ID: 1142379696

View in Genome Browser
Species Human (GRCh38)
Location 16:89724254-89724276
Sequence ATGTTGTTTTAGGAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142379686_1142379696 18 Left 1142379686 16:89724213-89724235 CCAGAACCCATAGCACTGTGGGC 0: 1
1: 0
2: 0
3: 20
4: 148
Right 1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 248
1142379682_1142379696 20 Left 1142379682 16:89724211-89724233 CCCCAGAACCCATAGCACTGTGG 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 248
1142379684_1142379696 19 Left 1142379684 16:89724212-89724234 CCCAGAACCCATAGCACTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
Right 1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 248
1142379689_1142379696 11 Left 1142379689 16:89724220-89724242 CCATAGCACTGTGGGCTGGTGCA 0: 1
1: 0
2: 0
3: 16
4: 181
Right 1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 248
1142379688_1142379696 12 Left 1142379688 16:89724219-89724241 CCCATAGCACTGTGGGCTGGTGC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG 0: 1
1: 0
2: 0
3: 16
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142379696 Original CRISPR ATGTTGTTTTAGGAGGGCCA GGG Intronic
902087860 1:13877022-13877044 ATGTTGTTTTTGTAGAGACAGGG + Intergenic
902519758 1:17009564-17009586 ATTTTTTTTTAGTAGGGACAGGG + Intronic
902968861 1:20032137-20032159 TTGTTGTTTTAAAAGGGCAATGG + Intronic
904074243 1:27827951-27827973 ATTTTGCTTTATGAGGGCCTAGG + Intergenic
904094842 1:27968515-27968537 TTGCTGTTCTAGGAGGTCCATGG + Intergenic
905300187 1:36981660-36981682 ATGTTCCTCCAGGAGGGCCAGGG + Intronic
905508357 1:38498751-38498773 ATTTTAATTAAGGAGGGCCAGGG - Intergenic
905645109 1:39619817-39619839 TTGTTGCTTTAGGATGGCCAAGG - Intergenic
906184799 1:43853686-43853708 ATTTTGTTTTAGGAAGGCTGGGG + Intronic
906969058 1:50491149-50491171 AGGTTTTTTTTGGAGAGCCAGGG - Intronic
907390729 1:54156514-54156536 ATGTGGTTTTAGGGTGGGCAGGG - Intronic
907572929 1:55500519-55500541 ATTTTGTTTTAGTAGAGACAAGG - Intergenic
908623880 1:66018125-66018147 ATGTGGTTTTAGGCCGGGCACGG + Intronic
910531540 1:88241785-88241807 ATGTTTTTTTAGTAGAGACAGGG - Intergenic
910688018 1:89938145-89938167 ATGTTGTTTTTGAAGGGCAGGGG + Intergenic
911870755 1:103094983-103095005 TTGTTGGTTTAAGAGAGCCATGG - Intronic
913671272 1:121098573-121098595 ATATTTTCCTAGGAGGGCCAAGG + Intergenic
914661529 1:149793936-149793958 ATATTTTCCTAGGAGGGCCAAGG + Intronic
914823494 1:151123676-151123698 TTGTATTTTTAGTAGGGCCAGGG - Exonic
916338752 1:163704152-163704174 ATCTTGTTATAGGAGGACAAAGG + Intergenic
917783180 1:178422210-178422232 ATTTTGTTTTAGGTTGCCCATGG + Intronic
920958535 1:210642813-210642835 ATGATGTTTTCTGAGGGACAAGG + Intronic
1063068881 10:2638711-2638733 ATGTTGTCTAAGGATGACCATGG - Intergenic
1063565111 10:7166030-7166052 ATGTGTTTTTATGAGGCCCATGG - Intronic
