ID: 1142374126

View in Genome Browser
Species Human (GRCh38)
Location 16:89698015-89698037
Sequence ACGTGGCCTCCTGTGTGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142374126_1142374134 17 Left 1142374126 16:89698015-89698037 CCAGGCCACACAGGAGGCCACGT 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1142374134 16:89698055-89698077 GCCTGCAGCAGCTCCTCAGCTGG 0: 1
1: 1
2: 3
3: 46
4: 402
1142374126_1142374136 28 Left 1142374126 16:89698015-89698037 CCAGGCCACACAGGAGGCCACGT 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1142374136 16:89698066-89698088 CTCCTCAGCTGGCAGCACACTGG 0: 1
1: 0
2: 1
3: 22
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142374126 Original CRISPR ACGTGGCCTCCTGTGTGGCC TGG (reversed) Exonic
900634880 1:3658070-3658092 TGGTGGCCTCCAGTGAGGCCTGG + Intronic
900830286 1:4960564-4960586 ACGCGGCCTCCTGAGTTCCCAGG - Intergenic
901322359 1:8347652-8347674 ACGTGGCCTCGTGTGTAGTGAGG - Intergenic
902611817 1:17602299-17602321 ATGTGGGCTCCTGTGAGCCCAGG + Intronic
903031563 1:20467523-20467545 ACATGGCCTCCTCTGTGACCAGG - Intergenic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
904513757 1:31036712-31036734 ACGTGTCCTCATGTATAGCCAGG - Intronic
905647274 1:39633271-39633293 ACGGGGCCTTCTGGGAGGCCAGG - Intronic
905653020 1:39669017-39669039 ACATGGCCACCTCTGCGGCCAGG - Intronic
908358210 1:63342905-63342927 ACTTGGCCTCCTGAGTAGCTAGG + Intergenic
909137685 1:71821948-71821970 ACCTGACCTCCTATGTGACCTGG - Intronic
909164772 1:72205825-72205847 ACTTGGCCTCCTGAGTAGCCAGG - Intronic
909712311 1:78665972-78665994 TCATGTCCTGCTGTGTGGCCTGG + Intergenic
912837354 1:113008340-113008362 ACCTGGGCTCTTCTGTGGCCTGG - Intergenic
913205987 1:116539305-116539327 CCTTGGCCTGCTGTGTGACCTGG + Intronic
914203387 1:145505942-145505964 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
914482509 1:148079096-148079118 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
915165878 1:153947468-153947490 ATGTGCCCTCCTGTCTGTCCAGG - Intergenic
916746101 1:167685999-167686021 ACGAGGCCTCCTGTGCGCTCTGG - Intronic
918640703 1:186837901-186837923 ACATTGCCTCCTTTGTGGCAGGG + Intronic
919759589 1:201089159-201089181 GACTGGCCTCCTGTGTGGACTGG + Intronic
920243824 1:204573280-204573302 CCATGCCCTCCTCTGTGGCCTGG + Intergenic
920833186 1:209483580-209483602 AGGAGGCTTCCTGTGTGCCCAGG - Intergenic
922178687 1:223216696-223216718 CCTAGGCCTGCTGTGTGGCCAGG + Intergenic
923824697 1:237487605-237487627 CCGTAGCCTCCTGAGTGGCTGGG - Intronic
924299744 1:242625354-242625376 TCGTGGCCTCCTGAGTAGCTGGG + Intergenic
924471724 1:244348823-244348845 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
1062801986 10:387665-387687 AGGGGGACTCCTGTGTGGACAGG + Intronic
