ID: 1142396863

View in Genome Browser
Species Human (GRCh38)
Location 16:89837063-89837085
Sequence TTTCCAAAGCTGCCCGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142396862_1142396863 -10 Left 1142396862 16:89837050-89837072 CCAGGAATCTGTGTTTCCAAAGC 0: 1
1: 0
2: 3
3: 55
4: 378
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396861_1142396863 -9 Left 1142396861 16:89837049-89837071 CCCAGGAATCTGTGTTTCCAAAG 0: 1
1: 0
2: 11
3: 76
4: 656
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396854_1142396863 24 Left 1142396854 16:89837016-89837038 CCCCAGATTCCTGTTCTGTAGGT 0: 1
1: 0
2: 5
3: 27
4: 429
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396857_1142396863 15 Left 1142396857 16:89837025-89837047 CCTGTTCTGTAGGTCTTTGCAGG 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396852_1142396863 30 Left 1142396852 16:89837010-89837032 CCTGCACCCCAGATTCCTGTTCT 0: 1
1: 0
2: 3
3: 30
4: 354
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396855_1142396863 23 Left 1142396855 16:89837017-89837039 CCCAGATTCCTGTTCTGTAGGTC 0: 1
1: 0
2: 1
3: 13
4: 153
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396860_1142396863 -8 Left 1142396860 16:89837048-89837070 CCCCAGGAATCTGTGTTTCCAAA 0: 1
1: 0
2: 2
3: 37
4: 338
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126
1142396856_1142396863 22 Left 1142396856 16:89837018-89837040 CCAGATTCCTGTTCTGTAGGTCT 0: 1
1: 0
2: 3
3: 15
4: 200
Right 1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142396863 Original CRISPR TTTCCAAAGCTGCCCGTGCC TGG Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
900958989 1:5907359-5907381 GTTCCAGAGCTGCCCTGGCCAGG - Intronic
901050469 1:6423735-6423757 TTTCCAGTGCTGACTGTGCCAGG + Intronic
902740800 1:18436661-18436683 TTTCCACAGGTGCCCAAGCCAGG + Intergenic
903365521 1:22803193-22803215 ATTCCATAGCTGCCTGGGCCGGG + Intronic
905562978 1:38941831-38941853 GTTCCAAAGCTGCCCAGCCCAGG + Intergenic
905897500 1:41558197-41558219 TTCCCAATGCTGCCTGGGCCGGG - Intronic
907179496 1:52557212-52557234 TTACCAAATCTGCCTGTTCCAGG + Intergenic
907617993 1:55944296-55944318 TTTCCAAAGCCCATCGTGCCTGG + Intergenic
909464401 1:75957208-75957230 TCTCCAAAGCTAACCATGCCAGG + Intergenic
912275218 1:108250467-108250489 TTTTCAAATCTGCCCTTGCAGGG + Intergenic
912293004 1:108443882-108443904 TTTTCAAATCTGCCCTTGCAGGG - Intronic
912587489 1:110780215-110780237 GCTCCAGAGCTGCCCTTGCCTGG - Intergenic
915891320 1:159776729-159776751 TTCCCAAAGCTTCCCATGGCAGG + Intergenic
922541638 1:226424699-226424721 TTTCCAGAGTTGCCTGTGCTGGG - Intergenic
922634964 1:227159194-227159216 TTTCCAAAGTTGGCCGGGCACGG + Intronic
1069877969 10:71574706-71574728 CTTCCAAAGATGCCCTTGTCAGG - Intronic
