ID: 1142378897

View in Genome Browser
Species Human (GRCh38)
Location 16:89721010-89721032
Sequence GCGCGTACTGCGGGCCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142378887_1142378897 4 Left 1142378887 16:89720983-89721005 CCGCACTTCCGGCGACGGGCCCC 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1142378897 16:89721010-89721032 GCGCGTACTGCGGGCCCCACGGG 0: 1
1: 0
2: 0
3: 4
4: 33
1142378888_1142378897 -4 Left 1142378888 16:89720991-89721013 CCGGCGACGGGCCCCCTCCGCGC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1142378897 16:89721010-89721032 GCGCGTACTGCGGGCCCCACGGG 0: 1
1: 0
2: 0
3: 4
4: 33
1142378883_1142378897 22 Left 1142378883 16:89720965-89720987 CCGCAGGAAGGGACGCGGCCGCA 0: 1
1: 0
2: 0
3: 19
4: 87
Right 1142378897 16:89721010-89721032 GCGCGTACTGCGGGCCCCACGGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142378897 Original CRISPR GCGCGTACTGCGGGCCCCAC GGG Intronic
921029929 1:211327638-211327660 GCTCTTGCTGCGGGTCCCACTGG + Intronic
1077138032 11:1011312-1011334 GAGCGTCCTGCCGGCCCCGCAGG + Exonic
1091132359 11:133157195-133157217 CGGTGTACTGCGGGCACCACGGG + Intronic
1113416009 13:110129290-110129312 GCGAGCACCGCTGGCCCCACCGG + Intergenic
1117546712 14:56798824-56798846 GCCCGTACTGCCGCCGCCACAGG - Intergenic
1122301176 14:100731972-100731994 GAGCGTGATGCGGGCCCCAGTGG - Intronic
1125811892 15:42548887-42548909 GCGCGGACGCCGGGTCCCACGGG - Exonic
1125825763 15:42674902-42674924 GACTGTACAGCGGGCCCCACGGG - Exonic
1129997137 15:80016613-80016635 GAGCGGCCTGCGGGCCCCACTGG + Intergenic
1135752281 16:25066962-25066984 GCGCGGGCTGGGGGCCCCAACGG - Intergenic
1142378897 16:89721010-89721032 GCGCGTACTGCGGGCCCCACGGG + Intronic
1143058028 17:4176944-4176966 GCACGTCCTGAGCGCCCCACTGG - Intronic
1146182930 17:30709049-30709071 GCGCGTCCTGCGGTGCCCACGGG + Intergenic
1146720455 17:35119899-35119921 GCGCCATCTGCGGGCCGCACGGG + Intronic
1152107140 17:78337261-78337283 GAGCCTACTGCGGGCACAACCGG + Intergenic
1152782071 17:82231078-82231100 GCGCCTACTGCGGGCAATACGGG + Intronic
1160911253 19:1474803-1474825 GCGTGACCTGAGGGCCCCACTGG - Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161511682 19:4675643-4675665 GAGGGTCATGCGGGCCCCACAGG - Exonic
1162491462 19:10995044-10995066 GCTGGTACTGCGGGCTCCAGGGG + Intronic
1162975880 19:14206756-14206778 GCGCGTCCTGCGGTGCCCACGGG - Intergenic
1165808503 19:38596480-38596502 GCACCTGCTGCGGGCCGCACAGG + Exonic
1166802700 19:45468208-45468230 ACGCGTCCGGCGGGTCCCACGGG - Exonic
933847580 2:86337809-86337831 GCGCGTCCTGCGCGCTCCCCGGG + Intronic
938170181 2:129069228-129069250 ACAGGTACTGGGGGCCCCACTGG + Intergenic
1172502015 20:35434262-35434284 GCGAAAACGGCGGGCCCCACTGG - Exonic
1185322807 22:50209681-50209703 GGGTGCACTGAGGGCCCCACCGG - Intronic
959566753 3:107840097-107840119 GCCCGTGCTGCAGGCCACACAGG - Intergenic
960939067 3:122921943-122921965 CGGCGTCCTGCGGGTCCCACTGG - Exonic
971244184 4:24913235-24913257 GCGCGGGAGGCGGGCCCCACGGG + Intronic
985616564 5:926573-926595 GCGCGGACGGCGGCCCCCGCAGG - Intergenic
1005526790 6:26659414-26659436 GCGCGGCCTGCGGGGCCCAGGGG - Intronic
1019515957 7:1440297-1440319 GCGTGAGCTCCGGGCCCCACGGG + Intronic
1033220456 7:139523828-139523850 GCGCGCCCTGCGGGCCCCCCAGG - Intergenic
1044734792 8:95268732-95268754 GCGCGGACTGCGGGCTCTGCGGG + Intronic
1049644020 8:143728065-143728087 GCGTGAGCTGCGGGTCCCACTGG + Exonic
1060825086 9:126683208-126683230 GCGCGCTCTGCGGGCCTCGCGGG - Intronic
1062334874 9:136060677-136060699 GAGCGTCCTGCAGCCCCCACTGG - Intronic