ID: 1142376661

View in Genome Browser
Species Human (GRCh38)
Location 16:89710191-89710213
Sequence GATCCAACCCCCTGTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142376655_1142376661 7 Left 1142376655 16:89710161-89710183 CCAAAACTGCAGGAACCAGGGAA No data
Right 1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 137
1142376654_1142376661 8 Left 1142376654 16:89710160-89710182 CCCAAAACTGCAGGAACCAGGGA 0: 1
1: 0
2: 2
3: 16
4: 255
Right 1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 137
1142376650_1142376661 30 Left 1142376650 16:89710138-89710160 CCTTTTCTCAAAAGGGGCTTTAC No data
Right 1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 137
1142376656_1142376661 -8 Left 1142376656 16:89710176-89710198 CCAGGGAAGACTTTAGATCCAAC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142376661 Original CRISPR GATCCAACCCCCTGTGGGTG GGG Intronic
900604526 1:3517924-3517946 CATCAAACCCCCACTGGGTGGGG - Intronic
903223379 1:21881203-21881225 GATGCAGCCCCCTGTGGCAGCGG - Intronic
905370298 1:37479425-37479447 GGTGCAGCCACCTGTGGGTGGGG + Intronic
911146042 1:94553411-94553433 GCTGCAAGCCCCTGTGGGGGTGG + Intergenic
918054011 1:181002857-181002879 GATCCTCCCTCCTGTGGCTGTGG - Intronic
920987895 1:210907725-210907747 GATCCATCCCAGTGGGGGTGGGG + Intronic
922283502 1:224147635-224147657 GACCCAAACCCCTGAGGATGCGG + Intronic
922669017 1:227494908-227494930 GATCCAGCGGCCTGGGGGTGGGG - Intergenic
922670580 1:227506394-227506416 GATCCAGCGGCCTGGGGGTGGGG + Intergenic
922882494 1:228991197-228991219 TATACAACACCCAGTGGGTGTGG - Intergenic
924598189 1:245465295-245465317 CCTCCAGCCGCCTGTGGGTGGGG + Intronic
1063725492 10:8633049-8633071 CAACCAACCCACTGTGTGTGTGG - Intergenic
1066283380 10:33940163-33940185 GATCCAGCCCCATTTGGGAGGGG - Intergenic
1066509942 10:36084269-36084291 GACCCAACGCCCTGCTGGTGTGG + Intergenic
1067343428 10:45421721-45421743 GATCCAGCCCCTTGTGGGGAAGG - Intronic
1069360119 10:67632703-67632725 GACCCAACGCCCTGGTGGTGTGG - Intronic
1070153624 10:73820025-73820047 GCTCCAGGCCCCTGTGAGTGAGG - Intronic
1071205790 10:83275434-83275456 GATACATCCCCCTGTGTTTGAGG + Intergenic
1071451635 10:85797583-85797605 GATTTAGCCCCCAGTGGGTGTGG - Intronic
1077001826 11:327124-327146 GATCGCACCCCCTGTCCGTGGGG - Intronic
1078436188 11:11327748-11327770 GATCCATCCACCTGTAGGTGAGG - Intronic
1083595645 11:63917295-63917317 GATCCCACCCCCTGGAGGTCTGG - Intergenic
1087439295 11:98162011-98162033 GCTCAAACCCCTTGTGGGAGGGG - Intergenic
1091240056 11:134046235-134046257 GATCCATCCCCGGATGGGTGGGG - Intergenic
1092943900 12:13435710-13435732 GATTAAGCCCCCTGTGGCTGAGG - Intergenic
1094173014 12:27514233-27514255 GATTCAGCCCCCTTTGGGAGAGG - Intergenic
1095396854 12:41771711-41771733 GAGCCAGCCACCTGTGGCTGCGG - Intergenic
1099508794 12:83508764-83508786 CATTCAAACCCCTGTGGGAGGGG + Intergenic
1101655668 12:106717858-106717880 GGTCCAACTCCCTGTGTGTCAGG - Intronic
