ID: 1142376391

View in Genome Browser
Species Human (GRCh38)
Location 16:89709038-89709060
Sequence TCCCAGCCGTGCACATCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142376391_1142376394 -4 Left 1142376391 16:89709038-89709060 CCTCCTGATGTGCACGGCTGGGA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1142376394 16:89709057-89709079 GGGAAGAGCCACGGTGACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 194
1142376391_1142376398 27 Left 1142376391 16:89709038-89709060 CCTCCTGATGTGCACGGCTGGGA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1142376398 16:89709088-89709110 CTCAGACACCACTTTTGTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142376391 Original CRISPR TCCCAGCCGTGCACATCAGG AGG (reversed) Intronic
900404752 1:2487588-2487610 TCCCAGCAGTCCACTGCAGGCGG - Exonic
900532909 1:3163412-3163434 TCCAAGGCGTGCACAGCCGGAGG + Intronic
900808303 1:4782179-4782201 TCCCAGGCGTGCATGTCAGGGGG - Intronic
901218233 1:7566723-7566745 CCTCATCCCTGCACATCAGGAGG + Intronic
902237404 1:15066342-15066364 TCCCACACGTTCACACCAGGGGG - Intronic
902300055 1:15495256-15495278 TCCCAGGTGAGCACATCAGAAGG - Exonic
902819890 1:18937438-18937460 CCCCAGTGGTTCACATCAGGTGG - Intronic
907239491 1:53073453-53073475 TCCCTCCCGTGCACCCCAGGCGG + Intronic
909238084 1:73178604-73178626 GCCCAGGCGAGCAGATCAGGAGG - Intergenic
911091606 1:94021900-94021922 TCCCAGTCGTCCCCATCACGGGG - Exonic
920940488 1:210477492-210477514 TCCCTGCAGTGGACATCAGGTGG - Intronic
924834673 1:247636515-247636537 TCCCCTCCCTGCAGATCAGGGGG + Intergenic
1063567457 10:7183326-7183348 TACAAGCTGAGCACATCAGGAGG + Intronic
1064009413 10:11723572-11723594 TCCCACACGTGCAAATCATGGGG - Intergenic
1064182399 10:13129583-13129605 TCCCAGCTGGGCAGATCATGAGG - Intronic
1066068959 10:31785394-31785416 TCTCAGCCTAGCACATCAGAAGG - Intergenic
1069705330 10:70456010-70456032 TCCCTGCCTTGGCCATCAGGAGG + Intergenic
1072211281 10:93249062-93249084 TCCCAGCCCTGCGCCTCCGGAGG + Intergenic
1075550138 10:123386618-123386640 TCCCAGGGGTGCACATTTGGTGG + Intergenic
1076223555 10:128754947-128754969 TCACAGCCTTGCAAAACAGGAGG + Intergenic
1076655919 10:132023240-132023262 TCCCAACCGTGGACAGCAGAGGG - Intergenic
1077070176 11:666469-666491 TCCCAGGCGGGCAGATCACGAGG + Intronic
1077149101 11:1060809-1060831 TCCCAGACCTGCACAGAAGGTGG + Intergenic
1089579751 11:119474261-119474283 ACCCAGTCGTGCACATCATAGGG - Intergenic
1097071931 12:56361512-56361534 TCCCAGCCATGGTCATCAGAAGG + Exonic
1101181190 12:102219761-102219783 TCCCTGTTGCGCACATCAGGAGG - Intergenic
1106038292 13:26065574-26065596 GCCCAGGCGGGCAGATCAGGAGG - Intergenic
1108544008 13:51472711-51472733 GCCCAGGCGGGCAGATCAGGAGG - Intergenic