1064371955 10:14759882-14759904 ATGTATTTTTAGTAGAGCCAGGG + Intronic
1064858039 10:19793866-19793888 TTGTTGTTTTAGTAGAGACAGGG - Intergenic
1064912056 10:20413193-20413215 TTGTTTTTTTAGCAGGGACAGGG + Intergenic
1065911670 10:30311972-30311994 TTGTAGTTTTAGTAGGGACAGGG - Exonic
1066418147 10:35240133-35240155 TTACTGTTTTAAGAGGGCCAAGG + Intergenic
1067331528 10:45326230-45326252 ATGTTGTTTTTGGAGGGGAATGG - Intergenic
1068293620 10:55037404-55037426 TTGTAGTTTTAGGAGAGACAGGG + Intronic
1068864270 10:61878500-61878522 ATATTGTTTTAAGAGAGGCAAGG + Intergenic
1069248623 10:66241885-66241907 ATTTTGTTTTAGGAGTGGAATGG - Intronic
1069843828 10:71356952-71356974 CTGTTGTTTTAGTAGAGACAGGG + Intronic
1072344257 10:94488211-94488233 GTATTGTTTTAGTAGGGACAGGG - Intronic
1072475009 10:95751544-95751566 ATTTTGTGTTAGGAGAGACAGGG - Intronic
1073329653 10:102661784-102661806 AGGGTGTCTTAGGAAGGCCATGG - Intergenic
1076265555 10:129107329-129107351 TTGTATTTTTAGTAGGGCCAGGG - Intergenic
1076318184 10:129558046-129558068 ATGTGGTGTTACGGGGGCCAAGG - Intronic
1076466697 10:130687690-130687712 ATGTTTTTCTAGGATGGCCAGGG + Intergenic
1078281690 11:9908702-9908724 TTGTTGTTTTAGAAAGGGCAGGG + Intronic
1080653889 11:34243485-34243507 CTGTTGTTGGAGGAGGGGCAGGG - Intronic
1081599930 11:44485884-44485906 TGGTTGGTTTAGGAAGGCCAGGG - Intergenic
1081691116 11:45079296-45079318 ATGAGGTTTGAGGAGTGCCAGGG - Intergenic
1081777721 11:45687398-45687420 ATGTTGTCTTAGTAGGGACAGGG - Intergenic
1082109246 11:48255966-48255988 ATAGTGTTTCAGGAGGGACATGG + Intergenic
1082615850 11:55357870-55357892 AGGATGTTTTCAGAGGGCCAAGG - Intergenic
1083285708 11:61657404-61657426 TTGTAGTTTTAGGAGAGACAGGG - Intergenic
1083341960 11:61964019-61964041 ATGTTGCAGTAGGAGGGCAAAGG - Exonic
1083704560 11:64505145-64505167 ATCTTGTTCTAGGAGGGACAGGG - Intergenic
1084130502 11:67130315-67130337 ATATTGTTTTAGTAGAGACAGGG + Intronic
1085416088 11:76319897-76319919 TTGTTGTTTTAGTAGAGACAGGG - Intergenic
1085604169 11:77882463-77882485 GTATTGTTTTGGGAGGGACAAGG - Intronic
1085761419 11:79244404-79244426 ATGTGGCATTAGGAGGGACAGGG + Intronic
1086203950 11:84236146-84236168 ATGTTATTTTGGTATGGCCAAGG - Intronic
1090343989 11:126052648-126052670 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1091020039 11:132091215-132091237 ATGTATTTTTAGTAGGGACAGGG - Intronic
1091930403 12:4391207-4391229 TTGTAGTTTTAGTAGGGACAGGG + Intergenic
1092650215 12:10626714-10626736 AAGTTGTTTTAGGCCGGGCACGG + Intronic
1092700750 12:11228245-11228267 TTGTTGTTTTGGAAGGGGCAAGG + Intergenic
1093420389 12:18967961-18967983 AAGTAGCTTTAAGAGGGCCAAGG - Intergenic
1094116291 12:26917947-26917969 CTGTAGTTTTAGTAGGGACAGGG - Intronic
1094578918 12:31715177-31715199 ATGTTGTTTTAGGAGCTAAAGGG - Intronic
1096293647 12:50364378-50364400 ATTTTTTTTTAGGAGAGACAGGG - Intronic