1103480183 12:121245560-121245582 GTTCCAGACCCCTCTGGGTGGGG - Intronic
1104811261 12:131621570-131621592 GCTGGAACCCCCTGGGGGTGTGG - Intergenic
1104979258 12:132566318-132566340 GATCCCATCACCTGGGGGTGAGG + Intronic
1107294437 13:38894632-38894654 GCTCAAACCCCTTGTGGGAGAGG - Intergenic
1107355849 13:39565843-39565865 GTTCCAACCCACTGTACGTGGGG + Intronic
1110061130 13:71039632-71039654 GCTCAAACCCCTTGTGGGAGGGG + Intergenic
1110709999 13:78640229-78640251 GAACCAATCCCCTGTAGATGTGG - Intronic
1113562166 13:111290512-111290534 GAACCAATCCCCTGTGGGTGAGG + Intronic
1117607159 14:57441417-57441439 GATCTTTCCCTCTGTGGGTGGGG + Intergenic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1119423203 14:74520254-74520276 GCTCCAACACCCTGTGTGTAAGG + Intronic
1119687452 14:76644027-76644049 TATGCAACCCTCTGAGGGTGAGG - Intergenic
1120806184 14:88753231-88753253 GCTCAAACCCCTTGTGGGAGTGG - Intronic
1124892733 15:33748017-33748039 GGTGCATCCCACTGTGGGTGGGG - Intronic
1126187172 15:45841641-45841663 GCTCAAACCCCTTGTGGGAGTGG - Intergenic
1130656234 15:85793882-85793904 GACCCAACGAACTGTGGGTGAGG - Intronic
1132897233 16:2234847-2234869 CAGGCAGCCCCCTGTGGGTGGGG - Exonic
1132903914 16:2272459-2272481 GACCCCACCCACTGTGGCTGTGG - Intergenic
1138552751 16:57756431-57756453 GGCCCCACCCTCTGTGGGTGTGG + Exonic
1138729025 16:59174442-59174464 GATCCAACTCCCTGTGAGTATGG - Intergenic
1139531959 16:67546814-67546836 GCTCCAACACCCTCTGGCTGTGG + Intergenic
1140650028 16:77077705-77077727 GTTCAAACCCATTGTGGGTGGGG - Intergenic
1141035812 16:80624394-80624416 GATTCTTCCCCATGTGGGTGTGG - Intronic
1142376661 16:89710191-89710213 GATCCAACCCCCTGTGGGTGGGG + Intronic
1143510182 17:7391108-7391130 AATCCAACCCCCTTAGGGTATGG + Intronic
1143961565 17:10725462-10725484 GATCCAAATCACTGTGGCTGAGG - Intronic
1146647625 17:34585517-34585539 AATCCAACCTCATGTGGATGAGG + Intronic
1146824715 17:36012500-36012522 GTTCAAATCCCCTGTGGGAGGGG - Intergenic
1148851076 17:50555665-50555687 GCCCCAACCCCCTTGGGGTGGGG + Exonic
1149249225 17:54749204-54749226 GCTCTAACCCACTGTGGCTGGGG + Intergenic
1149449542 17:56738940-56738962 GATCCAACCACCTTGGGGAGAGG + Intergenic
1151696257 17:75719497-75719519 TATACACCCCACTGTGGGTGGGG - Intergenic
1151960406 17:77402660-77402682 GCCCCAGCCCCCTGTGGCTGAGG + Exonic
1152930266 17:83105685-83105707 GAGCCACCCGGCTGTGGGTGGGG - Intergenic
1154381231 18:13851907-13851929 GAGCAAACCCCCTTGGGGTGAGG + Intergenic
1161026181 19:2038449-2038471 GCTCCAACCCCCGGGGGCTGCGG - Exonic
1163282669 19:16326660-16326682 CCTCCGACCCCCTGGGGGTGAGG + Intronic
1163850652 19:19661357-19661379 GATCGAGCCCCATGTGCGTGTGG - Intronic
1163878677 19:19898767-19898789 AGTCCAACACCCTGTGGGTCAGG + Intergenic
1164479295 19:28599038-28599060 CATGCTACCCCCTGGGGGTGGGG - Intergenic
1165312888 19:35039568-35039590 GACCCAACCCCCGGGGGATGGGG - Intronic
1165766485 19:38354667-38354689 GATCCAACCACCTGGGTCTGAGG + Intronic