1063368208 10:5504216-5504238 ACTTTGCTCCCTGTGTGGCCTGG + Intergenic
1065312699 10:24431583-24431605 ATGTGACCTCCCGTGTGGCTGGG + Intronic
1067551189 10:47237645-47237667 AGGTGGGCTCCAGTATGGCCTGG - Intergenic
1068269141 10:54697023-54697045 CCTTGGCCTCCTGTGTAGCTGGG + Intronic
1069722430 10:70558229-70558251 ATGTGGCCTCCTCGGTGGACAGG + Intronic
1069812191 10:71170256-71170278 ATGTGGGCTCCTGAGGGGCCAGG - Intergenic
1069933924 10:71902097-71902119 CCGTGGCCTCCTGAGTAGCTGGG - Intergenic
1073454411 10:103628026-103628048 ACGGGGCCTCCAGTGCTGCCCGG - Intronic
1074765102 10:116694736-116694758 ACGTGGCCTCCTGGGCCACCAGG + Intronic
1075258314 10:120942863-120942885 TGGTGACCTGCTGTGTGGCCTGG + Intergenic
1076229463 10:128808062-128808084 ACGTGGCCTCGGGTGGAGCCTGG - Intergenic
1076630649 10:131850001-131850023 AAGTGGCCTCCGGGGTGCCCAGG - Intergenic
1076815002 10:132910274-132910296 ACCTGGCCTCCAGTGCGCCCCGG + Intronic
1077140676 11:1023578-1023600 AGTTGGCCTCCTGTGTGTACTGG + Exonic
1077325442 11:1961999-1962021 AGGTGGGCTCCCGAGTGGCCTGG + Intronic
1077551111 11:3200716-3200738 ACGTTGCCTCCTCTGTGACTTGG - Intergenic
1077579322 11:3406722-3406744 TCGTGGCCTCCAGTGTGTGCTGG - Intergenic
1079369124 11:19835243-19835265 TAGTGGCCTCAGGTGTGGCCTGG - Intronic
1081649774 11:44816035-44816057 TCGTGCCTTCCTGTGTGACCTGG + Intronic
1081661044 11:44888612-44888634 AGGTTGCCTGGTGTGTGGCCAGG + Intronic
1081755861 11:45543978-45544000 ACTTGGCCTCGTGTCTGGCTTGG - Intergenic
1081921286 11:46779733-46779755 CCTTGGCCTCCTGTGTAGCTGGG + Intronic
1083000878 11:59289501-59289523 GCGTAGGCTCCTGTGTGGCTGGG - Intergenic
1083704032 11:64500893-64500915 TCGTCTCCTGCTGTGTGGCCTGG + Intergenic
1083841250 11:65305556-65305578 CCTTGGCCTCCTGCGTGGCTGGG - Intronic
1084392137 11:68884368-68884390 CCGTAGCCTCCTGAGTGGCTGGG + Intergenic
1084427870 11:69095436-69095458 ACGTGTCCGCCAGTGTGGCCGGG - Intergenic
1084476690 11:69393516-69393538 ACCGGGCCTCCTGTGTGTCCCGG + Intergenic
1085025433 11:73233733-73233755 CCTTGGCCTCCTGAGTGGCTAGG + Intronic
1085040826 11:73325309-73325331 AGGTCGCTTCCTGTGTGGCCAGG + Intronic
1085179801 11:74524111-74524133 CCTTGGCCTCCTGAGTGGCTAGG - Intronic
1086436415 11:86785497-86785519 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
1088197146 11:107287203-107287225 CCTTGGCCTCCTGAGTAGCCAGG + Intergenic
1088891975 11:114051757-114051779 ATGGGGCATCCTGTGTGGACAGG - Intergenic
1090463043 11:126909102-126909124 AGTTGGCCCCCTGTGTCGCCTGG - Intronic
1090884772 11:130866036-130866058 AGATGGCCTCCTGTGTGTGCAGG + Intergenic
1202808423 11_KI270721v1_random:17178-17200 AGGTGGGCTCCCGAGTGGCCTGG + Intergenic
1091694490 12:2618593-2618615 ATGTGGCCACCTGAGGGGCCAGG + Intronic
