ID: 1142396865

View in Genome Browser
Species Human (GRCh38)
Location 16:89837075-89837097
Sequence CCACGCGACGGGCCAGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142396865_1142396874 11 Left 1142396865 16:89837075-89837097 CCCGTGCCTGGCCCGTCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1142396874 16:89837109-89837131 GCAGGTCTTCTCCCTCGAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1142396865_1142396875 19 Left 1142396865 16:89837075-89837097 CCCGTGCCTGGCCCGTCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1142396875 16:89837117-89837139 TCTCCCTCGAGCAGGACTCGAGG No data
1142396865_1142396873 -7 Left 1142396865 16:89837075-89837097 CCCGTGCCTGGCCCGTCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1142396873 16:89837091-89837113 CGCGTGGGTTCTGGAATTGCAGG 0: 1
1: 1
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142396865 Original CRISPR CCACGCGACGGGCCAGGCAC GGG (reversed) Intronic
900923024 1:5685635-5685657 CTCCGGGCCGGGCCAGGCACTGG + Intergenic
901174036 1:7285509-7285531 CCATGAGACAGGCGAGGCACTGG - Intronic
904054251 1:27659839-27659861 CCCCGCGGCGGGCCGGGCACAGG - Intergenic
904858528 1:33518002-33518024 CCACGTGAGCGGCCATGCACAGG + Intronic
906680139 1:47720603-47720625 CCAGGCCCTGGGCCAGGCACAGG + Intergenic
911589025 1:99725260-99725282 CCAACCGACGGGCCATGGACTGG - Intronic
915163857 1:153937525-153937547 CTACGGGAAGGGCCTGGCACAGG + Exonic
920434130 1:205937283-205937305 CCAGGCGAGGGGCTGGGCACAGG - Intronic
923034959 1:230279353-230279375 CCGTGCGACTGTCCAGGCACAGG - Exonic
1064274235 10:13891882-13891904 CCATGCGGCGGGCCGGGCGCGGG - Intronic
1067375941 10:45727620-45727642 CAACGGGACGGGCCAGGTGCAGG - Intronic
1067883643 10:50068308-50068330 CAACGGGACGGGCCAGGTGCAGG - Intronic
1072816850 10:98517887-98517909 CCAAGAGATGGGCCTGGCACAGG + Intronic
1076141343 10:128080807-128080829 CCTCGCCACGGGCCAGGCATTGG - Intronic
1077228591 11:1448874-1448896 CCACACCACGGCCCAGGCCCCGG - Intronic
1088779273 11:113118624-113118646 CCACGAATCGGGCCAGGCACTGG - Intronic
1091732349 12:2890611-2890633 CCGCGCGGCGGGCGAGGCCCAGG + Intronic
1103477698 12:121230724-121230746 CCACGCCATGGGCCAGGCCTGGG - Intronic
1104356218 12:128089390-128089412 CCACACAATTGGCCAGGCACAGG + Intergenic
1106425541 13:29625278-29625300 CCAGGGGAAGGGCCAGCCACAGG + Intergenic
1111354280 13:87079215-87079237 CCAGGCGCCGGCACAGGCACCGG + Intergenic
1113697143 13:112354601-112354623 CCATCAGACGGGCCTGGCACGGG + Intergenic
1123002010 14:105300822-105300844 CCGCGGGATGGGACAGGCACCGG + Exonic
1131827414 15:96332187-96332209 CCGGGCGGCGGGCCGGGCACGGG - Exonic
1132913102 16:2325944-2325966 CCACGCGGCTGGGCAGGCAGGGG - Intronic
1133128613 16:3662789-3662811 ACACCCAACGGGCCAGGTACTGG + Exonic
1136127319 16:28193549-28193571 CCACCCCACTGGCGAGGCACTGG + Intronic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1141827976 16:86494293-86494315 CCCCGCCACAGGCCTGGCACCGG - Intergenic
1142396865 16:89837075-89837097 CCACGCGACGGGCCAGGCACGGG - Intronic
1143266565 17:5642431-5642453 CCAGGCCACCTGCCAGGCACTGG + Intergenic
1143503281 17:7351125-7351147 GCATGCGACGTGCCAGGCCCTGG + Intronic
1144328912 17:14206928-14206950 CCACGCGCCGGCACAGGCCCGGG - Exonic
1144580041 17:16453417-16453439 CCACGCACAGGGCCAGGCTCGGG + Intronic
1148052586 17:44776427-44776449 CCAGGCACCGGGCCAGGCGCTGG - Intronic
1160841678 19:1149200-1149222 CCACCCCACGGGCCAGGTCCAGG - Intronic
1161020779 19:2010429-2010451 CTGCGCGACGGTCCAGACACTGG + Intronic
1161267122 19:3369554-3369576 CCACTCGGCGGGCCGGGCCCGGG - Intronic
1164624139 19:29715311-29715333 CCACGCGCCGGGCCAGCTCCTGG + Intronic
1165755747 19:38291799-38291821 CCTCAGGACGGGCCAGGCAAGGG - Intronic
