ID: 1142379230

View in Genome Browser
Species Human (GRCh38)
Location 16:89722098-89722120
Sequence CACCGCGGGCAGGTCGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142379225_1142379230 -4 Left 1142379225 16:89722079-89722101 CCGGCGTGAGGAGCGCTGTCACC 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379217_1142379230 23 Left 1142379217 16:89722052-89722074 CCGGCCGCGGGCTCGGCCAGAAG 0: 1
1: 0
2: 4
3: 11
4: 72
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379220_1142379230 19 Left 1142379220 16:89722056-89722078 CCGCGGGCTCGGCCAGAAGGGAC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379224_1142379230 -3 Left 1142379224 16:89722078-89722100 CCCGGCGTGAGGAGCGCTGTCAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379216_1142379230 24 Left 1142379216 16:89722051-89722073 CCCGGCCGCGGGCTCGGCCAGAA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379215_1142379230 25 Left 1142379215 16:89722050-89722072 CCCCGGCCGCGGGCTCGGCCAGA 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379214_1142379230 28 Left 1142379214 16:89722047-89722069 CCTCCCCGGCCGCGGGCTCGGCC 0: 1
1: 0
2: 6
3: 70
4: 487
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1142379223_1142379230 7 Left 1142379223 16:89722068-89722090 CCAGAAGGGACCCGGCGTGAGGA 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142379230 Original CRISPR CACCGCGGGCAGGTCGCCCT GGG Intronic
900371620 1:2334685-2334707 CTCCGCGGCCAGGTCGTCCTGGG + Intronic
900477569 1:2883071-2883093 CAGCGGGGGCAGGACGCGCTCGG - Intergenic
901490853 1:9595545-9595567 CACCAGGAGCAGGTGGCCCTGGG + Intronic
901764355 1:11490499-11490521 CAACGCGGGCAGATCACCCGAGG - Intronic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
905972922 1:42154765-42154787 CACGGCGGGCAGGAGGCTCTGGG - Exonic
906477047 1:46176312-46176334 CACTGCTGGCAGTTCGACCTCGG + Exonic
913131032 1:115838647-115838669 CACAGCGGGCCTGTGGCCCTGGG + Exonic
921797745 1:219367045-219367067 CACCGCAGGCAAGTAGTCCTGGG - Intergenic
1062971594 10:1653119-1653141 CTCCGTGGGAAGGTGGCCCTTGG - Intronic
1064230998 10:13529092-13529114 CTCCGCCAGCAGGTGGCCCTGGG - Intergenic
1065624758 10:27619200-27619222 CACCCAGTGCTGGTCGCCCTTGG + Intergenic
1073444273 10:103571426-103571448 CACCGCAGGGAGGCTGCCCTTGG + Intronic
1081611295 11:44565133-44565155 CATCTCGGGCGGGTAGCCCTGGG - Intronic
1084199364 11:67545156-67545178 CACAGCGGGCAGGTGGGCCAAGG - Intergenic
1101041257 12:100758188-100758210 GACCGCGGGCAGGTGACTCTGGG - Intronic
1103506010 12:121442741-121442763 CGCCTCGGGCAGTTCGTCCTCGG + Exonic
1103621810 12:122191548-122191570 CACCTCGGCCAGGACGCCCGCGG - Exonic
1113737447 13:112689199-112689221 TACCCCGGCCAGGTCACCCTAGG + Intergenic
1113764086 13:112870021-112870043 CACCACGGCCAGGTGTCCCTGGG + Intronic
1117092218 14:52262645-52262667 GACTGGGGGCAGGTTGCCCTGGG - Intergenic