1092261175 12:6954001-6954023 ACGTGGTTTCCTGTGGGGCTGGG + Intronic
1092407257 12:8229672-8229694 TCGTGGCCTCCAGTGTGTGCTGG - Intergenic
1092524618 12:9302120-9302142 TGGTGGCTTCCTGTGTGTCCAGG + Intergenic
1092542647 12:9429692-9429714 TGGTGGCTTCCTGTGTGTCCAGG - Intergenic
1092991106 12:13900357-13900379 CCTTGGCCTCCTGTGTAGCTGGG - Intronic
1094480148 12:30875090-30875112 GCCTGGCCTCCTGTGGGCCCTGG + Intergenic
1094510365 12:31092738-31092760 TGGTGGCTTCCTGTGTGTCCAGG + Intronic
1096775351 12:53960388-53960410 CCGTGACCTCCTCTTTGGCCGGG - Intergenic
1097985167 12:65775431-65775453 CCTTGGCCTCCTGAGTAGCCGGG + Intergenic
1100734593 12:97512856-97512878 CCGTGGGCTCCTGTGCAGCCCGG - Intergenic
1101716901 12:107319695-107319717 TCGTGGCCTCCGGGGTGCCCCGG + Exonic
1102371070 12:112382496-112382518 ACGAGGCCACCCGGGTGGCCTGG + Intergenic
1102691231 12:114762667-114762689 CTGGGGCCTGCTGTGTGGCCGGG + Intergenic
1103416562 12:120745613-120745635 CCTTGGCCTCCTGTGTAGCTAGG - Intergenic
1103613679 12:122139099-122139121 GCCTGGCCTGCTGTGTGGGCTGG + Intronic
1103736876 12:123066230-123066252 ACTTGGCCTCCTTCCTGGCCAGG - Intronic
1103979580 12:124727688-124727710 ACCCGGCCTACTGTGTGCCCTGG - Intergenic
1104311355 12:127656721-127656743 ACCTAGCCCCCTGTGGGGCCTGG + Intergenic
1104753048 12:131251974-131251996 ACCTGGCCTCCTATGTGGAGAGG + Intergenic
1105491602 13:20893638-20893660 ACTTGGCCTCCTGTGTTCCTGGG - Intronic
1105815750 13:24034726-24034748 ACGTGGCTGCTTGTATGGCCTGG + Intronic
1107636057 13:42393797-42393819 ACGTGGCTTCCTCTGTGGCAGGG - Intergenic
1108621358 13:52187532-52187554 ATGTGGCTTTCTTTGTGGCCTGG - Intergenic
1108665283 13:52624013-52624035 ATGTGGCTTTCTTTGTGGCCTGG + Intergenic
1112431933 13:99357934-99357956 ACCTGGCCTCCTGTACGACCTGG - Intronic
1112530451 13:100197321-100197343 CCCTGGCCTCCTGTGTAGCTGGG + Intronic
1112597080 13:100817080-100817102 CCTTGGCCTCCTGTGTAGCTGGG + Intergenic
1113848880 13:113406970-113406992 ACGTGGCCTCCTGGGCCCCCAGG - Intergenic
1114680030 14:24476659-24476681 CCTTGGCCTCCTGTGTAGCTAGG + Intergenic
1115431605 14:33325528-33325550 CCTTGGCCTCCTGTGTAGCTGGG - Intronic
1117775336 14:59178376-59178398 ATGTGGGGTCCTGTGTGGTCAGG + Intergenic
1118272690 14:64358561-64358583 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
1119480350 14:74954685-74954707 CCGTGGGCTCCTGGGTGGGCTGG - Intronic
1119679792 14:76584012-76584034 CCCTGCCCTCATGTGTGGCCTGG - Intergenic
1121011372 14:90522159-90522181 CTGTGGCCTCCAGTGGGGCCAGG + Intergenic
1121011736 14:90523911-90523933 ACGTGGCCTCCTTTGTTTCCAGG - Intergenic
1121316230 14:92962547-92962569 ACGTGCTCTCCTGCCTGGCCTGG - Intronic
1121534520 14:94682032-94682054 CCTTGGCCTCCCCTGTGGCCGGG - Intergenic