1165900679 19:39167883-39167905 CCACGCGCTGTGCCAGGCGCGGG + Intronic
1168057733 19:53872800-53872822 CCACCCCTCTGGCCAGGCACAGG - Intronic
926142740 2:10377874-10377896 CAAGGGGACGGGGCAGGCACAGG + Intronic
927200545 2:20575591-20575613 CCAGGTGAGGAGCCAGGCACTGG + Intronic
934574596 2:95392033-95392055 CCCAGGGAGGGGCCAGGCACAGG + Intergenic
1173580801 20:44145185-44145207 CCAGGAGCAGGGCCAGGCACTGG + Intronic
1175062830 20:56259268-56259290 CCAGGTTGCGGGCCAGGCACTGG - Intergenic
1175214158 20:57381748-57381770 CCACATCACGGGCCAGCCACAGG - Intergenic
1175702190 20:61147633-61147655 CCCCGCCACATGCCAGGCACTGG + Intergenic
1176367860 21:6044623-6044645 CCAGGTGAGGGGCCAGCCACAGG - Intergenic
1178962012 21:37073683-37073705 CCACGCACCGGCCGAGGCACGGG - Intronic
1179464099 21:41560211-41560233 CCACGCTCTGGGCAAGGCACTGG + Intergenic
1179755659 21:43493919-43493941 CCAGGTGAGGGGCCAGCCACAGG + Intergenic
1180609135 22:17084737-17084759 AGGCGCGACGGGCCAGGCCCAGG + Intergenic
1183310460 22:37106869-37106891 CCAGGCGACCTGCCAGGCACTGG + Intronic
1183521867 22:38300333-38300355 CCACGGGGTGGGCCAGGCAAGGG - Intronic
1183667893 22:39255742-39255764 GCAGGGGACGGGGCAGGCACAGG + Intergenic
1184260522 22:43312762-43312784 GCACGTGCCAGGCCAGGCACAGG - Intronic
1184432532 22:44449867-44449889 CCAGGCTCTGGGCCAGGCACTGG - Intergenic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
953127628 3:40107194-40107216 CCAGGCACCAGGCCAGGCACTGG + Intronic
955010999 3:55014174-55014196 CCATGCTAAGGGCCTGGCACAGG + Intronic
963666809 3:148198437-148198459 CCCCACGACAGGCCAGGCCCCGG + Intergenic
968552694 4:1231830-1231852 CCACATGAAGGGCCAGGCCCAGG + Intronic
968701218 4:2059118-2059140 CAGCGCGAGGGGCCCGGCACGGG - Intergenic
968962024 4:3750518-3750540 CCAGGCCCTGGGCCAGGCACAGG + Intergenic
969409452 4:7018518-7018540 CCAGGCATGGGGCCAGGCACTGG - Intronic
978245216 4:106563876-106563898 CGACCCTCCGGGCCAGGCACAGG + Intergenic
985630965 5:1013784-1013806 CCACGCCACTGGCCAGCCTCCGG - Intronic
999325285 5:150639931-150639953 CCACGTGACTGGCCCTGCACTGG + Intronic
999663530 5:153890150-153890172 CAACACCATGGGCCAGGCACTGG + Intergenic
1002939675 6:1705125-1705147 CCACATGTCAGGCCAGGCACTGG + Intronic
1003165881 6:3677970-3677992 GGACCCGCCGGGCCAGGCACGGG + Intergenic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1006389834 6:33751806-33751828 CCACCCAACGGGGAAGGCACGGG + Intergenic
1007702247 6:43771987-43772009 ACACGCGGCCGGCCAGGCCCGGG - Intronic
1018652734 6:166005521-166005543 CCACGCGTGGGTGCAGGCACCGG + Intergenic
1019217336 6:170452347-170452369 CCACGCGCAGGCCCAGGCAGGGG - Intergenic
1019889227 7:3932726-3932748 CCACAGAACGAGCCAGGCACAGG - Intronic
1023880877 7:44320825-44320847 CCCCACCTCGGGCCAGGCACTGG + Intronic
1029250819 7:99234885-99234907 CACCGCGCCCGGCCAGGCACTGG + Intergenic
1033278720 7:139990917-139990939 CCTCCCGACGGTGCAGGCACGGG + Intronic
1033794598 7:144832800-144832822 CCACCCAAGAGGCCAGGCACTGG + Intronic
1035534624 8:381712-381734 CCACGCCCGTGGCCAGGCACTGG + Intergenic
1040604813 8:48921336-48921358 CATCGCGGCGGGCCAGGCTCGGG + Exonic
1050514652 9:6430297-6430319 CCACATTAAGGGCCAGGCACAGG - Intronic
1053472580 9:38357545-38357567 CCAGGCTCTGGGCCAGGCACAGG - Intergenic
1057815656 9:98292190-98292212 GCACGTGAGTGGCCAGGCACTGG - Intronic
1058574819 9:106389326-106389348 CCAAGATATGGGCCAGGCACTGG + Intergenic
1061199543 9:129129120-129129142 CCACAGGACAGGCCAGGGACTGG + Intronic
1062413199 9:136434880-136434902 CCAAGCTCAGGGCCAGGCACAGG + Intronic
1185456140 X:311771-311793 CCACGCGTCGGGTCTGGCCCGGG - Intronic
1185643421 X:1600601-1600623 CCACGTGTCCGGCCAGGCTCAGG + Intronic
1185832593 X:3316363-3316385 TCACACACCGGGCCAGGCACAGG + Intronic