1125862185 15:43009354-43009376 TCCCTGCCCTGCACAGCAGCTGG + Intronic
1126241066 15:46444338-46444360 TCCCAGCCTTGCCCATGGGGTGG + Intergenic
1128624468 15:69185730-69185752 ACCAAGCAGTGCACATCAGCTGG + Intronic
1129826509 15:78638227-78638249 AGCCACCCGGGCACATCAGGTGG - Intronic
1132342038 15:101085048-101085070 TGCCAGCCGTGCTCATTAGAGGG - Intergenic
1133293936 16:4740822-4740844 TCCCAGCAGAGCACATCCTGGGG + Intronic
1136774511 16:32864505-32864527 TGCCAACCTTGCACTTCAGGGGG + Intergenic
1136896101 16:33997009-33997031 TGCCAACCTTGCACTTCAGGGGG - Intergenic
1137603868 16:49774388-49774410 TCCCAGTCCTGCCCACCAGGAGG + Intronic
1142376391 16:89709038-89709060 TCCCAGCCGTGCACATCAGGAGG - Intronic
1203076938 16_KI270728v1_random:1126641-1126663 TGCCAACCTTGCACTTCAGGGGG + Intergenic
1148687786 17:49510275-49510297 TCCCAGCTGTGCATAACAGCTGG + Intronic
1150237007 17:63601250-63601272 TCCCCGCCGGGCACAACAAGTGG + Exonic
1151099161 17:71536012-71536034 TCCCATCCGTGCACACCTTGGGG + Intergenic
1151306827 17:73267892-73267914 TCCCTGCCCTGCACTTCAAGTGG - Intergenic
1151461831 17:74258915-74258937 TCCAGGCCATTCACATCAGGGGG - Intronic
1151946291 17:77321754-77321776 ACCCAGTCGGGCACAGCAGGCGG + Intronic
1152921911 17:83070089-83070111 TCCCAGCCCTGCACACACGGGGG - Intergenic
1156228709 18:35133645-35133667 TCCCAGCCCTGCACTTCAAACGG + Intronic
1158670399 18:59468954-59468976 TCCCAGCCGTGCACTCCTTGAGG - Intronic
1159798243 18:72868263-72868285 TCCCAGCCGCGCGGATCTGGGGG + Intergenic
1160833259 19:1113052-1113074 TCCCAGCTGTGCACGGGAGGTGG + Intronic
1160872417 19:1283312-1283334 TCCCAGCAGTGCAGAGCAGGGGG + Intergenic
1160895255 19:1399427-1399449 TCCCCCCAGTGCACATCAGAGGG + Intronic
1163115281 19:15185313-15185335 TCCCAGCCGTGCAGGGCCGGTGG - Exonic
1163270065 19:16247764-16247786 TGCCAGCCGTGACCACCAGGGGG + Intergenic
1163426184 19:17242366-17242388 ACCCAGCCCTGCCCCTCAGGTGG + Intronic
1163833682 19:19560418-19560440 TCTAAGCCGTGCACAGCAGTGGG + Intergenic
1165073472 19:33268598-33268620 GCCCAGCTGTGCCCACCAGGAGG - Intergenic
1166704764 19:44902685-44902707 CCCCAGCAGTGCTCAGCAGGAGG - Intronic
1167423235 19:49415809-49415831 TCCCTGCCTGGCACAGCAGGTGG + Intronic
1167498114 19:49830922-49830944 TCCTAGCTGTGGACAGCAGGAGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928551538 2:32375949-32375971 GCCCAGGCGGGCAGATCAGGAGG + Intronic
933727045 2:85433056-85433078 TCCCTGCCGTGCATGACAGGTGG + Intronic
933888224 2:86740051-86740073 ACCAGGCCGTGCACAGCAGGAGG + Intronic
933921954 2:87056655-87056677 ACCAGGCCGTGCACAGCAGGAGG - Intergenic
935939180 2:108220812-108220834 TCCCAGCTGTGCGGGTCAGGAGG + Intergenic
942732312 2:179073954-179073976 TCCCAGCCATTCACATCATAAGG - Intergenic