1122196156 14:100087497-100087519 ACCTGGCCTCCTGAGTAGCTGGG - Intronic
1122413710 14:101538647-101538669 ACCTGACCTGCTGTGTGACCTGG - Intergenic
1122499907 14:102190475-102190497 CCGTGGCCTCCTGAGTAGCTGGG - Intronic
1122742775 14:103881599-103881621 CCCTGGCCCTCTGTGTGGCCTGG - Intergenic
1122960514 14:105091863-105091885 TCCTGGCCTCCCCTGTGGCCTGG - Intergenic
1127273450 15:57421798-57421820 TCGTGTGCTCCTGTGTGGACAGG + Intronic
1131407269 15:92175607-92175629 TCATCTCCTCCTGTGTGGCCTGG - Intergenic
1132041068 15:98524998-98525020 CTGTGGCCTCTTGGGTGGCCAGG - Intergenic
1132591538 16:728349-728371 ATGTGGCCGGCGGTGTGGCCGGG - Exonic
1132665396 16:1079153-1079175 ACGCGGCGTTCTGCGTGGCCAGG - Exonic
1132774051 16:1582030-1582052 ACGCGGCCTCCTGTGTGGGCAGG + Intronic
1132803715 16:1766260-1766282 CTGTGGCCTCCTCTGTGGACTGG - Exonic
1132833633 16:1941931-1941953 TCCTGGGCTCCTGTGTGGCCTGG - Intronic
1132845224 16:1998116-1998138 ACTTGGCCTCTTGGTTGGCCAGG - Exonic
1133054844 16:3140748-3140770 ACGTCGCTGCCTGTCTGGCCTGG - Exonic
1133207901 16:4244907-4244929 CCTTGGCCTCCTGAGTAGCCGGG + Intergenic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1135466784 16:22693506-22693528 AAGTGGCCTCCTGAGTAGCTGGG + Intergenic
1137669195 16:50269500-50269522 ACGAGGCCTTCTGCGTGGCTGGG + Intronic
1139268685 16:65662611-65662633 CCGAGGCCTCCTGAGTCGCCTGG - Intergenic
1139562594 16:67753123-67753145 ACTTAGCCTCCTGTGTAGCTGGG - Intronic
1139947777 16:70653260-70653282 TCGTGGCCTCCTGAGTAGCTGGG - Intronic
1140638563 16:76945182-76945204 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
1141792499 16:86246132-86246154 GTGTGGCCTCTTGTGTGGCCTGG + Intergenic
1141881761 16:86864925-86864947 ACGTTGGCTCCTGAGTGGCCTGG + Intergenic
1141887384 16:86901874-86901896 ATGTGGTCTCCCGTGTGCCCAGG - Intergenic
1142374126 16:89698015-89698037 ACGTGGCCTCCTGTGTGGCCTGG - Exonic
1143575825 17:7792538-7792560 CCCTGCCCTCCTGTGGGGCCTGG - Intronic
1143746832 17:9001211-9001233 CCGTCGCCTCCTGTGTAGCTGGG - Intergenic
1145273489 17:21416872-21416894 AAGTGGCCTCCTGGGGGGCCAGG + Exonic
1145311680 17:21704316-21704338 AAGTGGCCTCCTGGGGGGCCAGG + Exonic
1149082992 17:52680267-52680289 CCTTGGCCTCCTGAGTGGCTGGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1152500165 17:80702786-80702808 CCGTGGCCTTCTGTGTGGCGTGG + Intronic
1152770461 17:82165069-82165091 CCTTGGCCTCCTGTGTAGCTGGG - Intronic
1152781890 17:82230432-82230454 ACATGGCTTTCTGGGTGGCCTGG - Intronic
1153392424 18:4577898-4577920 TCATGGCTTCCTGGGTGGCCAGG + Intergenic
1154279941 18:12993596-12993618 CCGTGGCCTCCTGAGTAGCTGGG + Intronic
1155266823 18:24102660-24102682 ATGTGGCCTTCAGTGAGGCCTGG + Intronic
