ID: 1142371947

View in Genome Browser
Species Human (GRCh38)
Location 16:89687320-89687342
Sequence GGCGGTGTTGCCCAGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 178}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142371938_1142371947 13 Left 1142371938 16:89687284-89687306 CCTCTGCAGAGACCAGGAGAGAG 0: 1
1: 0
2: 4
3: 45
4: 451
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178
1142371936_1142371947 17 Left 1142371936 16:89687280-89687302 CCTCCCTCTGCAGAGACCAGGAG 0: 1
1: 0
2: 1
3: 21
4: 304
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178
1142371941_1142371947 1 Left 1142371941 16:89687296-89687318 CCAGGAGAGAGCCTCTGGGCGTT 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178
1142371934_1142371947 23 Left 1142371934 16:89687274-89687296 CCGGTGCCTCCCTCTGCAGAGAC 0: 1
1: 0
2: 2
3: 33
4: 384
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178
1142371945_1142371947 -10 Left 1142371945 16:89687307-89687329 CCTCTGGGCGTTGGGCGGTGTTG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178
1142371937_1142371947 14 Left 1142371937 16:89687283-89687305 CCCTCTGCAGAGACCAGGAGAGA 0: 1
1: 0
2: 2
3: 35
4: 397
Right 1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG 0: 1
1: 0
2: 0
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142371947 Original CRISPR GGCGGTGTTGCCCAGGTGCA CGG Intronic
900242106 1:1622035-1622057 TGCAGTGCTGCCCAGGTGGAGGG + Intronic
900401110 1:2473314-2473336 GCCGGTGCAGCCCAGGTGCGGGG + Intronic
900436450 1:2633391-2633413 GGGGATCTTGCCAAGGTGCAAGG + Intergenic
901415130 1:9111217-9111239 GGCCGCTGTGCCCAGGTGCAAGG - Intronic
902552906 1:17229854-17229876 GGCAGTGGTGCCCAGAGGCAGGG - Intronic
903998800 1:27325579-27325601 GTCGGTGATGCCCGGGTACATGG - Intronic
904493958 1:30876576-30876598 GGCAGTGGTCCCCAGGGGCAGGG + Exonic
905445847 1:38028135-38028157 GGGGGTGCTGCCCAGCTGCCTGG - Intergenic
912520793 1:110243420-110243442 GGCTGAGGTGCCCACGTGCAGGG - Intronic
917465622 1:175273400-175273422 GGGGCTATTGCCCAGGTGCCAGG - Intergenic
919762820 1:201108925-201108947 GGCTGTGTTGCCAAGGTGATGGG - Intronic
920011917 1:202874128-202874150 GTAGGTGATGCCCAGGTACACGG - Intergenic
922618355 1:226976445-226976467 TGCGATGTTGCCCGGGTGCGGGG + Intronic
923403564 1:233638664-233638686 GGCCATATTGCACAGGTGCAGGG + Intronic
924708933 1:246518766-246518788 GGGTGTGTGGCTCAGGTGCAGGG - Intergenic
1067277031 10:44845135-44845157 GGTGGTGATGACCAGGAGCAAGG - Intergenic
1070685148 10:78475067-78475089 AGCTGTGTTGCCCATGTGCTTGG - Intergenic
1071442777 10:85717994-85718016 GGCGGAGTTGCCCAAGACCATGG - Intronic
1073990902 10:109261383-109261405 GGCGGAGTTGCCCAAGGCCATGG - Intergenic
1074390143 10:113050265-113050287 GTCTGTGTTGCTCAGGTGCTGGG + Intronic
1075050304 10:119178575-119178597 GGCGGTTCTGCGCAGGCGCATGG + Intronic
1076406693 10:130216938-130216960 GGCGGTGATGCGCAGGTGCTGGG + Intergenic
1077177521 11:1197460-1197482 GACGGTGTGGCCCACCTGCAAGG - Intronic
