACCTGACGTTCATGG + Exonic
925818927 2:7779973-7779995 CTCTCAGAGCCTACCGTCGGGGG + Intergenic
925981945 2:9184256-9184278 GCCGCAGAGCCAGCCGTTTGGGG - Intergenic
926115536 2:10210661-10210683 CCCGCAAAGCCTGCAGGCCAGGG + Exonic
927591275 2:24360223-24360245 CCCGCAGAGCCTCCGGGCAGCGG + Intronic
927811844 2:26184826-26184848 GCCGCAGGGCCTGCTGGCCGGGG + Exonic
927964876 2:27262515-27262537 CCCGCGGCGCCTGCCTTCCCTGG - Intronic
929893175 2:45936104-45936126 CCCTCAGTGCCTGCCCTCCTAGG - Intronic
930115946 2:47718336-47718358 CCCGCTGAGCCTGGCGACCTTGG + Intronic
930728824 2:54708973-54708995 CCCTCGGAGCCTGCCGTCCTGGG + Intergenic
937310521 2:120900022-120900044 CATGCAGAGGCTGCCGGCCGGGG + Intronic
937912396 2:127081909-127081931 CCAGCAGAGCCTGCGGTCGGGGG + Intronic
938953979 2:136281889-136281911 CCAGCAGAGCCTGCGGCCTGCGG - Intergenic
940807801 2:158207479-158207501 CCAGCAGAGCCTGGAGTCCTGGG - Intronic
947739027 2:232476485-232476507 CCCGCAGAACCTGCCCCCAGAGG + Intergenic
948462377 2:238136369-238136391 CCCGCAGACCCTCCCGCCCCAGG - Intergenic
948897147 2:240932854-240932876 CCCGCATGGCCTGCAGTGCGGGG - Intronic
1173743550 20:45419401-45419423 GCCGCAGAGCCTGGCAGCCGGGG + Intronic
1174204417 20:48828247-48828269 CCCGCGGAGCCGGGAGTCCGAGG + Intergenic
1175372518 20:58501483-58501505 TCTGCAGAGCCTGCCCTCCCTGG - Intronic
1175918454 20:62438541-62438563 CCCCCAGAGCCTGGCGACAGCGG - Intergenic
1178442783 21:32612293-32612315 CCCGCGGGTCCTGCCGGCCGAGG + Exonic
1178671513 21:34595546-34595568 CCTGCAGAGCCTGGGCTCCGGGG - Intronic
1182667596 22:31970873-31970895 CCCACGGAGCCTGGCGGCCGCGG - Intergenic
1185329729 22:50246827-50246849 CCCACAGGTCCTGCCGTCAGAGG + Intronic
961340432 3:126213537-126213559 CCCGCAGGGCCTGGCGCCTGGGG + Intergenic
962244000 3:133776282-133776304 CTCGGAGAGCCTGCCCTCTGGGG + Intronic
962378527 3:134878063-134878085 CACTCAGTGCCTGCCCTCCGGGG - Intronic
962876536 3:139539646-139539668 CCCGCAGAGCCCCCTGTCCCCGG - Exonic
968526317 4:1059421-1059443 CCTGCAGAGACTGCCCTCCTAGG + Intronic
968903878 4:3443056-3443078 CCTGCAGGGCCTCCCGTCCTCGG - Exonic
969396252 4:6923560-6923582 CCGGCACAGCCTCCAGTCCGTGG + Exonic
969516619 4:7651768-7651790 CCCGCAGGGCCTGCATTCCAAGG + Intronic
969552583 4:7880884-7880906 TCTGCAGAGCCTGTCGCCCGTGG - Intronic
974894840 4:67926711-67926733 CCCCCAGAGCCTGCCACCCTGGG + Intronic
986119981 5:4826148-4826170 TCCTCAGAGCCTGCAATCCGTGG + Intergenic
990753141 5:59039536-59039558 CGCGCTGCGCCTGCCGCCCGAGG - Intronic
994245641 5:97472160-97472182 CCCGCAGAGCCTGCCATCCTAGG - Intergenic
998192775 5:140041939-140041961 CCCGCAGACCCTGCCAGCCTGGG + Intronic
999721942 5:154405080-154405102 CCCGCACAGCTTTCCCTCCGGGG + Intronic
1003065707 6:2902346-2902368 CCTGCAGAGCCTGCGGTCTGTGG - Intronic
1003086429 6:3064573-3064595 CCTGCAGAGCCTGCGGTCTGTGG + Intronic
1003409720 6:5851550-5851572 CCCGCAGGCCCTGCCATCCTCGG + Intergenic
1006108185 6:31729083-31729105 CCCAGAGAGCCTGGCGTCGGGGG - Exonic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1006817085 6:36858916-36858938 CACGCAGAGCCTGGCCTCTGTGG - Intronic
1015076102 6:129159454-129159476 CCGGCAGATCCTCCCGGCCGGGG - Intronic
1019434245 7:1013555-1013577 CCCACAGACCCTGCAGTCTGGGG + Intronic
1019516083 7:1440799-1440821 CCCCCACAGCCAGCCGGCCGGGG + Intronic
1020086282 7:5312574-5312596 GCGGCAGCGCCTGCCGTCCGTGG - Exonic
1021902379 7:25298862-25298884 CCAGCAGAGACTGCCGTCATAGG + Intergenic
1023064816 7:36366954-36366976 CCCGCGGAGCCCGCCGCCCCGGG - Intronic
1025208025 7:57004498-57004520 GCGGCAGCACCTGCCGTCCGTGG + Intergenic
1025663928 7:63572377-63572399 GCGGCAGCGCCTGCCGTCCGTGG - Intergenic
1027217347 7:76192583-76192605 CCAGCACAGCCTGCCGTCAAGGG + Intergenic
1029595907 7:101537598-101537620 CCCACAGAGCCTGCAGACCTGGG - Intronic
1033220524 7:139524024-139524046 CCCGCAGAGGCTGAGGCCCGCGG + Exonic
1035028647 7:155843629-155843651 CCTGCAGGGCCTGGTGTCCGCGG + Intergenic
1035244822 7:157555100-157555122 CACGCAGAGCCTGGTGTCTGTGG - Intronic
1035266900 7:157693963-157693985 GACGCAGACCCTGCCGTCTGGGG + Intronic
1041044298 8:53877281-53877303 CCCGCCGGCCCTGCCGCCCGTGG + Intronic
1045358105 8:101407015-101407037 CCCTGAGTGCCTGCTGTCCGTGG - Intergenic
1048871983 8:138806746-138806768 CCCACAGCGCCTGCTGTCTGAGG + Intronic
1049173919 8:141179877-141179899 CCCTCAGTCCCTGCCGTCCAGGG - Intronic
1049471711 8:142777645-142777667 CCCGGCGAGCCGGCGGTCCGGGG - Intronic
1049660117 8:143816034-143816056 GCCGCAGAGCCGGCCGTCCAAGG - Intergenic
1055945663 9:81689292-81689314 CCCGCAGAGTTTGCCCGCCGGGG - Exonic
1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG + Exonic
1062213170 9:135375426-135375448 CCCGCAGAGCCTTCGGTGGGAGG + Intergenic
1062494111 9:136823580-136823602 CCTGCAGGGCCGGCCGTTCGTGG + Exonic
1062621916 9:137426657-137426679 CCCACAGAGCCTGCCCTCCTGGG - Intronic
1062627322 9:137449194-137449216 GCCGCAGAGGCTGCAGTCCCTGG - Exonic
1197715448 X:129703011-129703033 CCCTCAGAGCCTGACCTCCTTGG + Intergenic