1157549986 18:48574849-48574871 AGGTGACTTCCTGTGTGACCTGG + Intronic
1158716195 18:59881799-59881821 AGGTGGCCTCCTTTGATGCCTGG - Intergenic
1160506733 18:79431499-79431521 ACTCAGCCTCCTGTGTGGCTGGG + Intronic
1160741001 19:685797-685819 AGGTGTCCGCCTTTGTGGCCTGG - Exonic
1160793381 19:933136-933158 ACTTGGCCTCCTCTGTCCCCTGG + Intronic
1161299672 19:3536740-3536762 ACGTGGATTCATGTGTGGCCGGG + Intronic
1161952192 19:7473865-7473887 CCTTGGCCTCCTGTGTAGCTGGG - Intergenic
1162766455 19:12922750-12922772 ACGCAGCCTCCTGTGTGGGAGGG + Exonic
1163114547 19:15181079-15181101 CAGTGGGCTCCTGTGTAGCCGGG + Exonic
1163638529 19:18449140-18449162 AGGTGGTTTCCTGTCTGGCCTGG - Intronic
1165880621 19:39040231-39040253 CCTTGGCCTCCTGAGTGGCTGGG + Intergenic
1166030229 19:40119445-40119467 ACTTGGCCTCCTGCGTAGCTGGG - Intergenic
1166089654 19:40500091-40500113 CCTTGGCCTCCTGTGTAGCTGGG - Intronic
1166535166 19:43569026-43569048 ACTTGGCCTCCTGAGTAGCTAGG - Intronic
1167512123 19:49900940-49900962 ACGAGGCCCCCAGTGGGGCCAGG - Intronic
1167605885 19:50481092-50481114 TCCGGGCCTCCTGTGTGTCCTGG + Intronic
1168380445 19:55916029-55916051 TCTTGGTCTCCTGTGGGGCCAGG - Intronic
924977029 2:187188-187210 GTGGGGGCTCCTGTGTGGCCAGG + Intergenic
926474731 2:13308385-13308407 CCGTGGGCTCCTGCGCGGCCCGG - Intergenic
926571675 2:14536183-14536205 ACGTGCCTTCCTGTGAGACCAGG + Intergenic
930686288 2:54312068-54312090 ACCTGGCCTCCTGGGTAGCTGGG - Intergenic
931580406 2:63765581-63765603 ACTAGGCCTTTTGTGTGGCCAGG + Intronic
933084396 2:78037621-78037643 CCTTGGCCTCCTGAGTGGCTGGG - Intergenic
934522832 2:95030657-95030679 ACCCTGCCTCCTTTGTGGCCTGG - Intronic
935954940 2:108366517-108366539 ACGGGGCCTTCTCTGTGTCCTGG - Intergenic
936078477 2:109416788-109416810 ACTTAGCCTCCTGAGTAGCCGGG - Intronic
938017255 2:127877449-127877471 ACTTGGCCTCCTGAGTGGCTGGG + Intronic
938073390 2:128319695-128319717 ACGTTGGCTCGTGTGTGGGCCGG + Intergenic
941893389 2:170605560-170605582 AAGTGGCATCATGTTTGGCCGGG + Intronic
941905497 2:170714375-170714397 CCCGGGCCTCCTGGGTGGCCTGG + Exonic
942126480 2:172830717-172830739 CCTTAGCCTCCTGTGTAGCCAGG + Intronic
944558608 2:200912609-200912631 ACAGGGTCTCCTGTGTTGCCAGG + Intronic
946233508 2:218307608-218307630 GCCTGTCCTGCTGTGTGGCCTGG + Intronic
946238916 2:218342042-218342064 AGATGGCCTTGTGTGTGGCCAGG - Exonic
947844931 2:233236307-233236329 ACGGGAACTCCTGTGTGTCCTGG - Intronic
948195678 2:236094202-236094224 ACGTGGCCTTCTGAGTAGCTGGG - Intronic
948764229 2:240211356-240211378 ACGAGGGCACCTCTGTGGCCTGG - Intergenic
948780060 2:240314240-240314262 CCTTGGCCTCCTGAGTGGCTGGG - Intergenic
948927454 2:241108474-241108496 ACATGGCCTGCTGGCTGGCCTGG - Intronic
1168819026 20:761229-761251 ACGAGGCCACCTGCGGGGCCGGG + Exonic
