ID: 1142374027

View in Genome Browser
Species Human (GRCh38)
Location 16:89697677-89697699
Sequence GAGAGGAAGGAGAAGGCGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2859
Summary {0: 1, 1: 1, 2: 29, 3: 303, 4: 2525}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142374017_1142374027 12 Left 1142374017 16:89697642-89697664 CCAGGTCCCCAGGCCTACTCAGC 0: 1
1: 1
2: 4
3: 25
4: 270
Right 1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG 0: 1
1: 1
2: 29
3: 303
4: 2525
1142374021_1142374027 4 Left 1142374021 16:89697650-89697672 CCAGGCCTACTCAGCTCACGGCG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG 0: 1
1: 1
2: 29
3: 303
4: 2525
1142374020_1142374027 5 Left 1142374020 16:89697649-89697671 CCCAGGCCTACTCAGCTCACGGC 0: 1
1: 0
2: 1
3: 14
4: 120
Right 1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG 0: 1
1: 1
2: 29
3: 303
4: 2525
1142374018_1142374027 6 Left 1142374018 16:89697648-89697670 CCCCAGGCCTACTCAGCTCACGG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG 0: 1
1: 1
2: 29
3: 303
4: 2525
1142374022_1142374027 -1 Left 1142374022 16:89697655-89697677 CCTACTCAGCTCACGGCGCAGAG 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG 0: 1
1: 1
2: 29
3: 303
4: 2525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142374027 Original CRISPR GAGAGGAAGGAGAAGGCGGA AGG Exonic
Too many off-targets to display for this crispr