1077281272 11:1747334-1747356 GGCGGGGTTGCTCAGGCTCAGGG - Intronic
1080359272 11:31493911-31493933 GGCGGAGTTGCCCAAGGCCATGG - Intronic
1080959804 11:37145477-37145499 GGCAGAGTTGCCCAGGACCATGG - Intergenic
1081406706 11:42707032-42707054 GGCTCAGGTGCCCAGGTGCAGGG + Intergenic
1083609246 11:63997348-63997370 GGAGGTGGAGCCCATGTGCAAGG + Exonic
1085305365 11:75482702-75482724 GGAGGTGTTCACCAGGTGAAGGG - Intronic
1085715745 11:78871689-78871711 GGCGCTGCTTCCCAGGTGAAGGG + Intronic
1087571026 11:99928157-99928179 GGCGGAGTTGCCCAAGGCCATGG - Intronic
1090207848 11:124895784-124895806 GGCGGTGTGGCTCAGCTGGAAGG - Exonic
1090247779 11:125229052-125229074 GGAGGAGTTGCCCAGGTGAGAGG + Intronic
1094209903 12:27878085-27878107 GGCCTTGTTGCCCAGCTGCTGGG - Intergenic
1095850625 12:46799880-46799902 GGCTGAGTTCCTCAGGTGCAAGG - Intronic
1097367761 12:58738635-58738657 AACGGTGTTGGCCAGGGGCAGGG + Intronic
1100477654 12:94949048-94949070 GCCGCTGCTGCCCAGGTCCAAGG - Intronic
1104609315 12:130215488-130215510 GGGGTCGTAGCCCAGGTGCATGG - Intergenic
1104624409 12:130339447-130339469 GGTGGTGGTTCCCACGTGCACGG + Intronic
1104846242 12:131848571-131848593 GGCGGGGCTGCCCAGGGGCGGGG - Intronic
1105749802 13:23412227-23412249 GGCTCTGTTGCCCAGGCGCGGGG - Intronic
1105810361 13:23990113-23990135 GATGGTGGTGACCAGGTGCAGGG - Intronic
1106181154 13:27370426-27370448 GACGGTGGTGACCAGGGGCAGGG - Intergenic
1108648885 13:52455943-52455965 GGCGGGGCTGCACAGGTTCAGGG + Intronic
1109362938 13:61320147-61320169 GGTAATGTTGCTCAGGTGCATGG + Intergenic
1110511499 13:76356192-76356214 GGTGGTGTTGCCCAAGACCATGG + Intergenic
1113521554 13:110945744-110945766 GGTGGCCTTCCCCAGGTGCAGGG + Intergenic
1118101219 14:62605465-62605487 GGTGGTATTGCCCAAGTACATGG - Intergenic
1119236767 14:73026671-73026693 GGCGGTGGTGTCCGGGTGGAAGG - Intronic
1119855405 14:77896666-77896688 GGCTGCGGTGCCCAGGTGCCAGG + Intronic
1120324770 14:83009974-83009996 GGCAGAGTTGCCCAGGACCATGG + Intergenic
1122104018 14:99437419-99437441 GGCGGAGTAGCCCAGAGGCAGGG - Intronic
1122215979 14:100204805-100204827 GTCAGTGTTCCCCAGGTGGACGG + Intergenic
1123703686 15:22935225-22935247 GGCAGTGTGGCCCTGGAGCAGGG + Intronic
1123939539 15:25210171-25210193 GGCACTGTTTCCCAGGGGCAGGG + Intergenic
1128110127 15:65071087-65071109 GGGGGTGTCTCCCAGGGGCAAGG + Intronic
1129709943 15:77815732-77815754 GGTGGGGTTGTCCAGGTGCTGGG - Intronic
1130012278 15:80161011-80161033 GGCAGTGTACCCCAGGGGCAGGG - Intronic
1132517487 16:372569-372591 GGCACTGCTGCCCAGGTGCTCGG - Intronic
1132654477 16:1036163-1036185 GGCCTTGGTGCCCTGGTGCAGGG - Intergenic
1132798685 16:1740919-1740941 GACGGCGCTGCCCAGCTGCATGG - Intronic
1132903607 16:2271286-2271308 GGAGGTGCTGGCCAGGTCCATGG + Intergenic
1132927161 16:2436813-2436835 GGCGGTGGTTCCCAGCTGGAGGG + Intronic
1135157125 16:20061977-20061999 GGCATTGTAGGCCAGGTGCAGGG + Intronic
1136029784 16:27494647-27494669 CCCGGTGTTGCCCAGATGAATGG - Intronic