1122125664 14:99577175-99577197 CACCGTGGGCAGGGCTGCCTGGG - Intronic
1123030900 14:105450583-105450605 CAGCGAGGGGAGGTCCCCCTGGG + Intronic
1132841321 16:1979699-1979721 CACCGCGGGCAGGGCGGGCCAGG - Exonic
1136529783 16:30860277-30860299 CACCGCGGGGATGTCTGCCTTGG + Intronic
1139504694 16:67393070-67393092 CAGCGCGGTCAGGTGGCGCTGGG + Intronic
1142379230 16:89722098-89722120 CACCGCGGGCAGGTCGCCCTGGG + Intronic
1147886739 17:43689331-43689353 CACCCCGGGGAGGTTTCCCTTGG + Intergenic
1152395856 17:80032794-80032816 CACCGGGGGCGGGTGGCTCTGGG - Intronic
1161574062 19:5046185-5046207 CACCTGTGGCAGGTCGGCCTGGG - Intronic
1165686790 19:37828882-37828904 CAAGGCGGGCAGGTCACCCGAGG - Intergenic
1167567867 19:50268097-50268119 CACCCAGTGCAGGTTGCCCTGGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
929501206 2:42493352-42493374 CACCTCGAGCACGTCGCGCTCGG + Exonic
931882432 2:66581625-66581647 CCCCGCGGGCTGGGGGCCCTGGG + Intergenic
936038528 2:109130546-109130568 CACCGCAGGCAGGAGGCCCGCGG - Intronic
946248298 2:218399299-218399321 GACCGGGGGCACCTCGCCCTGGG + Intronic
948868060 2:240785274-240785296 CACTGTGGGCAGGTGGCCATGGG - Intronic
1169609968 20:7367582-7367604 CAACCCTGGCAGGACGCCCTTGG + Intergenic
1172109338 20:32536284-32536306 CCCCGCGGGCGGGTCCCTCTCGG + Intronic
1173802043 20:45899939-45899961 CACCTCTGGCAGGTAGGCCTGGG - Intronic
1175424067 20:58853364-58853386 CACCGGGGGCAGCTGCCCCTGGG - Exonic
1175985280 20:62761341-62761363 CACCGCTGGCCGGCAGCCCTGGG + Exonic
1184680760 22:46071245-46071267 CCCCGCGGGCACGCCGCCCCGGG - Intronic
952825206 3:37519015-37519037 CAAGGCGGGCAGGTCGCCTGAGG - Intronic
961010114 3:123429945-123429967 CAGCGGGGGCAGCTCGGCCTGGG + Intronic
965055081 3:163700827-163700849 CACCACGGGCAAGACTCCCTGGG + Intergenic
972475567 4:39446549-39446571 CACCGCGGACAGGTTGCCAGTGG - Exonic
995391528 5:111645494-111645516 CACTGTGGTCAGGTAGCCCTGGG + Intergenic
998403519 5:141860881-141860903 CACGGCGGGCAGATCGCCTGAGG + Intronic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1023221250 7:37921398-37921420 CCCCGCCAGCAGGCCGCCCTCGG - Intronic
1025255833 7:57383418-57383440 CACCGCGGTCAGGACCCCCTGGG - Intergenic
1037666284 8:20972891-20972913 GACTGCGGGCAGGTAGCCCGAGG + Intergenic
1041107617 8:54458185-54458207 CACCGCGGGCAGCGCGCTCTGGG - Exonic
1049465973 8:142751495-142751517 CACCTCGGGCAGGAAGCCTTGGG + Intronic
1049641739 8:143719057-143719079 CCCCTCGGGGAGGTCGCCCAGGG - Exonic
1057222817 9:93267027-93267049 CACAGTGGGCATGTGGCCCTGGG - Intronic
1057550715 9:96049464-96049486 CTCCCTGGGCAGGGCGCCCTGGG + Intergenic
1061621545 9:131814247-131814269 CCCTGCGGGCAGGTCGGCCAGGG - Intergenic
1062428933 9:136518379-136518401 CACGGCGGGCAGCTCCTCCTGGG - Intronic
1062685618 9:137811531-137811553 CACGGCGTGGAGGTCGCACTTGG - Exonic