1170163757 20:13342478-13342500 AGGTGGCCTCCTGTGTCCCGAGG - Intergenic
1170368937 20:15627421-15627443 ACTTGGTCTCCTGTATGGCATGG - Intronic
1171110963 20:22482214-22482236 TCCTGGCCTCCTGTGGGGGCTGG - Intergenic
1172106158 20:32518429-32518451 CTGTGGGCTTCTGTGTGGCCAGG - Intronic
1172608581 20:36232262-36232284 ACATGGCCTCCTGGGTGGAGAGG - Exonic
1173341682 20:42157906-42157928 ACATGGCCTCTTCAGTGGCCTGG - Intronic
1173604119 20:44317832-44317854 CCTTGGCCTCCTGAGTAGCCAGG - Intergenic
1173951670 20:46998294-46998316 ACGTGGTCTTCAGTGTAGCCCGG - Intronic
1173976536 20:47190939-47190961 AAGTGGGTTCCTGTGTGGCAAGG - Intergenic
1174043741 20:47718391-47718413 AGGAGGACTCCTGTGTGGCTGGG + Intronic
1174144743 20:48444100-48444122 CCTTGGCCTCCTGAGTAGCCGGG - Intergenic
1175105458 20:56611592-56611614 TCCTGCCCTCCTCTGTGGCCTGG + Intergenic
1175120826 20:56715108-56715130 ACGGGGCCTGCTCTCTGGCCGGG + Intergenic
1175147919 20:56910773-56910795 GCCTTGCCTCCTGTGTGCCCTGG - Intergenic
1175399448 20:58692512-58692534 GCCTGGCCTCCAGTGGGGCCTGG - Intronic
1176019032 20:62953252-62953274 ACCTGGCCTCCTGACTGTCCTGG - Intronic
1176065105 20:63190400-63190422 ACGTCCCCTCCTGTCTGGGCTGG + Intergenic
1179904746 21:44416707-44416729 AGCTGGCCTCCCGTGTGGCGTGG + Intronic
1180098752 21:45574518-45574540 CGATGGCCTCCTGTGGGGCCAGG - Intergenic
1180123629 21:45770788-45770810 ATGTGGCACCCTGTGTGGCTGGG + Intronic
1180797350 22:18612512-18612534 TGGTGGCCACCTGTGTGGCTTGG + Intergenic
1180876566 22:19177780-19177802 GCGTGGGCTGCTGTGCGGCCTGG - Exonic
1180936032 22:19625878-19625900 GCCTGGCCTCCTCTGTGGCCAGG - Intergenic
1181224372 22:21382770-21382792 TGGTGGCCACCTGTGTGGCTTGG - Intergenic
1181254260 22:21552053-21552075 TGGTGGCCACCTGTGTGGCTTGG + Intronic
1183160349 22:36109220-36109242 TCGTGTCCTCCTGTGCAGCCTGG + Intergenic
1183295791 22:37028771-37028793 AAGTGCCCTACTGGGTGGCCTGG - Intronic
1183324759 22:37185193-37185215 GAGTGCCCTCCTGTGGGGCCTGG - Intronic
1185161637 22:49233547-49233569 AGGTGGCCTCTGATGTGGCCTGG + Intergenic
1185205313 22:49534579-49534601 ACGGGGACTCCTGTGGGGACAGG - Intronic
1185347369 22:50316521-50316543 CCGTGGGCTCCTGAGTGGCGAGG - Intronic
949259016 3:2083916-2083938 CCGTGGGCTCCTGTGCGGCCCGG + Intergenic
949459271 3:4272957-4272979 CCTTGGCCTCCTGTGTAGCCAGG - Intronic
952485562 3:33806259-33806281 ACATGTACTCCTGTGTGTCCAGG + Intronic
952855750 3:37769527-37769549 ACATGCCCTCCTCTGTGTCCAGG + Intronic
955329479 3:58035084-58035106 ACGTGGCTTCCTGTGTCACTAGG + Intronic
958041683 3:88233850-88233872 CCTTGGCCTCCTGAGTGGCTGGG + Intergenic
959941807 3:112087935-112087957 ACTCGGCCTTCTGTGAGGCCTGG + Intronic
961302552 3:125931507-125931529 TCGTGGCCTCCAGTGTGTGCTGG + Intronic