1096367425 12:51040454-51040476 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1096665666 12:53162393-53162415 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1096969752 12:55656178-55656200 TTGTTATTTTAGTAGGGACAGGG + Intergenic
1097008870 12:55938484-55938506 GGGGTGTTTTAGGGGGGCCAGGG - Intronic
1098387230 12:69932345-69932367 ATGTTGTTTTCAGAGAGGCAGGG + Intronic
1102873952 12:116435380-116435402 TTGTAGTTTTAGGAGAGACAGGG + Intergenic
1108615305 13:52127055-52127077 ATTTTTTTTTAGCAGGGACAGGG + Intronic
1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG + Intergenic
1111290549 13:86163141-86163163 ATGTTGTGGTAGAAGAGCCAGGG + Intergenic
1112512911 13:100025856-100025878 ATGATGTGTTCTGAGGGCCAGGG - Intergenic
1112638011 13:101239004-101239026 ATGTTTTTTAAGGAGGGAAATGG - Intronic
1113481314 13:110623828-110623850 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1115546122 14:34466207-34466229 ATGTTGGAGGAGGAGGGCCACGG + Intergenic
1119955240 14:78791140-78791162 ATGTTGTTTTAGGTGTGATAAGG - Intronic
1120519016 14:85504266-85504288 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
1121285656 14:92733636-92733658 ATTTTGTATTAGCAGAGCCAGGG - Intronic
1122705847 14:103620813-103620835 TTGTAGTTTTAGTAGGGACAGGG + Intronic
1124063990 15:26322620-26322642 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1124174222 15:27407097-27407119 TTGTAGTTTTAGTAGGGACAGGG + Intronic
1125662681 15:41406434-41406456 TTGTTGTTTTAGTAGAGACAGGG + Intergenic
1126864199 15:52920000-52920022 ATGCTTTTTTTGCAGGGCCAGGG + Intergenic
1127613494 15:60659809-60659831 ATATTGTTTTAGCAGGGGGATGG - Intronic
1130567079 15:85005528-85005550 ATGTTCTTTTAGGAACACCAGGG - Intronic
1131683029 15:94744031-94744053 TTGGTGTTTTGGGAGGCCCATGG - Intergenic
1134118736 16:11568850-11568872 TTGTATTTTTAGGAGGGACAGGG + Intronic
1134622459 16:15699811-15699833 ATGTTGCTTTAGGAAAACCACGG + Intronic
1135780715 16:25297895-25297917 TTGTATTTTTAGGAGGGACAAGG - Intergenic
1137415711 16:48276902-48276924 ATGATGTTTTAGCTGGCCCAGGG + Intronic
1137765012 16:50971336-50971358 ATGTTGTTTTTAGAAAGCCAGGG - Intergenic
1137945926 16:52733213-52733235 TTGTTTTTTTAGGAGAGACAGGG - Intergenic
1138000086 16:53269194-53269216 ATGTTCTGTTAGGAAGGCTAAGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139079737 16:63501786-63501808 CTGTTGCTTTAGAAGGGCAAAGG + Intergenic
1140080622 16:71743771-71743793 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1142379696 16:89724254-89724276 ATGTTGTTTTAGGAGGGCCAGGG + Intronic
1142636610 17:1261484-1261506 TTGTATTTTTAGGAGGGACAGGG - Intergenic
1143418625 17:6770959-6770981 ATGTTGATTTAGGATCGGCAGGG - Exonic
1143807117 17:9438422-9438444 ATACTGGTTCAGGAGGGCCAAGG - Intronic
1144185507 17:12791567-12791589 ATTGTGTTTCAGGAAGGCCAGGG - Intronic