1167012282 19:46816454-46816476 GATCAAACGCCATGTGGGTTGGG + Intergenic
1168121320 19:54254027-54254049 GATCCAACCCCGTGGGGGTGAGG + Exonic
1168124833 19:54277559-54277581 GATCCGACCCAGTGGGGGTGAGG + Exonic
1168177153 19:54633990-54634012 GATCCGACCCGGTGGGGGTGAGG - Exonic
1168254166 19:55156985-55157007 GATCCAAGACCCTGGGAGTGGGG - Intronic
925860971 2:8174669-8174691 GATCCAACCCCCGGTGGGAAAGG - Intergenic
930890040 2:56374083-56374105 GACCCAATCCCCTGTGGGAAAGG - Intronic
936628817 2:114177964-114177986 GATCAAAAACCCTGGGGGTGTGG - Intergenic
939269253 2:139916595-139916617 AATCCTAACCCCTATGGGTGAGG + Intergenic
940658634 2:156519751-156519773 GCTCAAACCCCTTGTGGGTGGGG + Intronic
945267544 2:207905767-207905789 TATCAAACACCCTGTGGGTGGGG - Intronic
945336204 2:208595579-208595601 GTTCAAACTTCCTGTGGGTGGGG + Intronic
947145110 2:227057212-227057234 AATGCAACCCACTGTGTGTGTGG + Intronic
948411883 2:237769756-237769778 GACCCAACCTCCTTTGGCTGTGG + Intronic
1169122752 20:3107201-3107223 GAGCCAAGCCCCTGCGAGTGAGG + Intergenic
1174505812 20:51016829-51016851 GATCCAAATCCCAGTGGGTCAGG - Intronic
1176169671 20:63691127-63691149 GAGCCAGCAGCCTGTGGGTGAGG - Intronic
1178598873 21:33979029-33979051 GATCCAACCGCCTTTGGGGACGG + Intergenic
1179897123 21:44369331-44369353 GATCCATCCCACGGTGAGTGCGG + Exonic
1180156251 21:45978491-45978513 GAGCTCACCCGCTGTGGGTGGGG + Intergenic
1180976737 22:19852788-19852810 GTACCAACCTCCTGTGGGGGAGG - Intronic
1181436818 22:22915947-22915969 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181437659 22:22919873-22919895 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181438307 22:22922928-22922950 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
1181540981 22:23573229-23573251 GCTCCAGGCCCCTTTGGGTGGGG + Exonic
1181550888 22:23638588-23638610 GCTCCAGGCCCCTGTGGGTGGGG + Intergenic
1181574067 22:23782926-23782948 GCTCTAGCCCCCTGTGGTTGTGG - Intronic
1181797398 22:25320101-25320123 GCTCCAGGCCCCTGTGGGTGGGG - Intergenic
951501372 3:23390729-23390751 GCTCAAACCCCTTGTGGGAGAGG - Intronic
953772999 3:45792980-45793002 GATCCAGACGCCTGTGGGGGAGG - Intronic
954397166 3:50298936-50298958 GACCCCACCCACTGTGGGCGGGG + Intronic
959164324 3:102758378-102758400 GCTCAAACCCCTTATGGGTGGGG + Intergenic
962687745 3:137863550-137863572 GCTCAAACCCCTTGTGGGAGGGG - Intergenic
962992841 3:140595224-140595246 GATCCACTCCCAGGTGGGTGAGG + Intergenic
967210297 3:187162376-187162398 GATCCCTCTCCCTGGGGGTGGGG - Intronic
967660473 3:192102579-192102601 GCTCCAACCTTCTGTGGGGGAGG - Intergenic
968972422 4:3803050-3803072 GGCCCAGCCCCCTATGGGTGTGG + Intergenic
971567820 4:28168009-28168031 GCTCTAACCCCCTGTGGCTGAGG + Intergenic
972414088 4:38821622-38821644 GAACCAATCCCCTGTGGATACGG + Intronic
975701346 4:77069779-77069801 GTACCAACCCACTGTGTGTGGGG + Intronic
985138244 4:186811705-186811727 GCTCAAACCCCTTGTGGGAGAGG + Intergenic