961455162 3:127020433-127020455 ATGGGGCAGCCTGTGTGGCCTGG + Intronic
961885919 3:130096273-130096295 TCGTGGCCTCCAGTGTGTGCTGG - Intronic
966892952 3:184420821-184420843 CCTTGGCCTCCTGAGTGGCTGGG + Intronic
968181553 3:196599108-196599130 CCGTGGGCTCCTGTGCGGCCCGG - Intergenic
968752634 4:2398180-2398202 ATGCGGCCTCCTGTGGAGCCAGG - Intronic
969672660 4:8598298-8598320 ACCTGGGCTGCTCTGTGGCCAGG - Intronic
969758881 4:9168372-9168394 TCGTGGCCTCCAGTGTGTGCTGG + Intergenic
971254539 4:25002222-25002244 ACGTGGCCCCATGTGGGTCCTGG + Exonic
972526532 4:39918061-39918083 CCGTGGCCTCCTGAGTAGCTGGG - Intronic
973653419 4:53020651-53020673 ACGTGGGCTACTGTGTACCCAGG - Intronic
976223561 4:82777737-82777759 ATGGGGCTTCCTGTGGGGCCAGG + Intronic
977750924 4:100608836-100608858 CCATGGGCTCCTGTGCGGCCGGG - Intronic
980561237 4:134479179-134479201 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
980966987 4:139531470-139531492 ACCTGGCCTCGTGAGTAGCCAGG - Intronic
982203845 4:152982425-152982447 GGGAGGCCACCTGTGTGGCCAGG + Intergenic
984265700 4:177495881-177495903 CCGTGGGCTCCTGTGCAGCCCGG + Intergenic
987476643 5:18399736-18399758 CCATGGGCTCCTGTGCGGCCGGG - Intergenic
989252545 5:39333862-39333884 CCTTGGCCTCCTGAGTTGCCGGG + Intronic
990505388 5:56439098-56439120 CCTTGGCCTCCTGAGTGGCTGGG + Intergenic
993632358 5:90301531-90301553 ACTTGGCTTCCTGAGTGACCTGG + Intergenic
997696704 5:135866649-135866671 TGCTGGCCTCCTGTTTGGCCTGG - Intronic
997939967 5:138148481-138148503 CCTTGGCCTCCTGTGTAGCTAGG + Intronic
1002640880 5:180630149-180630171 AGGCGGCCGCCTGTCTGGCCAGG - Intronic
1003955889 6:11164794-11164816 AAGGGGGCTCCTGAGTGGCCGGG + Intergenic
1004404891 6:15323777-15323799 ACGTGGCCTCCAGAGTAGCTGGG - Intronic
1005088813 6:22034869-22034891 AAATGGCCTCTGGTGTGGCCTGG - Intergenic
1007111392 6:39315143-39315165 AAGTGGGCTCCTATGTGGCTGGG - Exonic
1007693575 6:43718031-43718053 TCGTGGCCACCTGCCTGGCCTGG + Intergenic
1008603526 6:53118465-53118487 AAGTGTCCTCCTATGTTGCCTGG + Intergenic
1009615461 6:65999451-65999473 CCGTGGGCTCCTGTGCAGCCTGG - Intergenic
1012342121 6:98140526-98140548 ACTTAGCCTCCTGAGTAGCCAGG + Intergenic
1015157328 6:130111390-130111412 GCTTGGCCTGCTGTGTGGCAGGG - Intronic
1015520430 6:134125049-134125071 ACATGTCCACCTGGGTGGCCAGG - Intergenic
1017540500 6:155397396-155397418 ACTTGACCTCCTTTTTGGCCAGG + Intronic
1019140789 6:169940953-169940975 ACGTGCCCTCCTGTCTTCCCGGG - Intergenic
1019412945 7:914499-914521 ACGTGTCCTCCTGTCTGGGGCGG - Intronic
1019528417 7:1491780-1491802 CCTTGGCCTCCTGTGTAGCTGGG - Intronic
1019652595 7:2168517-2168539 CCCTGGCCTGCTGTGTGGCCTGG + Intronic
1020282950 7:6659780-6659802 AGGCGCCCTCCTGTGTGGCGTGG + Intergenic
