ID: 1142382242

View in Genome Browser
Species Human (GRCh38)
Location 16:89739509-89739531
Sequence GCTGATCCGGGGCCACACGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142382235_1142382242 9 Left 1142382235 16:89739477-89739499 CCTGTAAAAAGCGAAAGGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
1142382232_1142382242 26 Left 1142382232 16:89739460-89739482 CCCTGTGGGTGGAGGTACCTGTA 0: 1
1: 0
2: 1
3: 8
4: 148
Right 1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
1142382231_1142382242 30 Left 1142382231 16:89739456-89739478 CCAGCCCTGTGGGTGGAGGTACC 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
1142382233_1142382242 25 Left 1142382233 16:89739461-89739483 CCTGTGGGTGGAGGTACCTGTAA 0: 1
1: 0
2: 0
3: 11
4: 298
Right 1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142382242 Original CRISPR GCTGATCCGGGGCCACACGG AGG Exonic
900473001 1:2863749-2863771 GCAGGTCCGGGGCCACCCCGTGG + Intergenic
900647600 1:3715997-3716019 GGTGAGCAGGAGCCACACGGGGG - Intronic
908458852 1:64329903-64329925 GCTGCTCCGTGGGCACACTGGGG - Intergenic
1069944856 10:71978819-71978841 GCTGAGCAGGGGCCCCTCGGAGG - Intronic
1074871475 10:117579394-117579416 GCTGAGCAGGGGCCACATTGCGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076837160 10:133026974-133026996 GCTGCTCTGGGTCCACACCGAGG - Intergenic
1083265070 11:61542809-61542831 GCTGAGCCAGGGCCAGAAGGTGG - Intronic
1084961639 11:72719966-72719988 GCTGATCTGGGGCCTCCCTGGGG + Intronic
1091219158 11:133920246-133920268 GCTGAGCCGGGGGCGCACGGCGG - Exonic
1100565424 12:95790264-95790286 GCTGCTCTGGGGCTGCACGGTGG - Exonic
1102463022 12:113112023-113112045 GCTTGTCCGGGGTCACTCGGAGG - Intronic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1111888676 13:94054497-94054519 GCTGATACTGGGCCACACTTTGG + Intronic
1113437791 13:110307010-110307032 GCTGAGCCGGGGCCCCATGGTGG + Exonic
1113858163 13:113460845-113460867 GCTGAGCTGGGGCCACTCCGGGG - Intronic
1113969929 13:114181060-114181082 GCTACTCGGGGGCCACACTGGGG - Intergenic
1114554800 14:23555868-23555890 GCTGAACTGGGGCTACAAGGCGG - Intronic
1115307243 14:31945405-31945427 GCTGCTCCAGGGCCACACTTAGG + Intronic
1118168616 14:63362482-63362504 GCTGGGAAGGGGCCACACGGAGG - Intergenic
1121330443 14:93046334-93046356 GCTAGCCCGGGGCCCCACGGTGG + Intronic
1122602429 14:102928388-102928410 GCTGAGGCGGCGCCACGCGGGGG - Intronic
1125732858 15:41903854-41903876 GCTGAGCAGGGGCCACACGCTGG - Intronic
1129840528 15:78740639-78740661 GCTGCACCGGCTCCACACGGGGG - Intergenic
1132566424 16:625600-625622 GCAGAGCCGGGGCCACAGGAGGG - Intronic
1132987531 16:2775661-2775683 GGTGGTCCTGGGCCACACTGAGG - Intronic
1133121461 16:3611323-3611345 GCGGATCCGGATCCCCACGGTGG - Intronic
1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG + Exonic
1143141560 17:4744386-4744408 GCAGCTCCAGGGCCACATGGGGG - Exonic
1143610399 17:8014687-8014709 TCTGATCCGGGAGCGCACGGAGG + Exonic
1146968613 17:37054217-37054239 GCTGCTCCTGGGCCCCAGGGAGG + Intronic
1147401201 17:40180958-40180980 GCTGAGCCAGGCCCAGACGGGGG + Intronic
1147986048 17:44308459-44308481 GCAGAGCCCGGGCCCCACGGAGG - Intronic
1148052121 17:44774600-44774622 GCTGGGCGTGGGCCACACGGGGG - Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1151573818 17:74941301-74941323 GCTGACCCTGGGTCACACAGCGG + Intronic
1152065571 17:78110916-78110938 GAGGGTCTGGGGCCACACGGTGG + Exonic
1152237684 17:79147049-79147071 GCTGACCCCGGGACACCCGGAGG - Intronic
1152894052 17:82900205-82900227 GCAGATCAGGGGCCTCAGGGTGG - Intronic
1153784945 18:8526131-8526153 GCTGGGCCGGGGGCACACAGGGG + Intergenic
1155392714 18:25352271-25352293 GCGGATCCGGAGCCAGGCGGCGG + Intergenic
1157476509 18:48027414-48027436 GCTGATGGGGGGGAACACGGGGG + Exonic
1161486236 19:4537339-4537361 GCTGAGCCCTGGCCACACTGGGG - Exonic
1162381275 19:10333303-10333325 ACTGATCCGGGGCCTCCCGGGGG - Exonic
1162553157 19:11369598-11369620 GCTGATCATGGGCCACTGGGGGG + Intergenic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1168233590 19:55048235-55048257 GCTGATGGGAGGCCAAACGGTGG - Intronic