1072608572 10:97002311-97002333 TTCCTACAGCTGCCAGTGCCAGG - Exonic
1074350596 10:112733118-112733140 ATTCCAGAGCTGAACGTGCCAGG - Intronic
1074586707 10:114774886-114774908 TGTCCAAAGATGCCCATGCCAGG + Intergenic
1074786806 10:116849082-116849104 TTGCTAAGGCCGCCCGTGCCAGG - Intergenic
1075299457 10:121308684-121308706 CTTCCAACGCTGCCTGTGTCAGG - Intergenic
1076257508 10:129039846-129039868 TGTTCAAAGCTGCCCTTTCCTGG - Intergenic
1076837948 10:133030457-133030479 TCTCCCAACCTGCCCGCGCCTGG - Intergenic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1078467126 11:11558699-11558721 TTTCCACAGCTTCCCTGGCCAGG + Intronic
1078887871 11:15523500-15523522 TTCCCAATGCTGGCCATGCCAGG + Intergenic
1080759675 11:35236480-35236502 ATTCCAGAGCTCCCTGTGCCTGG + Intergenic
1081616547 11:44594797-44594819 TTTCCAGAGCCGACCGGGCCGGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1088815083 11:113415266-113415288 CTTCAAAATCTGCCCTTGCCCGG + Intronic
1094053213 12:26243014-26243036 TTTCCAAAGCTGTTCTTACCAGG + Intronic
1094830238 12:34296866-34296888 TCTTCACAGCAGCCCGTGCCTGG + Intergenic
1095563306 12:43590888-43590910 TTTCCATATCTGCCTCTGCCTGG + Intergenic
1098029043 12:66235386-66235408 TTCCCAAAGCTGCCTCGGCCCGG - Intronic
1101315787 12:103627630-103627652 TTCCAAAAGCTGCCAGTGCCAGG + Intronic
1102199322 12:111046555-111046577 TGGCCAAAGCTGCCCCTCCCAGG + Intronic
1102588570 12:113940439-113940461 TTTCCAAGGCTTCCAGTGGCTGG + Intronic
1103418844 12:120763557-120763579 TTACCTAAGCAGCCCCTGCCTGG - Exonic
1105397503 13:20053319-20053341 TTTCAAAACCTTCCAGTGCCTGG + Intronic
1109184483 13:59252417-59252439 TTTCGAAAACTGCCCTGGCCTGG - Intergenic
1117521883 14:56559376-56559398 TTTTCAAAACTGCCCATTCCTGG - Intronic
1117699233 14:58396438-58396460 TTCCCTCAGCCGCCCGTGCCCGG + Intronic
1119334983 14:73825759-73825781 TTTCCAGAGCTGCCCATGGGGGG - Intergenic
1119488469 14:75008906-75008928 TTTCCATAGCTTCCCGTCCTTGG + Intronic
1119756401 14:77123057-77123079 TTCCATAAGCTGTCCGTGCCTGG + Intronic
1120407810 14:84110893-84110915 TTTCCAAGGCTGCTAGTGGCAGG - Intergenic
1121856163 14:97272062-97272084 TTTCAAAAACTTCCCATGCCTGG - Intergenic
1130775045 15:86970143-86970165 TTTCCAATGCTGCCTTGGCCTGG - Intronic
1132555037 16:568627-568649 CTTCCCAGGCTGCCCCTGCCAGG + Exonic
1135688181 16:24515061-24515083 CTTCCTAAGCTGCCCCTGCCTGG - Intergenic
1141174412 16:81709679-81709701 TTGCAGAAGCTGCCAGTGCCTGG - Intronic
1141878083 16:86840057-86840079 TCACCAAAGCTGCAGGTGCCTGG - Intergenic
1142210911 16:88808048-88808070 TTTCAAGTGCTGCCCGTGCAGGG + Intronic
1142382806 16:89743255-89743277 TTTCCTCAGTTGCCCATGCCTGG + Intronic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1144704039 17:17355746-17355768 TATCCAGAGCTGCCCAGGCCTGG + Intergenic