1136682817 16:31977902-31977924 TGCCGTGATGCCCGGGTGCAGGG + Intergenic
1136783455 16:32921468-32921490 TGCCGTGATGCCCGGGTGCAGGG + Intergenic
1137639278 16:50014008-50014030 TGGGGCGGTGCCCAGGTGCATGG + Intergenic
1137911135 16:52379709-52379731 GCCACTGTTGGCCAGGTGCATGG + Intergenic
1142208194 16:88793836-88793858 GACGGTGTAGCCCTGCTGCAGGG - Intergenic
1142371673 16:89686294-89686316 GGGGGGGTTCCCCAGGTGAAGGG - Intronic
1142371947 16:89687320-89687342 GGCGGTGTTGCCCAGGTGCACGG + Intronic
1203086105 16_KI270728v1_random:1185452-1185474 TGCCGTGATGCCCGGGTGCAGGG + Intergenic
1143375336 17:6463829-6463851 CACGGTGTTGCCCAGGGGCATGG - Exonic
1144891404 17:18496349-18496371 GGCCGTGTTGCTGAGATGCACGG + Intergenic
1145140817 17:20447968-20447990 GGCCGTGTTGCTGAGATGCACGG - Intergenic
1145795057 17:27650691-27650713 GGCTGTGTTGCTGAGATGCACGG + Intergenic
1146791016 17:35750501-35750523 GGCGGAATTGCTCAGGTGCTGGG + Intronic
1149751533 17:59150232-59150254 TGCTGTGTTGCCCAGCTGGAGGG - Intronic
1151404520 17:73877962-73877984 GGCAATGTTGCCCATGTGCCAGG - Intergenic
1151481524 17:74372514-74372536 GGCTGTGATGCCAAAGTGCAGGG - Exonic
1151655218 17:75492694-75492716 GGCGATGTTGCACAGGTGGTCGG - Exonic
1151720073 17:75850021-75850043 GGCAGTGTTGCCTAAGTGAAGGG + Intronic
1153948538 18:10037879-10037901 GGTGGTTTTGCCCAAGAGCAGGG + Intergenic
1158300665 18:56048343-56048365 GGAGGATTTGGCCAGGTGCAGGG - Intergenic
1159008782 18:63038965-63038987 GGCTGTGTTGGGCAGATGCATGG - Intergenic
1160190462 18:76710680-76710702 GGAGGTGGTGCCAAGCTGCAGGG + Intergenic
1160408324 18:78658345-78658367 GTCAGTGTTGACCAGGTGCTGGG - Intergenic
1161429998 19:4226007-4226029 GGGGGAGTTGCCAAGGGGCAGGG - Intergenic
1165900332 19:39166707-39166729 GCTGGGCTTGCCCAGGTGCAGGG - Intronic
1166300440 19:41909485-41909507 GGTGGTGTTGGGGAGGTGCAGGG + Intronic
1166730603 19:45057177-45057199 GCTGCTGTTGCCCTGGTGCACGG + Intronic
1167101937 19:47409071-47409093 AGCCCTGCTGCCCAGGTGCAGGG - Intronic
927963837 2:27257238-27257260 GCTGGTGTTCCCCAGGGGCAGGG + Exonic
928179964 2:29062128-29062150 GGAGGGGTTGCCAAGGTGCTGGG - Exonic
929757310 2:44778513-44778535 GAGGCTGCTGCCCAGGTGCAAGG + Intergenic
931567693 2:63632151-63632173 GGCGGTGCTGTGCTGGTGCAAGG - Intronic
931629142 2:64283850-64283872 GGGGAAGTTGCACAGGTGCAGGG - Intergenic
933350333 2:81145534-81145556 GGCGGAGTTGCCCAAGACCATGG - Intergenic
936539088 2:113335614-113335636 GGAGGTGTTGTCCACGTGCATGG + Intergenic
937093568 2:119222482-119222504 AGAGGTGTTGCCCTGGGGCAAGG + Intergenic
938200132 2:129366100-129366122 TGCGGTGATTCGCAGGTGCATGG + Intergenic
944902718 2:204231861-204231883 GGAGTTGCTGCCCAGCTGCAGGG - Intergenic
946758020 2:222965873-222965895 GCAGGTTTGGCCCAGGTGCAGGG - Intergenic
948220503 2:236265761-236265783 GGCTGTGTTGGGCAGGTGGAAGG - Intergenic
1169676285 20:8158872-8158894 GGCGGAGTTGCCCAAGGCCATGG - Intronic
1170657866 20:18306456-18306478 GGAGGCGTTGCTCAGGTGCTGGG + Intronic