1145959246 17:28877209-28877231 TTGTTGTTTTAGTAGCGACAGGG + Intergenic
1146598917 17:34195366-34195388 ATGTTGTTGTATCAGAGCCATGG + Intergenic
1147162644 17:38577070-38577092 ATGTTGTTTTAGGAGTGGTGGGG - Intronic
1148608795 17:48950074-48950096 CTGTAGTTTTAGTAGGGACAGGG + Intergenic
1149580824 17:57749304-57749326 ATGTAGTTTTAGTAGAGACAGGG - Intergenic
1149627419 17:58089696-58089718 ATGCTGCTTTGGGAGGGCCAGGG + Exonic
1150489278 17:65563296-65563318 TTGTAGTTTTAGTAGGGACAGGG - Intronic
1151222263 17:72621881-72621903 ATTTTGTTTTAGGCTGGGCATGG - Intergenic
1151418391 17:73981754-73981776 ATGTTGATTTTGGAGTGGCAGGG + Intergenic
1152871978 17:82759496-82759518 ATTTTGTTTTTGCAGGGTCAGGG + Intronic
1153287861 18:3472969-3472991 TTGTAGTTTTAGTAGAGCCAGGG + Intergenic
1153880607 18:9418615-9418637 CAGTTGTACTAGGAGGGCCAGGG + Intergenic
1155080945 18:22409074-22409096 ATGTTGTATTCTGAAGGCCACGG - Intergenic
1157425218 18:47578832-47578854 TTGTTGTTTTAGTAGAGTCAGGG - Intergenic
1157559321 18:48635497-48635519 CTTTTGTTTTAGTAGGGACAAGG + Intronic
1158138793 18:54234588-54234610 ATGTTGTCATTGGAGGGCAAGGG - Intergenic
1162987938 19:14283663-14283685 ATATTTTTTTAGTAGGGACAAGG + Intergenic
1163322037 19:16580543-16580565 ATTTTTTTTTAGTAGGGACAGGG + Intronic
1163540574 19:17907034-17907056 ATGTTTTTTTAGTAGAGACAGGG + Intergenic
1164896896 19:31884726-31884748 ACTTTGTTTTGGGAGGGCTAGGG - Intergenic
1165223474 19:34337258-34337280 AAGTTGGTTTATGAGGGGCAGGG - Intronic
1165239781 19:34456728-34456750 TTGTAGTTTTAGGAGAGACAGGG + Intronic
1166590697 19:43995554-43995576 ATGTATTTTTAGTAGGGACAGGG + Intronic
1167675127 19:50879095-50879117 ATGTTGTTGAAGGAGGGACTAGG + Exonic
927594380 2:24383973-24383995 ATGTGTTTTTAGGAGAGACAGGG + Intergenic
927825868 2:26309963-26309985 ATGTCCTCTGAGGAGGGCCATGG + Exonic
928490625 2:31778923-31778945 TTGCTGTTCTAGAAGGGCCAAGG - Intergenic
928850939 2:35745343-35745365 ATGGTATTTTAGGAGGGCTGGGG + Intergenic
929530648 2:42749638-42749660 TTGTAGTTTTAGGAGAGACAGGG + Intronic
929691321 2:44076329-44076351 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
930808636 2:55518287-55518309 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
931320307 2:61169145-61169167 AAGTTGTTTTAGGCCGGGCACGG - Intergenic
931727878 2:65129233-65129255 AGGTTTTTATAGGAGGGCAATGG + Intronic
933479579 2:82839095-82839117 ATGTTGTTTTAGGAATGTCAAGG + Intergenic
936237905 2:110760643-110760665 AGGTTGGTTTAAGATGGCCATGG + Intronic
937494290 2:122401561-122401583 TTGTTGTTTTAGTAGAGGCAGGG + Intergenic
937892438 2:126948785-126948807 TTGTTGTTTGAGGAGGGCAGTGG + Intergenic
940072956 2:149710072-149710094 ATGTGGATGTAGGAGGGCCAAGG + Intergenic
940715174 2:157214089-157214111 TTGTTGTTTTAGTAGAGACAAGG + Intergenic
941054737 2:160774425-160774447 ATTTTGTTTTAGGAGCACAAAGG - Intergenic