1145996841 17:29109800-29109822 TTTCCAGAGCTGGCCCTGCCCGG - Intronic
1147450203 17:40499650-40499672 TATAGAAAGCTTCCCGTGCCCGG - Intronic
1147725327 17:42563169-42563191 TCTCCAAAGCAGCCGGTGCGTGG + Exonic
1148208090 17:45792125-45792147 ATCCCTCAGCTGCCCGTGCCTGG + Intronic
1148798194 17:50207472-50207494 TGTCCAAAGGGGCCCCTGCCAGG - Intergenic
1150566018 17:66340900-66340922 TGTCAAAAGCTGCGAGTGCCAGG + Intronic
1151541751 17:74768164-74768186 TCTCCAAGGCTGCCTCTGCCAGG - Exonic
1151550209 17:74818344-74818366 TTTCCAAAGCCCTCCATGCCTGG + Intronic
1152430323 17:80245234-80245256 CGTCCAAAGCTGCCTGTGACCGG - Exonic
1159339803 18:67119853-67119875 TTTCCAATGCAGCCGCTGCCAGG + Intergenic
1160044707 18:75375910-75375932 TCTCCACACCTGCCTGTGCCAGG - Intergenic
1161729802 19:5952326-5952348 TTTCCAAATGAGCCCTTGCCTGG - Intronic
1163727651 19:18931921-18931943 TCTCCACAGTTGCCCGGGCCAGG + Intronic
1164998459 19:32740963-32740985 TTTCCATAGTTTCCCGTCCCAGG + Intronic
1165828527 19:38719188-38719210 TTCAGAAAGCTGCCAGTGCCTGG + Intronic
925102830 2:1263607-1263629 TTGCCAGAGCTGACCCTGCCAGG + Intronic
926682894 2:15677441-15677463 TTTCCAAAGCTGCCCAGAGCAGG + Intergenic
930618752 2:53622840-53622862 TGTCCAGGGCTGCCAGTGCCTGG - Intronic
931236042 2:60413376-60413398 TTGCCAAAGCTCCCCTAGCCAGG + Intergenic
937498212 2:122448730-122448752 TTTCCACAGATACCCTTGCCAGG - Intergenic
942182768 2:173396169-173396191 TTTCCATCCCTGCCAGTGCCTGG - Intergenic
942624358 2:177883761-177883783 TTTCCAAAGTTGCTAGTGCCTGG - Intronic
943386212 2:187206320-187206342 ATTCAAAGGCTTCCCGTGCCAGG + Intergenic
944847551 2:203683936-203683958 TTTCCAAAGCTGAAACTGCCTGG + Intergenic
947114897 2:226759077-226759099 TATCCAAAACTGCCTGTGTCCGG + Intronic
947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG + Intronic
1169360901 20:4948095-4948117 TTGCCAGAGCTGCCCCTGCTGGG + Intronic
1170780655 20:19422665-19422687 TTTTTAAAGCTCCCCCTGCCAGG - Intronic
1173416501 20:42861231-42861253 TTCCCAAAGTTGCCAGTCCCTGG + Intronic
1175878041 20:62239533-62239555 ATCCCAAAGCTGCCGGAGCCAGG - Intronic
1179211322 21:39327002-39327024 TTTCCACAGCTGCTCATCCCTGG - Intergenic
1180714296 22:17860882-17860904 TTTCTAAAGCTGCTTGTTCCTGG - Intronic
1183477425 22:38043172-38043194 TTTTCAGAGGTGCCCCTGCCTGG + Intergenic
1184393027 22:44216311-44216333 TTGCCAAAGCTGACTTTGCCTGG - Intronic
951528262 3:23674466-23674488 TTTCCAAAGCTACCTGGGGCTGG + Intergenic
952216511 3:31283411-31283433 TTACCATAGCTGCAGGTGCCTGG + Intergenic
953551725 3:43908490-43908512 TTTCCACAGCTGCCCTTCCAGGG + Intergenic
954441866 3:50526450-50526472 TTTCCAAGGCTGCCTCAGCCAGG + Intergenic
955970362 3:64432952-64432974 TTAGCACAGCTGCCCCTGCCAGG + Intronic