1172165528 20:32896745-32896767 GGCGGTGTCGGCCAGGACCAGGG - Intronic
1172380092 20:34482588-34482610 GGCAGTGTTGCCCAAGGCCATGG - Intronic
1173333838 20:42097512-42097534 TGCTGTGTTGGCCAGGAGCAGGG - Intronic
1173903724 20:46610549-46610571 GGCGGTGTTGCTCAGCCACATGG + Exonic
1174296661 20:49550150-49550172 GGGGATGCTGCCCAGGTCCAGGG + Exonic
1175074087 20:56359073-56359095 GGCGGTGGCGCCCAGGAGCCAGG - Exonic
1175806121 20:61830252-61830274 TGCCGTGCTGCGCAGGTGCAGGG - Intronic
1175947499 20:62565646-62565668 GGCAGTGACGCCCATGTGCAGGG + Intronic
1177017984 21:15815515-15815537 GGCGGAGCTGCCCAGGACCATGG + Intronic
1177910019 21:27019444-27019466 GGAGCTGGTGCCCAGGTGGAGGG - Intergenic
1179678131 21:42998774-42998796 GGCGGAGATGCCCAGGACCATGG - Intronic
1181388713 22:22563739-22563761 GGCTGTGTAGTCCTGGTGCAAGG + Exonic
1181441831 22:22940535-22940557 GGCAGTTTTGCCCAGGAGCAGGG + Intergenic
1181679545 22:24484003-24484025 GGCTGTGCTGCCCAGATGCATGG + Intergenic
1183100279 22:35579525-35579547 TGAGGTGTTGCCCATGTGCCAGG + Intergenic
1183581192 22:38727620-38727642 AGCGGTGTTGCTAAGGTGCTGGG + Intronic
1184412654 22:44333716-44333738 GGCAGTGTTGCCCAGTGGGAAGG + Intergenic
1185292040 22:50032085-50032107 GGCGTTGTTGCACAGGTGGATGG + Exonic
949355857 3:3179763-3179785 GGCGCTGTGGCCCCGGTGCGCGG - Intergenic
950592745 3:13950478-13950500 GGCGCTATTGCCCAGGTGCCAGG + Intronic
950792740 3:15486447-15486469 GGCTGTGTTGCCCAAATGCAGGG - Intronic
951590124 3:24255604-24255626 GTAGGAGTTGCCCAGGTGGAAGG + Intronic
954460692 3:50625322-50625344 GGCTGGGTTCCCCAGGTGCAGGG - Intronic
954613907 3:51959876-51959898 GGAGGTGCTGCCCTGGGGCAGGG - Exonic
954644851 3:52124941-52124963 GGTGGGGTTGCCCAGATCCAGGG - Intronic
961503989 3:127358115-127358137 GGGGCTGGTGCCCAGGTGGATGG - Intergenic
961825326 3:129596328-129596350 GGCGGTGGTTCCCAGGCGCCAGG - Intronic
963519231 3:146344745-146344767 GGCAGTTTTCCCTAGGTGCATGG + Intergenic
968928030 4:3560215-3560237 CTTGGTGTTGGCCAGGTGCATGG + Intergenic
971501675 4:27325183-27325205 GGCTATGGTGCCCATGTGCATGG - Intergenic
976098214 4:81531938-81531960 GGAGGTGATGCTCAGGTGTAAGG + Intronic
976743382 4:88379230-88379252 GGCGCGGGGGCCCAGGTGCAGGG + Intronic
978430348 4:108626725-108626747 GATGGTGTTGGCCGGGTGCAAGG - Intronic
984150634 4:176125896-176125918 GGCTGGGATGCCCAGGAGCATGG + Intronic
986008991 5:3695140-3695162 GGCAGTATAGCCCAGGTGCATGG - Intergenic
986311478 5:6554111-6554133 GTGGGTCTTGCCCAGCTGCAAGG - Intergenic
987283128 5:16430280-16430302 GGCTATGGTGCCCAGTTGCATGG + Intergenic
989004654 5:36796908-36796930 AGCTGTGTTTCCCAGGTGCTAGG - Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999141931 5:149368077-149368099 GCTGCTGTTGTCCAGGTGCAGGG - Exonic
999456751 5:151723275-151723297 GGGGGAGATGCCCTGGTGCAGGG - Intergenic
1000042860 5:157498136-157498158 GGAGGAGTGGCCCAGGAGCAGGG - Intronic
1000305063 5:159987287-159987309 GGCGGGGGCGCCCAGGTGCGCGG + Intergenic
1001826731 5:174751377-174751399 GGCGCTGGTTCCCAGGCGCACGG + Intergenic