941833653 2:169991870-169991892 ATGTTGTTTTAGGCCAGGCACGG - Intronic
942690189 2:178576805-178576827 CTGGTTTTTCAGGAGGGCCAGGG + Exonic
943112868 2:183627541-183627563 ATGTTGATATAGGAGGGAGAGGG + Intergenic
943378635 2:187115212-187115234 AGTTTCTTATAGGAGGGCCATGG + Intergenic
943632062 2:190264948-190264970 TTGTTGTTTTAGTAGAGACAGGG - Intronic
944219443 2:197287845-197287867 TTGTATTTTTAGGAGGGACAGGG - Intronic
945782013 2:214186934-214186956 ATTTTGTTTTAGTAGAGACAGGG + Intronic
947131279 2:226928043-226928065 ATTTTCTTTTAGGAGTTCCATGG + Intronic
947361976 2:229354947-229354969 ATGTATTTTTAGGAGGTCCCGGG + Intergenic
948019073 2:234715460-234715482 TTGTAGTTTTAGTAGAGCCAGGG - Intergenic
1169435964 20:5590366-5590388 ATATTGTTTTAGTAGAGACAGGG - Intronic
1171934589 20:31261847-31261869 AGGTTGTTTTGGGAGGTCCACGG - Intergenic
1173563591 20:44023254-44023276 TTGTTGTTTTAGTAGAGGCAGGG - Intronic
1173991671 20:47308390-47308412 TTGTATTTTTAGTAGGGCCAGGG + Intronic
1174437777 20:50523273-50523295 ATGTTGTTAGAGGACGTCCAGGG + Intronic
1174498136 20:50964087-50964109 ATTTTGTTTTAGTAGAGACAGGG - Intergenic
1174812736 20:53660930-53660952 TTGTTGTTTTAGGAAGCCCATGG - Intergenic
1174984755 20:55438282-55438304 AAGGTGTTTTAGAAGGGACAAGG + Intergenic
1175558719 20:59897907-59897929 TTGTTGTTTTAGTAGAGACAGGG - Intronic
1177672487 21:24251200-24251222 ATGATGTTTTATGAGAGACATGG + Intergenic
1177914586 21:27073120-27073142 TTGTATTTTTAGTAGGGCCAGGG + Intergenic
1178707197 21:34886115-34886137 AGGCTGTTTTCGGAGAGCCAGGG - Intronic
1179009803 21:37547432-37547454 TTGTTGTTTTCGGAGGGACTTGG + Intergenic
1181820208 22:25469542-25469564 ATTTTGTTTTAGTAGAGGCAGGG + Intergenic
1183956764 22:41385189-41385211 ATTTTGTTTTAGTAGAGACAGGG - Intronic
1184155362 22:42663187-42663209 TTGTAGTTTTAGTAGAGCCAGGG - Intergenic
949191156 3:1250698-1250720 TTTTGGTTTTAGGAGGCCCAAGG - Intronic
950287732 3:11758265-11758287 ATTTTGTTTTTGAAGGGCAATGG + Intergenic
950860931 3:16146676-16146698 ATTTTTTTTTTGGAGGGACAGGG + Intergenic
954230039 3:49209888-49209910 ATATTGTTTTAGTAGAGACAGGG + Intronic
956434499 3:69220677-69220699 ATGTAGTTTTAGTAGAGACAGGG - Intronic
957343532 3:78931534-78931556 ATGTTGTTTTTGGCTGGGCACGG - Intronic
957866094 3:86025227-86025249 TTGTAGTTTTAGTAGAGCCAGGG + Intronic
958047082 3:88298403-88298425 ATGTGGTTTGTGGAGGGCAAAGG + Intergenic
960525979 3:118710127-118710149 ATGTTGTTTCAGAAGTGCCAAGG - Intergenic
962242355 3:133760862-133760884 ATGCTACTTTAGGAGGTCCAGGG + Intronic
962722139 3:138185963-138185985 ATGTGATTTTAGGTGGTCCATGG + Intergenic
963032837 3:140995875-140995897 AGTTTGATTTAGGAGGTCCAAGG + Intergenic
963131689 3:141864276-141864298 AAGTTGTTGTAGGCTGGCCACGG - Intergenic
964591035 3:158361840-158361862 ATCTTGTTTTAGAAGAGCCTTGG - Intronic
965679442 3:171235212-171235234 TTGTAGTTTTAGTAGAGCCAGGG + Intronic