965704669 3:171494256-171494278 TTTAAACAGCTGCCCATGCCTGG - Intergenic
967216811 3:187218177-187218199 TTTCCAAAGCAGCACTTGGCAGG + Intronic
969864841 4:10068320-10068342 ATTCTAAAGCTGCCACTGCCTGG - Intergenic
970966910 4:21938241-21938263 TTTCCAAAGCAGTCTGTGCTTGG + Intronic
976691549 4:87872819-87872841 TTTCCAACTCTGCCACTGCCAGG + Intergenic
987083374 5:14446271-14446293 TCTCCAGTGCTGCCAGTGCCTGG - Intronic
990400351 5:55431192-55431214 TTTTCTAAGCTTCCTGTGCCTGG - Intronic
995182250 5:109239866-109239888 TTTCCAAATCTGTCTGGGCCAGG - Intergenic
995456131 5:112353986-112354008 TTTTCAAAGTTGCCTGTGTCTGG - Intronic
998136976 5:139679027-139679049 TTTCCAAGGCAGCCCATCCCGGG - Intronic
1002312982 5:178325798-178325820 TGTCCACAGCGGCCTGTGCCTGG + Intronic
1002799063 6:504014-504036 TGTCCAAAGAAGCCCGTGCTGGG + Intronic
1003545343 6:7053303-7053325 TTTCCAAATCATCACGTGCCTGG - Intergenic
1005362432 6:25043387-25043409 ATTCTAAAGCTGCCCCTGGCAGG + Intergenic
1006191237 6:32210832-32210854 ATTCCAAGGCAGCCTGTGCCAGG - Exonic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1011853318 6:91657623-91657645 TTTCCAAAGCTGCCAGTCCAAGG + Intergenic
1015590983 6:134822977-134822999 GTTCCAAATCTGCCCCTCCCTGG - Intergenic
1016341421 6:143065272-143065294 TTTCCAAAGTTGTCCATGTCAGG - Intronic
1017712404 6:157182410-157182432 TTTTCAAAGCTGTCAGTACCTGG + Intronic
1018712430 6:166506480-166506502 TTTCCAAAGATGCTGGAGCCTGG - Intronic
1021898171 7:25257112-25257134 TTCCCAGAGCTGGCCCTGCCTGG - Intergenic
1022273528 7:28833756-28833778 TCTCCAAATCCCCCCGTGCCAGG + Intergenic
1022539559 7:31123364-31123386 TCCCCAAAGCTGCTAGTGCCAGG + Intergenic
1033755773 7:144397493-144397515 TTGCCAGAGCTGCCCTTCCCTGG - Exonic
1034464298 7:151217294-151217316 ATTCCAAAGCTGCACCTGTCAGG - Intronic
1035689794 8:1552519-1552541 TTTTCAAAGATGCCTGTGCAGGG + Intronic
1036613023 8:10366228-10366250 TTCCCCAAGCTGCCTTTGCCTGG - Intronic
1037724796 8:21474244-21474266 TCTCCAGAGCTGGACGTGCCTGG - Intergenic
1041811112 8:61911280-61911302 TCTCCAAAGCTGCAGGTGCTCGG + Intergenic
1047878939 8:129171264-129171286 TTTCCAGTTCTGCCCCTGCCAGG - Intergenic
1048149208 8:131877235-131877257 TTTTAAAAGCTGCACGTGACAGG + Intergenic
1048940270 8:139394521-139394543 CTTCCAAAGCTGTCCCTGCCAGG + Intergenic
1051553328 9:18355069-18355091 TTTCCAAATCTGCTCTTGCTGGG - Intergenic
1052890603 9:33695922-33695944 TTTTCAATGCTCCCAGTGCCAGG - Intergenic
1055020262 9:71662072-71662094 TTTCACAAGCTGCCCCTTCCTGG - Intergenic
1056672296 9:88640479-88640501 TTGCCAAAGCCTCCCGAGCCTGG - Intergenic
1189304775 X:39978857-39978879 TTTCCACAGCTGCCCAAGCATGG + Intergenic
1196236837 X:113291694-113291716 TTTCCAATGCTTCCTGTGGCTGG - Intergenic
1200117500 X:153775757-153775779 TTTCCAAAGCCCCCCTTGCCGGG - Intronic