985993283 5:3581006-3581028 CATCCAATCCCCTGAGGGTCCGG + Intergenic
988320779 5:29693495-29693517 TATCCAACCCACTGTTGATGAGG + Intergenic
989801951 5:45553541-45553563 GAACCAATACCCTATGGGTGGGG - Intronic
991655854 5:68903080-68903102 GAACCAATCCCCTGTGGATATGG - Intergenic
993004955 5:82419784-82419806 GATTCATCCACCTGTGAGTGGGG + Intergenic
994264637 5:97700324-97700346 GTTCTATCCCCCTGTGGCTGAGG - Intergenic
997318027 5:132954388-132954410 GCTCAAACCCCTTGTGGGAGGGG + Intronic
1006341750 6:33451286-33451308 AATCCAAACCCCTGTGGATTTGG - Intronic
1007429543 6:41768772-41768794 GATCCTACCTCCTCTGAGTGGGG - Intergenic
1012446923 6:99316163-99316185 GGGGCAACCCCTTGTGGGTGGGG - Intronic
1013043656 6:106461794-106461816 GGTTCAACCTGCTGTGGGTGTGG + Intergenic
1017558130 6:155595448-155595470 GATCCCACCCCCTGCTGGTCTGG - Intergenic
1018709226 6:166485878-166485900 GACCTCACCCCCTGAGGGTGGGG - Intronic
1019519587 7:1454690-1454712 GACCCAACCCCGCGTGGGAGAGG + Intronic
1019535960 7:1530081-1530103 GATCACAGCCTCTGTGGGTGGGG - Intergenic
1023875142 7:44282738-44282760 GATCCAGCCACCTGTGGGGGCGG - Intronic
1024924189 7:54595680-54595702 GATCAAAATCCCTGTGGCTGGGG + Intergenic
1026405683 7:70063104-70063126 CATCCATCACACTGTGGGTGGGG - Intronic
1026837339 7:73647710-73647732 GATCCAATTCCCCTTGGGTGAGG + Intergenic
1032319026 7:130867994-130868016 GATGCCACCCACTGTGGGTTGGG - Intergenic
1033564995 7:142569761-142569783 GATCCAAGGCCCTGTTGTTGTGG - Intergenic
1034482800 7:151335744-151335766 GGTCAAAGCCCCTGTGTGTGTGG + Intergenic
1036569553 8:9968093-9968115 GATCCAACCAGCTGTGGTTGAGG + Intergenic
1036923546 8:12881435-12881457 AATCCAAGCGGCTGTGGGTGTGG + Intergenic
1038415893 8:27395678-27395700 GATCCCTCCCTCTCTGGGTGGGG + Intronic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041367661 8:57125769-57125791 GCTCAAACCCCCTATGGGAGGGG - Intergenic
1046696453 8:117345178-117345200 AACCCAAACCCCTGTTGGTGAGG - Intergenic
1051263539 9:15288849-15288871 GCTCAAACCCCTTATGGGTGGGG - Intronic
1053302280 9:36960706-36960728 GTTCCACCCCTCTGTGGTTGAGG + Intronic
1053423723 9:37997548-37997570 GATCCAAGCCCCAGTGGATGTGG - Intronic
1055505076 9:76939783-76939805 TACCCCACCCCATGTGGGTGGGG + Intergenic
1061633632 9:131890746-131890768 GATCCAGCCCTGTGTGGCTGTGG + Intronic
1061863072 9:133477955-133477977 CATCCAGCCAACTGTGGGTGTGG + Intronic
1062526354 9:136979484-136979506 GATCCAACCCCCTGGAGGAAGGG - Intronic
1062587084 9:137254279-137254301 GATCCAACCCCCAGCTGGTTCGG - Intergenic
1185493354 X:536271-536293 CATCCCAGCCCCTGTGGGGGAGG + Intergenic
1188183703 X:27088343-27088365 GCTCAAACCCCTTGTGGGAGAGG + Intergenic
1189302960 X:39966018-39966040 GAGCCAACCCCTTCTGGTTGGGG - Intergenic
1189551371 X:42097072-42097094 GAACCAATCCCCTGTGGATATGG + Intergenic
1194435787 X:93867695-93867717 GATCCAAGACCCTGATGGTGTGG - Intergenic
1197352982 X:125400463-125400485 TATCAGTCCCCCTGTGGGTGAGG + Intergenic