966126860 3:176588192-176588214 ATGTAATTTTAGGACGGGCACGG + Intergenic
966650089 3:182290922-182290944 ATGAGGTCTTAGGAGGGCCCAGG + Intergenic
969105973 4:4807323-4807345 ATGGGGTTTCAGGAGGGCCAGGG + Intergenic
970890371 4:21037306-21037328 AAGTTGTTTTGGGTGAGCCAGGG - Intronic
972654466 4:41051284-41051306 ATGTTGTTTTAGCATGGCCTTGG - Intronic
974160407 4:58131194-58131216 TTGTACTTTTAGGAGGGACAGGG + Intergenic
974578096 4:63755867-63755889 ATGTAGTTTTAGTAGAGACAAGG - Intergenic
974708502 4:65556283-65556305 ATGTTGTTTCATGAGTGTCAGGG + Intronic
975702970 4:77084169-77084191 ATGTTTTTTTAGTAGAGACAGGG + Intergenic
977893059 4:102334220-102334242 ATGCTGTATTAGCAAGGCCACGG - Intronic
980796007 4:137684006-137684028 TTGTATTTTTAGGAGGGACAGGG + Intergenic
982043205 4:151415357-151415379 TTGTATTTTTAGGAGAGCCAGGG + Intronic
983223905 4:165068289-165068311 ATGTTGTTTCAGGCTGGGCACGG - Intergenic
987280344 5:16407472-16407494 ATTTTGTTTTAGTAGAGACAGGG + Intergenic
987745784 5:21969825-21969847 ATGTTCTATTGGGTGGGCCATGG - Intronic
987792611 5:22587318-22587340 ATGGTGTTCTGGGAAGGCCAAGG - Intronic
988315983 5:29628573-29628595 TTGTTGTTTTAGTAGAGACAGGG - Intergenic
988803836 5:34721879-34721901 TTGTAGTTTTAGTAGAGCCAGGG + Intronic
991014716 5:61918464-61918486 ATGTTGTTTGAGGCCGGGCATGG - Intergenic
991140159 5:63231455-63231477 ATGTAATTTTAGGAGGGCTGTGG + Intergenic
991765993 5:69979957-69979979 ATGTTCTGTTGGGTGGGCCATGG - Intergenic
991781329 5:70138205-70138227 ATGTTCTATTGGGTGGGCCATGG + Intergenic
991845228 5:70855028-70855050 ATGTTCTATTGGGTGGGCCATGG - Intergenic
991873774 5:71138519-71138541 ATGTTCTATTGGGTGGGCCATGG + Intergenic
992015010 5:72566844-72566866 GTCTTGTTTTAGCATGGCCATGG - Intergenic
994999408 5:107107949-107107971 ATGATGTTTCAGGAGAGACAGGG - Intergenic
996137004 5:119855168-119855190 TTGTATTTTTAGGAGGGGCAGGG + Intergenic
996860626 5:128061743-128061765 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
997720766 5:136076911-136076933 ATGCTGTCTTCAGAGGGCCAGGG - Intergenic
997764113 5:136482098-136482120 GTTTTGTTTTAGGAGTGACAGGG - Intergenic
998046949 5:138995411-138995433 ATTTTGTTTTAGTAGAGACAGGG + Intronic
999807333 5:155094761-155094783 TTGTTGTTTTAGAAAGGCCTGGG - Intergenic
1000302723 5:159970809-159970831 TTGTTGTTTTTGGAGAGACAGGG + Intronic
1001659064 5:173376868-173376890 ATACTGTTTGAGGAGGACCAAGG + Intergenic
1002585527 5:180244599-180244621 TTGTATTTTTAGTAGGGCCAGGG - Intronic
1004213649 6:13680433-13680455 ATGTTTTTTTATGAGCTCCATGG - Intronic
1006197010 6:32250452-32250474 TTGTATTTTTAGTAGGGCCAGGG + Intergenic
1007660393 6:43481672-43481694 ATGTTGTTTGAAGAAGGCCCTGG + Intronic
1008598751 6:53068096-53068118 ATGTTATTTCAGGGCGGCCAGGG - Intronic
1015065550 6:129021908-129021930 ATGTGGTTTTAAGTAGGCCATGG + Intronic
