ID: 1142391012

View in Genome Browser
Species Human (GRCh38)
Location 16:89799980-89800002
Sequence CTTTTTTCCGAGACGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5061
Summary {0: 1, 1: 4, 2: 61, 3: 1380, 4: 3615}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142391012 Original CRISPR CTTTTTTCCGAGACGGAGTC TGG (reversed) Intronic
Too many off-targets to display for this crispr