1020319368 7:6928743-6928765 TCGTGGCCTCCAGTGTGTGCTGG - Intergenic
1023758867 7:43445060-43445082 AAGTGGCCCCCGGAGTGGCCAGG - Exonic
1023881590 7:44324424-44324446 CAGGGGCCTCCTGTCTGGCCTGG - Intronic
1024149407 7:46554793-46554815 ACCTGGCCTCCTGTGGTCCCTGG + Intergenic
1024610111 7:51056974-51056996 ACGTGTCCTTCTGAGTAGCCTGG + Intronic
1025155805 7:56605364-56605386 ACCTGGCCAACTGTGAGGCCGGG - Intergenic
1026285215 7:68956971-68956993 CCTTGGCCTCCTGAGTAGCCAGG + Intergenic
1027269230 7:76511055-76511077 ACGGGGACTGCTGTGGGGCCTGG + Intronic
1027269293 7:76511362-76511384 ATGTGGCCTCCTGTGGGGCAGGG + Intronic
1027320006 7:77005257-77005279 ATGTGGCCTCCTGTGGGGCAGGG + Intergenic
1029652589 7:101903636-101903658 ACGTGGCCGGCTCTGTGGCAGGG - Intronic
1030370467 7:108694045-108694067 AAGTGGGCTCCCTTGTGGCCAGG + Intergenic
1034529982 7:151689622-151689644 ACCTGGCCTCCTGGGAGACCTGG - Intronic
1035301807 7:157902178-157902200 ACTGGGCCTCCTGTGAGGCCAGG + Intronic
1035455668 7:159007023-159007045 ACGTGGCCTGCTCAGGGGCCCGG + Intergenic
1035924747 8:3715656-3715678 CCTTGGCCTCCTGAGTAGCCGGG + Intronic
1036558720 8:9883777-9883799 ACGAGGCATCCTGAGTGTCCCGG - Intergenic
1036847625 8:12180589-12180611 TCGTGGCCTCCAGTGTGTGCTGG - Intergenic
1036943745 8:13075014-13075036 ACTTGGCCTCCTGAGTAGCTGGG + Intergenic
1038457447 8:27686564-27686586 ATGGGGCCTCCTGGGGGGCCAGG + Intergenic
1040323987 8:46331979-46332001 CCGTGGGCTCCTGTGAGGCCCGG + Intergenic
1041653948 8:60330213-60330235 ACATGGCCTCCTGCATGGCGTGG - Intergenic
1041724911 8:61009261-61009283 ACGTAGCCTCCTGAGTAGCTGGG + Intergenic
1049387211 8:142349049-142349071 TCTTGGCCTTCTGTGTGGGCGGG - Intronic
1056317083 9:85400455-85400477 TCGTGGCCTCCTGAGTAGCTGGG - Intergenic
1056588351 9:87944155-87944177 ACCTGGCCTCTTGGTTGGCCAGG - Intergenic
1057280449 9:93707580-93707602 ATGTGGCTTTCTGTGTGGCTTGG + Intergenic
1059461034 9:114430234-114430256 ACGTGGCCTTCTATGAGGCTGGG + Intronic
1059496809 9:114716977-114716999 CCTTGGCTTCCTGTGTGGCTTGG + Intergenic
1061674671 9:132208994-132209016 GCGTGGCCGCCTGCGTGGCTCGG + Intronic
1061681064 9:132242621-132242643 ACCGGGCCTCCGGTGAGGCCTGG - Exonic
1062061256 9:134496473-134496495 AAGTGGCCTCCAGGGTGGCAGGG + Intergenic
1062221118 9:135415730-135415752 TCGTGGCCTCCTGTGTGGCTTGG - Intergenic
1062525873 9:136977929-136977951 GCGTGGGCGCGTGTGTGGCCCGG - Intronic
1186509218 X:10117700-10117722 ATGTGGCCTCCTGCGGGGCGAGG + Intronic
1190832445 X:54071295-54071317 TCTCAGCCTCCTGTGTGGCCAGG - Exonic
1192169335 X:68844602-68844624 ACCTGGCCTCCTGTCCTGCCTGG + Intergenic
1198140138 X:133794371-133794393 ACGAGGCCTCCTTTGTGCTCAGG - Intronic
1202203287 Y:22377329-22377351 ACTTGGCCTCCTGAGTAGCTGGG - Intronic