1016001038 6:139041531-139041553 ATTTTTTTTTAGGAGAGACATGG + Intronic
1019941972 7:4298928-4298950 ATGCTGATTTAGGGGGGCCGGGG - Intergenic
1020567378 7:9815200-9815222 CTTTTGTTTTAGGAGGGCAAAGG - Intergenic
1021018357 7:15564492-15564514 AGGTTGTATTAGTAGGGCCCAGG + Intergenic
1022413366 7:30156650-30156672 TTGTAGTTTTAGGAGAGACAGGG - Intronic
1023123806 7:36935395-36935417 ATTTTTTTTTAGAAGGGACAAGG - Intronic
1024602622 7:50997413-50997435 ATGTTGCTTTAGTCAGGCCATGG - Intergenic
1025165895 7:56712028-56712050 TTGTAGTTTTAGTAGGGACAGGG + Intergenic
1027883904 7:83878006-83878028 ATTCTGTTTTAGAAGGGCTAGGG - Intergenic
1028280571 7:88921585-88921607 ATGTTTTATTAGGTGGTCCATGG - Intronic
1029953613 7:104613708-104613730 ATCTAGTTTGAGCAGGGCCATGG - Intronic
1038482044 8:27908626-27908648 ATGTTGTATTAGGAGGGAAAAGG - Intronic
1038590852 8:28836100-28836122 ATGTTCATTTAGGCTGGCCACGG - Intronic
1042195027 8:66224463-66224485 ATCTGATTTGAGGAGGGCCAAGG - Intergenic
1042401854 8:68358868-68358890 TTGTAGTTTTAGGAGAGGCACGG + Intronic
1043913859 8:85897306-85897328 ATGGTGACTTAGGAGGGCCCAGG - Intergenic
1047948915 8:129911625-129911647 TTGTATTTTTAGGAGGGACAGGG - Intronic
1049656626 8:143801869-143801891 ATGTCGGTATAGGAGGGGCAGGG - Intronic
1049855928 8:144861850-144861872 TTGTTGTTTTAGAAGGGCATTGG + Intergenic
1050255264 9:3786946-3786968 ATGATATTTGAGAAGGGCCAGGG - Intergenic
1051491753 9:17674437-17674459 TTGTTTTTTTAGTAGGGACAGGG + Intronic
1053145990 9:35712469-35712491 ATTTTGTTTTAGTAGAGACAGGG - Intronic
1055532579 9:77200194-77200216 ATATTGTTTTAGGCTGGGCATGG + Intronic
1058354319 9:104064835-104064857 TTGTAGTTTTAGTAGGGACAGGG - Intergenic
1059124221 9:111668159-111668181 ATGTTTTTTTAAGAGGACAAGGG + Intronic
1060161053 9:121364805-121364827 ATGTTGTTTTAAAAGGGTAAAGG - Intronic
1060842922 9:126808854-126808876 ATGTTGCTTTTTGATGGCCATGG + Exonic
1061398647 9:130356713-130356735 ATGTAGTTGTTGGAGGGCTAAGG - Intronic
1061536363 9:131252605-131252627 ATGTTCTTTTAGGAGTGACAAGG - Intergenic
1186497747 X:10025184-10025206 TTGTTTTTTTAGTAGGGACAGGG - Intronic
1188354375 X:29173137-29173159 ATTGTGATTTAGGAGGTCCAAGG + Intronic
1189811204 X:44782171-44782193 TTGTTGTTTTAGTAGAGACAGGG + Intergenic
1190449692 X:50566121-50566143 ATGTTCTACTAGGAGGGCAAAGG + Intergenic
1193172800 X:78356571-78356593 ATTTTGTTTTAGTAGAGACACGG + Intergenic
1194010246 X:88553250-88553272 TGGATGTTTTTGGAGGGCCAAGG + Intergenic
1194933406 X:99916964-99916986 ATGTTACTTTAGGAGGCCTAAGG + Intergenic
1197874890 X:131091996-131092018 ATGTGGTATTTGGAGGGCAAGGG - Intergenic
1198143742 X:133833119-133833141 ATGTTTTTTCAGGAGGGAAATGG + Intronic
1199179489 X:144836550-144836572 TTGTATTTTTAGGAGGGACAGGG + Intergenic
1199765360 X:150937302-150937324 TTGTTATTTTTGTAGGGCCAGGG + Intergenic
1201226611 Y:11824702-11824724 ATTTTGTTTTAGTAGAGACAGGG - Intergenic