1168335124 19:55593043-55593065 GCTGCTCCTGGGCCCCGCGGGGG - Exonic
1168354519 19:55692900-55692922 GCTGAGGCGGGGCCCCAGGGAGG + Intronic
932441162 2:71736530-71736552 GCTGATCTCCAGCCACACGGCGG - Intergenic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
936556934 2:113503988-113504010 GCGGGTCCGGGGCCACAGGCTGG + Intergenic
944550966 2:200844579-200844601 GCTCATCCTGGGCCACACTCAGG - Intergenic
946329157 2:219000119-219000141 GCTGCTCCGCTGCCACAGGGCGG - Intergenic
948801922 2:240436917-240436939 GCTCCTCCGGGACCACAGGGAGG - Intronic
948886529 2:240887788-240887810 GCAGAGCCTGGGCCACAGGGAGG + Intronic
948911679 2:241008148-241008170 GCTGCTCCAGGGCCACCTGGGGG + Intronic
949032380 2:241803158-241803180 GCAGAGCCAGGGCCACACGCAGG - Intronic
1173691872 20:44966874-44966896 GCTGAGGCCGGGCCACTCGGGGG + Intronic
1175936611 20:62517193-62517215 GCTCAGCCAGGGCCTCACGGTGG + Intergenic
1178914280 21:36698300-36698322 GCTGAGCCAGGGTCACAGGGTGG - Intergenic
1179613673 21:42568067-42568089 GCTGCTCTGGGGCCTCAGGGAGG + Intronic
1180078870 21:45477354-45477376 GCAGAGCTGGGGCCACCCGGGGG + Intronic
1180079696 21:45481005-45481027 GCTGACTCGGGGCCACCCTGGGG + Intronic
1180090602 21:45531989-45532011 GCTGCTGCTGGGCCACTCGGTGG - Exonic
1180950610 22:19718949-19718971 GCAGGTCCGCGGCCCCACGGTGG + Intronic
1181968585 22:26673269-26673291 GCTAAGCCGGGGCCACACCTGGG + Intergenic
1182475221 22:30573495-30573517 GCTCATCCAGGCCCACACAGGGG - Intronic
1184238757 22:43200580-43200602 GCTGACCCTGGGCCTCAGGGCGG - Exonic
1184405467 22:44298315-44298337 GCCGATCAGGGGCCACACTTTGG - Intronic
1184754252 22:46507485-46507507 CCTGAGCCAGGGCCACACAGAGG - Intronic
1185054217 22:48569655-48569677 GCTGATCCTGGCTGACACGGGGG + Intronic
950206814 3:11087159-11087181 GCAGATCCTGGGCCAGAGGGTGG + Intergenic
950555812 3:13695342-13695364 GCTGAGGCTGGGACACACGGTGG + Intergenic
954176166 3:48847539-48847561 GCTGCTGCAGGGCTACACGGTGG - Exonic
954199952 3:49018255-49018277 GCAGCACCGGGGCCACACCGGGG + Exonic
954590626 3:51778670-51778692 CCTGATCCGGGGCCACTATGAGG - Exonic
956121509 3:65970853-65970875 GCTGATCCTTAGCCACACTGTGG - Intronic
969826781 4:9764095-9764117 GCGGCTCCAGGGGCACACGGAGG - Intergenic
983094786 4:163549098-163549120 GCTGATCAGGGACCACACTTTGG - Intronic
985174515 4:187187244-187187266 GCTGATCGGGGGCCACTTTGAGG - Intergenic
985733264 5:1563416-1563438 GCTGATGCGGCCCCACACGCTGG + Intergenic
989156773 5:38351877-38351899 ACTGATCCTGGGACACACAGTGG - Intronic
997692352 5:135835287-135835309 GCTGATCCCGGGGCGCAGGGTGG + Intronic
1006925191 6:37650121-37650143 GCTGCACCTGGGCCTCACGGGGG + Exonic
1007065534 6:38987193-38987215 TCTGAGCCGGGAGCACACGGAGG + Intronic
1019523910 7:1472276-1472298 GCTTTCCCGGGGCCAAACGGTGG - Exonic
1024044067 7:45575467-45575489 GCTGATGAGCGGCCAGACGGCGG + Intronic
1036654835 8:10671427-10671449 CCTGATCCGGGGTCAGAAGGGGG - Intronic
1037907681 8:22725042-22725064 GCTGATCTGGGGCCCCAGGGAGG - Intronic
1039955326 8:42202852-42202874 GCTGTTCCGGGAACACACGAAGG + Intronic
1045713563 8:105015031-105015053 GCTGGTCCAGGGCCAAAGGGAGG + Intronic
1049674901 8:143885061-143885083 GCTGAGGAGGAGCCACACGGGGG - Intergenic
1049896067 9:113313-113335 GCGGGTCCGGGGCCACAGGCTGG - Intergenic
1053274234 9:36771163-36771185 GCTGATCCAAGGTCACACAGGGG - Intergenic
1056680557 9:88714089-88714111 GCTGAGACGGGGCCACAGGATGG + Intergenic
1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG + Exonic
1060002182 9:119968791-119968813 GGTGAGCTGGGGCCACAGGGGGG + Intergenic
1060358309 9:122931357-122931379 GTTGATCCAGGGCCCCAGGGGGG + Intronic
1061872561 9:133528568-133528590 GCTGGTCCTGGGCCACGCTGGGG + Intronic
1062155710 9:135047049-135047071 GCTGATCCTGGGCAGCACTGGGG + Intergenic
1062517683 9:136944447-136944469 GCTGCTCCAGGGCCGCAGGGCGG - Intronic
1190304167 X:49072964-49072986 GCTGATGAGGGGCCCTACGGGGG - Intronic
1196812145 X:119637130-119637152 GCTGATTCGGGTCAACATGGAGG - Exonic
1200193152 X:154229836-154229858 GCAGAGCCGGGGCCACATTGTGG - Intronic
1200198907 X:154267640-154267662 GCAGAGCCGGGGCCACATTGTGG - Intronic