ID: 1142383285

View in Genome Browser
Species Human (GRCh38)
Location 16:89746202-89746224
Sequence CCGTCACGAGAGCATGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142383285 Original CRISPR CCGTCACGAGAGCATGACTG TGG (reversed) Intronic
910843527 1:91584247-91584269 CAGTCAGGAGAGAATGACAGTGG - Intergenic
914685593 1:149976104-149976126 CCGTGAGGAGAGCATGAGTTTGG - Intronic
919597449 1:199581323-199581345 CTGTCACGAGAACAGCACTGAGG - Intergenic
920367163 1:205454251-205454273 CAGTCACGTCAGCAGGACTGTGG + Intronic
923864643 1:237926944-237926966 CCGGCACAAGAGCATGATGGTGG + Intergenic
1071415349 10:85436137-85436159 GCCTCACTAGAGCAGGACTGAGG + Intergenic
1074156743 10:110806500-110806522 CTGTCACGAGAGTAGTACTGGGG + Intronic
1074277165 10:112014458-112014480 CCATCAGGAGAGCTTGATTGTGG + Intergenic
1083299918 11:61734948-61734970 CCTGGACGAGAACATGACTGCGG + Exonic
1098293009 12:68976520-68976542 CCTTCAAGATGGCATGACTGGGG + Intergenic
1102191342 12:110990953-110990975 CCATCACCAGAGCAGCACTGAGG - Intergenic
1113893898 13:113751605-113751627 CCGTCTCTACAGCGTGACTGTGG - Intergenic
1118999858 14:70872100-70872122 CTGTCACAAGAACATGCCTGTGG + Intergenic
1131427849 15:92361458-92361480 CCGTCATGAGTGCCTGGCTGCGG + Intergenic
1135185795 16:20314731-20314753 CAGTCACTGGAGCATGACTGAGG - Intronic
1137870475 16:51945545-51945567 CCCAAAAGAGAGCATGACTGGGG + Intergenic
1142186083 16:88695346-88695368 CCGTCACAAGGGCATGACCCTGG - Intergenic
1142383285 16:89746202-89746224 CCGTCACGAGAGCATGACTGTGG - Intronic
1148986911 17:51630484-51630506 CCTTCACGGGAGCATCACAGGGG + Exonic
1150778661 17:68101646-68101668 GCGGCACGGGAGCAGGACTGTGG - Intergenic
1158508306 18:58066853-58066875 CTATCACGAGAGCAACACTGAGG + Intronic
1163363226 19:16861178-16861200 CCCTCATGAGAGGAAGACTGTGG + Intronic
1165412862 19:35673156-35673178 CCGTCAGGGAAGCATCACTGGGG - Intronic
1166033497 19:40150460-40150482 CTATCACGAGAACAGGACTGAGG - Intergenic
945408155 2:209476166-209476188 CCTTCTCGAGACCATGATTGTGG + Intronic
947857757 2:233335803-233335825 CCTTCCCGGGAGCATGTCTGTGG + Intronic
948058642 2:235027835-235027857 ACCTAACGAGAGCATGTCTGGGG - Intronic
1174305746 20:49613183-49613205 CCGTCAGGTGAGCATGGCTGGGG + Intergenic
1177316003 21:19461951-19461973 CTGTCACGAGAACATTACGGGGG + Intergenic
1179470743 21:41608538-41608560 CTGTCACGAGAGCAGCACTTGGG + Intergenic
1179980595 21:44893719-44893741 CTGTCTCGAGGGCAGGACTGTGG - Intronic
1182654096 22:31876077-31876099 TTGTCTCCAGAGCATGACTGAGG + Intronic
951797625 3:26558359-26558381 CCTTCAGGAGAGCACTACTGAGG - Intergenic
977189518 4:93982073-93982095 CAGTTAAGAGAGCATTACTGAGG - Intergenic
983303165 4:165953437-165953459 CCGTCAAGAGAACATAGCTGAGG - Intronic
999100991 5:149026187-149026209 CTGTCACAGGATCATGACTGAGG - Intronic
1015329581 6:131961863-131961885 CCGTAAAGGAAGCATGACTGGGG - Intergenic
1015621615 6:135138007-135138029 ACGTCATGAGGTCATGACTGGGG - Intergenic
1016257667 6:142128081-142128103 CTGTCACAAGAGCAACACTGAGG - Intergenic
1025727749 7:64082549-64082571 CAGTGAGGAGAACATGACTGGGG + Intronic
1032007360 7:128313756-128313778 CCGTCACGAGAACAGCACTGAGG - Intronic
1035680169 8:1482117-1482139 CCGTCATGTGAGCATGACACGGG - Intergenic
1037839062 8:22231391-22231413 CCCACACATGAGCATGACTGCGG + Intronic
1042340156 8:67670375-67670397 CTATCACGAGAGCAGCACTGAGG + Intronic
1062683791 9:137799491-137799513 GCCTCACGAGTGAATGACTGGGG + Intronic
1188747554 X:33864629-33864651 GCTTCAGGAGAGCATGACTTTGG + Intergenic
1195427990 X:104756877-104756899 CTGAGACGAGAGCATGCCTGGGG + Intronic
1200234694 X:154462586-154462608 CTGCCACGAGAGCAGGCCTGGGG + Intronic