942974285 2:181996315-181996337 TCCCAGCTGTGACAATCAGGGGG + Intronic
1169921502 20:10739294-10739316 TCCTAGGTGTGCACATCATGAGG - Intergenic
1175183694 20:57165873-57165895 CCCCAGCAGTGCACATGAGAAGG + Intergenic
1176204767 20:63882299-63882321 TGCCAGGCGTGCACCTCAGGGGG + Intronic
1176232549 20:64039544-64039566 TCCCAGACCTGCGCATCAGATGG - Intronic
1180206565 21:46264796-46264818 CCCCAGCCATGCCCATCAGGGGG + Intronic
1184166678 22:42733302-42733324 TCCCAGGCGGGCAGATCACGAGG + Intergenic
950606197 3:14083051-14083073 TCCAAACCGTTAACATCAGGAGG - Intergenic
950645138 3:14372615-14372637 TCCCAGCTGTGCAGATCTGGGGG - Intergenic
953534801 3:43769601-43769623 TCCCAGCTGTGACCAGCAGGGGG + Intergenic
955527076 3:59832072-59832094 TCCCTACAGTGCACATCATGGGG - Intronic
961318767 3:126058095-126058117 GCCCAGCCTTGCACATGAGTGGG + Intronic
961346454 3:126266664-126266686 TCCCAGCCCTTCACATCTGCAGG + Intergenic
967266899 3:187699178-187699200 TCCCAGGGGTGCTCACCAGGAGG - Intronic
968260964 3:197323818-197323840 GCCCAGGCGGGCACATCACGAGG + Intergenic
968571096 4:1341094-1341116 TCCCGCCGGTGGACATCAGGCGG + Intergenic
972579100 4:40379422-40379444 TCCAAGCCCTGCACAGCAGGAGG - Intergenic
973924345 4:55722352-55722374 TCTCAGGCGTGCACAACAGCTGG - Intergenic
982041012 4:151396707-151396729 TCCCAGCACTGCACTTCGGGAGG + Intergenic
982062755 4:151621270-151621292 TCCCAGACCTGCACATCATCTGG - Intronic
990082438 5:51933630-51933652 GCCCAGCCGGGCAAATCACGAGG - Intergenic
992167549 5:74069708-74069730 GCCCAGCCGGGCAGATCACGAGG - Intergenic
992892616 5:81217974-81217996 TCCCAGGCGGGCAGATCACGAGG - Intronic
1012934901 6:105356763-105356785 TCCTAGCTGTGTACAGCAGGAGG + Intronic
1015718781 6:136219154-136219176 TCCCAGCCATGCAGAACAGTGGG - Intergenic
1017767068 6:157615667-157615689 TGCCAGCAGTGCCCATCATGTGG + Intronic
1024185307 7:46942816-46942838 TCCCAACTGTGCAGATCTGGAGG - Intergenic
1025785772 7:64642200-64642222 TCCTAGCTGGGCACAACAGGTGG + Intergenic
1031197689 7:118637750-118637772 TCCAAGGCGGGCAGATCAGGAGG - Intergenic
1038350444 8:26771493-26771515 TTCCTGCCGTGCACATCAACGGG - Intronic
1041401507 8:57450261-57450283 ACCCAGCTGGGCACATCTGGAGG - Intergenic
1049262924 8:141649340-141649362 TCCCTGCCCCACACATCAGGAGG - Intergenic
1057259058 9:93574208-93574230 TCCCAGCCCTGCCCTTCAGATGG - Intergenic
1059780586 9:117522041-117522063 TGCCAGCCCTGCACTACAGGGGG + Intergenic
1061401902 9:130373132-130373154 TCCCAGCCCATCACATCATGTGG - Intronic
1186285369 X:8038091-8038113 TCCAAGCTGTGAACACCAGGAGG + Intergenic
1186346230 X:8696061-8696083 TACCAGCCTTGCACATGAAGAGG - Intronic
1188619118 X:32197522-32197544 GCCCAGCAGTGAACTTCAGGGGG + Intronic
1196792644 X:119478196-119478218 TCCCAGAAGTGAAGATCAGGGGG + Intergenic