1007909613 6:45500644-45500666 GGCGCTGTTGCCAGGGTGAATGG + Intronic
1010294776 6:74183020-74183042 TGCGGTGGTGCCCAGGTGTTGGG - Intergenic
1011930960 6:92712140-92712162 GGCTGTGTTGCCCAGGCTCTTGG - Intergenic
1015526640 6:134180582-134180604 GACTGTGGTGGCCAGGTGCAGGG + Intronic
1018900493 6:168049611-168049633 GGGGGTGCTGTCCAGGTTCAAGG - Intergenic
1019178482 6:170173140-170173162 GGCGCTACTGCGCAGGTGCACGG + Intergenic
1021455261 7:20823208-20823230 GGCACTGTTGCCCATATGCATGG + Intergenic
1022688361 7:32618660-32618682 GGGGGTGGTGCCGAGGTGGATGG - Intergenic
1023745653 7:43320162-43320184 GGTGGTGATGCCCAGGTGGGAGG + Intronic
1025663181 7:63567880-63567902 GACGGTGTTGCACAAGTGCCTGG - Intergenic
1028873403 7:95793501-95793523 GGTGATGTTGCTCAGCTGCAAGG + Intronic
1030986142 7:116244515-116244537 GGCGGAGTTGCCCAAGGCCATGG - Intronic
1032915413 7:136483825-136483847 GGCGGCGTTGCACACATGCAGGG + Intergenic
1034978273 7:155460294-155460316 GGCGGTGCTGCCCAGCTCCCGGG - Intronic
1036688007 8:10924573-10924595 GGCCGTGGTCCCCAGGTGGAGGG + Intronic
1039895129 8:41711815-41711837 TGCTGTGTTGCCCAGGGCCATGG + Intronic
1042040733 8:64586090-64586112 GGAGGGGTTGCCCAGCTGCGGGG - Intergenic
1043350568 8:79355579-79355601 GGCAGTTTTGCCCAGGAGCAGGG - Intergenic
1049229582 8:141475033-141475055 GGCTGTGTTGCCCTGGTCCCGGG + Intergenic
1049572716 8:143377215-143377237 GGGGGTGGTGCACAGGTGCAAGG + Intronic
1049609904 8:143550096-143550118 GGGGGTGTTGGGCAGGCGCAGGG - Intergenic
1050424784 9:5501946-5501968 GGCGGTGTTGCCCATGAGATAGG + Intergenic
1053146133 9:35713263-35713285 GGTGCTGTTGCCCAGGTCCTGGG + Exonic
1053802887 9:41775296-41775318 CTTGGTGTTGACCAGGTGCATGG + Intergenic
1054142359 9:61539774-61539796 CTTGGTGTTGACCAGGTGCATGG - Intergenic
1054191192 9:61986642-61986664 CTTGGTGTTGACCAGGTGCATGG + Intergenic
1054462101 9:65470924-65470946 CTTGGTGTTGACCAGGTGCATGG - Intergenic
1054647177 9:67601075-67601097 CTTGGTGTTGACCAGGTGCATGG - Intergenic
1055002884 9:71473496-71473518 AGGGGTTTTGCCCAGGGGCAAGG - Intergenic
1055956297 9:81776654-81776676 GGATGTGCTGCCCAGCTGCAGGG - Intergenic
1056295765 9:85191540-85191562 GGCAGTGTTGCCCAGAGGAAGGG + Intergenic
1057598937 9:96440387-96440409 GGAGTTGTTGCCCAGGTTGAGGG + Intergenic
1057732553 9:97622666-97622688 GGCGGAGTTGCCCAGTATCATGG + Intronic
1058668067 9:107338353-107338375 GGCGGTGCTGCCCAGCTGAGTGG - Intergenic
1060546746 9:124466334-124466356 GGCGGTGGAGTCCAGGTACAGGG - Exonic
1060662743 9:125414019-125414041 GGGGCTGTTGCCCATGTGCAGGG + Intergenic
1061164803 9:128916142-128916164 CACGTTGTTGCCCAGGTGCAGGG - Exonic
1061989720 9:134152411-134152433 GGGGGTGCTGCCGAGGTGGATGG + Intronic
1062197939 9:135284964-135284986 GCCGGGGCTGCCCTGGTGCAAGG - Intergenic
1062529679 9:136994378-136994400 GGCGGGGTGCCCCAGGTGGATGG - Intergenic
1189915048 X:45848596-45848618 GGCTTTGTTACCCAGGTGGAGGG - Intergenic
1193845662 X:86466921-86466943 GGTTTTGTTGCCCAGGTCCAGGG - Intronic